Enhancing Honey Bee Health: Evaluating Pollen Substitute Diets in Field and Cage Experiments
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Preparation of Pollen Substitute Diet
2.2. Field Experiment Design
2.3. Field Experiment
2.4. Cage Experiment
2.5. Free Amino Acid Analysis
2.6. RNA Extractions and Quantitative PCR (qPCR)
2.7. Statistical Analyses
3. Results
3.1. Colony Population
3.2. Capped Brood Area
3.3. Consumption and Preference
3.4. Colony Weight
3.5. Honey Production
3.6. Hygienic Behavior
3.7. Dried Head and Thorax Weights
3.8. Vitellogenin (vg) Gene Expression Level
3.9. Cage Experiments
3.10. Amino Acid Content Analysis
3.11. Discrimination of Diet Effects by Canonical Discriminant Analysis and Principle Component Analysis
3.12. Heat Map Depicting the Effect of Pollen Substitute Diets
4. Discussion
5. Conclusions
6. Patents
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Williams, I.H. The dependence of crop production within the European union on pollination by honey bees. Agric. Zool. Rev. 1994, 6, 229–257. [Google Scholar]
- Eilers, E.J.; Kremen, C.; Smith Greenleaf, S.; Garber, A.K.; Klein, A.M. Contribution of pollinator-mediated crops to nutrients in the human food supply. PLoS ONE 2011, 6, e21363. [Google Scholar] [CrossRef] [PubMed]
- Steinhauer, N.; Kulhanek, K.; Antúnez, K.; Human, H.; Chantawannakul, P.; Chauzat, M.P.; van Engelsdorp, D. Drivers of colony losses. Curr. Opin. Insect Sci. 2018, 26, 142–148. [Google Scholar] [CrossRef] [PubMed]
- Potts, S.G.; Biesmeijer, J.C.; Kremen, C.; Neumann, P.; Schweiger, O.; Kunin, W.E. Global pollinator declines: Trends, impacts, and drivers. Trends Ecol. Evol. 2010, 25, 345–353. [Google Scholar] [CrossRef]
- Theisen-Jones, H.; Bienefeld, K. The Asian honey bee (Apis cerana) is significantly in decline. Bee World 2016, 93, 90–97. [Google Scholar] [CrossRef]
- Goulson, D.; Nicholls, E.; Botías, C.; Rotheray, E.L. Bee declines driven by combined stress from parasites, pesticides, and lack of flowers. Science 2015, 347, 1255957. [Google Scholar] [CrossRef]
- Requier, F.; Odoux, J.F.; Henry, M.; Bretagnolle, V. The carry-over effects of pollen shortage decrease the survival of honeybee colonies in farmlands. J. Appl. Ecol. 2017, 54, 1161–1170. [Google Scholar] [CrossRef]
- Saffari, A.; Kevan, P.G.; Atkinson, J.L. Palatability and consumption of patty-formulated pollen and pollen substitutes and their effects on honeybee colony performance. J. Apic. Sci. 2010, 54, 63–71. [Google Scholar]
- Jehlík, T.; Kodrík, D.; Krištůfek, V.; Koubová, J.; Sábová, M.; Danihlík, J.; Tomčala, A.; Čapková Frydrychová, R. Effects of Chlorella sp. On biological characteristics of the honey bee Apis mellifera. Apidologie 2019, 50, 564–577. [Google Scholar] [CrossRef]
- Ricigliano, V.A.; Williams, S.T.; Oliver, R. Effects of different artificial diets on commercial honey bees colony performance, health biomarkers, and gut microbiota. BMC Vet. Res. 2022, 18, 52. [Google Scholar] [CrossRef]
- Szczesna, T. Protein content and amino acid composition of bee-collected pollen from selected botanical origins. J. Apic. Sci. 2006, 50, 81–90. [Google Scholar]
- Corby-Harris, V.; Snyder, L.; Meador, C.; Ayotte, T. Honey bee (Apis mellifera) nurses do not consume pollens based on their nutritional quality. PLoS ONE 2018, 13, e0191050. [Google Scholar] [CrossRef]
- Gardener, M.C.; Gillman, M.P. Analyzing variability in nectar amino acids: Composition is less variable than concentration. J. Chem. Ecol. 2001, 27, 2545–2558. [Google Scholar] [CrossRef]
- Standifer, L.N.; Moeller, F.E.; Kauffeld, N.M.; Herbert, E.W.J.; Shimanuki, H. Supplemental feeding of honey bee colonies. Ann. Entomol. Soc. Am. 1977, 70, 691–693. [Google Scholar] [CrossRef]
- Noordyke, E.R.; Ellis, J.D. Reviewing the Efficacy of Pollen Substitutes as a Management Tool for Improving the Health and Productivity of Western Honey Bee (Apis mellifera) Colonies. Front. Sustain. Food Syst. 2021, 5, 772897. [Google Scholar] [CrossRef]
- Jung, C.; Bae, Y.H. Production and characteristics of winter generation honey bees, Apis mellifera: Discussion with overwintering failure. J. Apic. 2022, 37, 265–274. [Google Scholar]
- Wu, G. Amino Acids: Biochemistry and Nutrition; CRC Press: Boca Raton, FL, USA, 2013. [Google Scholar]
- Frunze, O.; Kim, H.; Lee, J.H.; Kwon, H.W. The Effects of Artificial Diets on the Expression of Molecular Marker Genes Related to Honey Bee Health. Int. J. Mol. Sci. 2024, 25, 4271. [Google Scholar] [CrossRef]
- Groot, A.P.D. Protein and amino acid requirements of the honeybee (Apis mellifica L.). Physiol. Comp. Oecologia 1953, 3, 1–83. [Google Scholar]
