Molecular Identification and Prevalence of the Mite Carpoglyphus lactis (Acarina: Carpoglyphidae) in Apis mellifera in the Republic of Korea
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Samples and Detection of Astigmatid Mites in Honeybees
2.2. Total Nucleic Acid Extraction
2.3. Amplification of Astigmatid Mite-Specific Genes Using Polymerase Chain Reaction
2.4. Phylogenetic Analysis and Statistical Analysis
3. Results
3.1. Molecular Identification of Carpoglyphus lactis Mites in Honeybee Colonies
3.2. Similarities of COI Gene Sequence of Astigmatid Mites in Honeybee Colonies
3.3. Prevalence of Carpoglyphus lactis Mite in Korean Honeybee Colonies
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Truong, A.-T.; Yoo, M.-S.; Seo, S.K.; Hwang, T.J.; Yoon, S.-S.; Cho, Y.S. Prevalence of honey bee pathogens and parasites in South Korea: A five-year surveillance study from 2017 to 2021. Heliyon 2023, 9, e13494. [Google Scholar] [CrossRef] [PubMed]
- Klein, A.-M.; Vaissière, B.E.; Cane, J.H.; Steffan-Dewenter, I.; Cunningham, S.A.; Kremen, C.; Tscharntke, T. Importance of pollinators in changing landscapes for world crops. Proc. R. Soc. B 2007, 274, 303–313. [Google Scholar] [CrossRef]
- Mutinelli, F.; Pinto, A.; Barzon, L.; Toson, M. Some Considerations about Winter Colony Losses in Italy According to the Coloss Questionnaire. Insects 2022, 13, 1059. [Google Scholar] [CrossRef] [PubMed]
- Johannesen, J.; Wöhl, S.; Berg, S.; Otten, C. Annual fluctuations in winter colony losses of Apis mellifera L. are predicted by honey flow dynamics of the preceding year. Insects 2022, 13, 829. [Google Scholar] [CrossRef] [PubMed]
- Gray, A.; Adjlane, N.; Arab, A.; Ballis, A.; Brusbardis, V.; Bugeja Douglas, A.; Cadahia, L.; Charriere, J.D.; Chlebo, R.; Coffey, M.F.; et al. Honey bee colony loss rate in 37 countries using the COLOSS survey for winter 2019–2020: The combined effects of operation size, migration and queen replacement. J. Apic. Res. 2023, 62, 204–210. [Google Scholar] [CrossRef]
- Chantawannakul, P.; de Guzman, L.I.; Li, J.; Williams, G.R. Parasites, pathogens, and pests of honeybees in Asia. Apidologie 2016, 47, 301–324. [Google Scholar] [CrossRef]
- Chantawannakul, P.; Ramsey, S.; Khongphinitbunjong, K.; Phokasem, P. Tropilaelaps mite: An emerging threat to European honey bee. Curr. Opin. Insect Sci. 2018, 26, 69–75. [Google Scholar] [CrossRef] [PubMed]
- Denmark, H.A.; Cromroy, H.L.; Sanford, M.T. Honey Bee Tracheal Mite, Acarapis woodi (Rennie) (Arachnida: Acari: Tarsonemidae); University of Florida, IFAS Extension: Gainesville, FL, USA, 2000. [Google Scholar] [CrossRef]
- Sammataro, D.; Gerson, U.; Needham, G. Parasitic mites of honey bees: Life history, implications, and impact. Annu. Rev. Entomol. 2000, 45, 519–548. [Google Scholar] [CrossRef] [PubMed]
- Emmanouel, N.G.; Pelekassis, C.D.; Santas, L.A. Harmful mesostigmatic mites ectoparasitic to honey bees. Entomol. Hell. 1983, 1, 17–23. [Google Scholar] [CrossRef]
- Truong, A.-T.; Yoo, M.-S.; Yun, B.-R.; Kang, J.E.; Noh, J.; Hwang, T.J.; Seo, S.K.; Yoon, S.-S.; Cho, Y.S. Prevalence and pathogen detection of Varroa and Tropilaelaps mites in Apis mellifera (Hymenoptera, Apidae) apiaries in South Korea. J. Apic. Res. 2023, 62, 804–812. [Google Scholar] [CrossRef]
- Nguyen, T.-T.; Yoo, M.-S.; Truong, A.-T.; Lee, J.H.; Youn, S.Y.; Lee, S.-J.; Kim, D.-H.; Yoon, S.-S.; Cho, Y.S. First identification of Tyrophagus curvipenis (Acari: Acaridae) and pathogen detection in Apis mellifera colonies in the Republic of Korea. Sci. Rep. 2023, 13, 9469. [Google Scholar] [CrossRef] [PubMed]
- Jung, C.; Lee, M.L. Beekeeping in Korea: Past, present, and future challenges. In Asian Beekeeping in the 21st Century; Chantawannakul, P., Williams, G., Neumann, P., Eds.; Springer: Singapore, 2018; pp. 175–197. [Google Scholar]
- Ahn, A.J.; Ahn, K.S.; Noh, J.H.; Kim, Y.H.; Yoo, M.S.; Kang, S.W.; Yo, D.H.; Shin, S.S. Molecular prevalence of Acarapis mite infestations in honey bees in Korea. Korean J. Parasitol. 2015, 53, 315–320. [Google Scholar] [CrossRef] [PubMed]
- Bowman, C. Variation in the trophic morphology of Astigmatid mites common in UK beehives. Acarologia 2023, 63, 4–16. [Google Scholar] [CrossRef]
- Hubert, J.; Nesvorna, M.; Kopecký, J.; Ságová-Marečková, M.; Poltronieri, P. Carpoglyphus lactis (Acari: Astigmata) from various dried fruits differed in associated micro-organisms. J. Appl. Microbiol. 2015, 118, 470–484. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Z. A new species of Carpoglyphidae from China (Acarina: Acaroidea). J. Jiang Univ. 1991, 15, 82–86. [Google Scholar]
- Chmielewski, W. Morphological and bio-ecological characteristics of Carpoglyphus lactis found in natural honey, warehouses and beehives. Pszczel. Zesz. Naukowe 1970, 14, 109–127. [Google Scholar]
- Clark, J.M. A new species of Carpoglyphus (Astigmatina: Carpoglyphidae) from the bark of black beech (Nothofagus) honeydew in New Zealand. Int. J. Acarol. 2010, 36, 453–459. [Google Scholar] [CrossRef]
- Haragsim, O.; Samšiňák, K.; Vobrázková, E. The mites inhabiting the beehives in ČSR. Z. Angew. Entomol. 1978, 87, 52–67. [Google Scholar] [CrossRef]
- Vijayakumar, K.; Muthuraman, M.; Jayaraj, R. Infestation of Carpoglyphus lactis (Linnaeus)(Acari: Carpoglyphidae) on Trigona iridipennis (Apidae: Meliponinae) from India. Sch. J. Agric. Sci. 2013, 3, 25–28. [Google Scholar]
- Baker, E.; Delfinado, M. Notes on the driedfruit mite Carpoglyphus lactis (Acarina: Carpoglyphidae) infesting honeybee combs. J. Apic. Res. 1978, 17, 52–54. [Google Scholar] [CrossRef]
- Zhang, Z.-Q. New Zealand records of Carpoglyphus lactis (Acari: Carpoglyphidae). Syst. Appl. Acarol. 2012, 17, 239–240. [Google Scholar] [CrossRef]
- Zhang, K.; Zhang, Z.-Q. The dried fruit mite Carpoglyphus lactis (Acari: Carpoglyphidae) is a suitable alternative prey for Amblyseius herbicolus (Acari: Phytoseiidae). Syst. Appl. Acarol. 2021, 26, 2167–2176. [Google Scholar] [CrossRef]
- Hughes, A.M. The Mites of Stored Food and Houses, 2nd ed.; Her Majesty’s Stationery Office: London, UK, 1976. [Google Scholar]
- Chmielewski, W. Bionomics of Carpoglyphus lactis (Acari: Carpoglyphidae) on honey. In Ecology and Evolution of the Acari, 3rd ed.; Bruin, J., van der Geest, L.P.S., Sabelis, M.W., Eds.; Spinger: Dordrecht, The Netherlands, 1999; pp. 423–424. [Google Scholar]
- Zander, E. Handbook of Beekeeping in Individual Representations. Diseases and Pests of Adult Bees; Verlag Eugen Ulmer: Stuttgart, Germany, 1947. [Google Scholar]
- Yang, B.; Cai, J.; Cheng, X. Identification of astigmatid mites using ITS2 and COI regions. Parasitol. Res. 2011, 108, 497–503. [Google Scholar] [CrossRef] [PubMed]
- Hall, T. BioEdit Version 7.0.0. 2004. Distributed by the Author, Website. Available online: www.mbio.ncsu.edu/BioEdit/bioedit.html (accessed on 7 February 2004).
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Chmielewski, W. Stored products mites (Acaroidea) in Polish bee hives. In Modern Acarology, Proceedings of the 8 International Congress of Acarology, held in Ceske Budejovice, Czechoslovakia, 6–11 August 1990; Dusbabek, F., Bukva, V., Eds.; SPB Academic Publishing bv: The Hague, The Netherlands, 1991; pp. 615–619. [Google Scholar]
- Dabert, M.; Witalinski, W.; Kazmierski, A.; Olszanowski, Z.; Dabert, J. Molecular phylogeny of acariform mites (Acari, Arachnida): Strong conflict between phylogenetic signal and long-branch attraction artifacts. Mol. Phylogenet. Evol. 2010, 56, 222–241. [Google Scholar] [CrossRef]
Name of Primers | Sequences (5’→ 3’) | Amplicon Size (bp) | Note | References |
---|---|---|---|---|
COI–For | GTTTTGGGATATCTCTCATAC | 377 | Used for Astigmatid mite detection | [28] |
COI–Rev | GAGCAACAACATAARAAGTATC | |||
CL-For | CTTGAATTTGTAGAATGGA | 1242 | Used for C. lactis mite detection | This study |
CL-Rev | CTAATCGAGGTGTCCGAGGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nguyen, T.-T.; Yoo, M.-S.; Lee, H.-S.; Youn, S.-Y.; Lee, S.-J.; Seo, S.-K.; Kim, J.; Cho, Y.-S. Molecular Identification and Prevalence of the Mite Carpoglyphus lactis (Acarina: Carpoglyphidae) in Apis mellifera in the Republic of Korea. Insects 2024, 15, 271. https://doi.org/10.3390/insects15040271
Nguyen T-T, Yoo M-S, Lee H-S, Youn S-Y, Lee S-J, Seo S-K, Kim J, Cho Y-S. Molecular Identification and Prevalence of the Mite Carpoglyphus lactis (Acarina: Carpoglyphidae) in Apis mellifera in the Republic of Korea. Insects. 2024; 15(4):271. https://doi.org/10.3390/insects15040271
Chicago/Turabian StyleNguyen, Thi-Thu, Mi-Sun Yoo, Hyang-Sim Lee, So-Youn Youn, Se-Ji Lee, Su-Kyoung Seo, Jaemyung Kim, and Yun-Sang Cho. 2024. "Molecular Identification and Prevalence of the Mite Carpoglyphus lactis (Acarina: Carpoglyphidae) in Apis mellifera in the Republic of Korea" Insects 15, no. 4: 271. https://doi.org/10.3390/insects15040271