- Ren, C.S.; Chang, Z.M.; Han, L.; Chen, X.S.; Long, J.K. Higher Essential Amino Acid and Crude Protein Contents in Pollen Accelerate the Oviposition and Colony Foundation of Bombus breviceps (Hymenoptera: Apidae). Insects 2023, 14, 203. [Google Scholar] [CrossRef]
- Glavinic, U.; Stankovic, B.; Draakovj, V.; Stevanovj, J.; Petrovj, T.; Lakic, N.; Stanimirovi, Z. Dietary amino acid and vitamin complex protects honey bees from immunosuppression caused by Nosema ceranae. PLoS ONE 2017, 12, e0187726. [Google Scholar] [CrossRef]
- Bertazzini, M.; Medrzycki, P.; Bortolotti, L.; Maistrello, L.; Forlani, G. Amino acid content and nectar choice by forager honeybees (Apis mellifera L.). Amino Acids 2010, 39, 315–318. [Google Scholar] [CrossRef]
- González-Teuber, M.; Heil, M. Nectar chemistry is tailored for both attraction of mutualists and protection from exploiters. Plant Signal. Behav. 2009, 4, 809–813. [Google Scholar] [CrossRef] [PubMed]
- Rathman, E.S.; Lanza, J.; Wilson, J. Feeding preferences of flesh flies (Sarcophaga bullata) for sugar-only vs. sugar amino acid nectars. Am. Midl. Nat. 1990, 124, 379–389. [Google Scholar] [CrossRef]
- Nepi, M.; Soligo, C.; Nocentini, D.; Abate, M.; Guarnieri, M.; Cai, G.; Bini, L.; Puglia, M.; Bianchi, L.; Pacini, E. Amino acids and protein profile in floral nectar: Much more than a simple reward. Flora Morphol. Distrib. Funct. Ecol. Plants 2012, 207, 475–481. [Google Scholar] [CrossRef]
- Kim, H.; Frunze, O.; Maigoro, A.Y.; Lee, M.L.; Lee, J.H.; Kwon, H.W. Comparative Study of the Effect of Pollen Substitute Diets on Honey Bees during Early Spring. Insects 2024, 15, 101. [Google Scholar] [CrossRef]
- Noordyke, E.R.; van Santen, E.; Ellis, J.D. Tracing the fate of pollen substitute patties in Western honey bee (Hymenoptera: Apidae) colonies. J. Econ. Entomol. 2021, 114, 1421–1430. [Google Scholar] [CrossRef]
- Morais, M.M.; Turcatt, A.P.; Pereira, R.A.; Francoy, T.M.; Guidugli-Lazzarini, K.R.; Goncalves, L.S.; de Almeida, J.; Ellis, J.D.; de Jong, D. Protein levels and colony development of Africanized and European honey bees fed natural and artificial diets. Genet. Mol. Res. 2013, 12, 6915–6922. [Google Scholar] [CrossRef] [PubMed]
- Ling, T.C.; Phokasem, P.; Sinpoo, C.; Chantawannakul, P.; Khongphinitbunjong, K.; Disayathanoowat, T. Tropilaelaps mercedesae Infestation Is Correlated with Injury Numbers on the Brood and the Population Size of Honey Bee Apis mellifera. Animals 2023, 13, 1318. [Google Scholar] [CrossRef]
- Delaplane, K.S.; van der Steen, J.; Guzman-Novoa, E. Standard methods for estimating strength parameters of Apis mellifera colonies. J. Apic. Res. 2013, 52, 1–12. [Google Scholar] [CrossRef]
- Topal, E.; Mărgăoan, R.; Bay, V.; Takma, Ç.; Yücel, B.; Oskay, D.; Düz, G.; Acar, S.; Kösoğlu, M. The effect of supplementary feeding with different pollens in autumn on colony development under natural environment and in vitro lifespan of honey bees. Insects 2022, 13, 588. [Google Scholar] [CrossRef]
- Akyol, E.; Unalan, A.; Yeninar, H.; Ozkok, D.; Ozturk, C. Comparison of colony performances of anatolian, caucasian and carniolan honeybee (Apis mellifera L.) genotypes in temperate climate conditions. Ital. J. Anim. Sci. 2014, 13, 3409. [Google Scholar] [CrossRef]
- DeGrandi-Hoffman, G.; Chen, Y.; Rivera, R.; Carroll, M.; Chambers, M.; Hidalgo, G.; de Jong, E.W. Honey bee colonies provided with natural forage have lower pathogen loads and higher overwinter survival than those fed protein supplements. Apidologie 2016, 47, 186–196. [Google Scholar] [CrossRef]
- Omar, E.M.; Darwish, H.Y.A.; Othman, A.A.; El-Seedi, H.R.; Al Naggar, Y. Crushing corn pollen grains increased diet digestibility and hemolymph protein content while decreasing honey bee consumption. Apidologie 2022, 53, 52. [Google Scholar] [CrossRef]
- Ketnawa, S.; Ogawa, Y. Evaluation of protein digestibility of fermented soybeans and changes in biochemical characteristics of digested fractions. J. Funct. Foods 2019, 52, 640–647. [Google Scholar] [CrossRef]
- Slansky, F.; Scriber, J.M. Food consumption and utilization. Compar. Insect Physiol. Biochem. Pharm. 1985, 4, 87–163. [Google Scholar]
- Association of Official Analytical Chemists (AOAC). Official Methods of Analysis, 15th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 1990; Volume 1. [Google Scholar]
- Kim, H.J.; Hwang, J.; Ullah, Z.; Mustafa, B.; Kwon, H.W. Comparison of physicochemical properties of pollen substitute diet for honey bees (Apis mellifera). J. Asia-Pac. Entomol. 2022, 25, 101967. [Google Scholar] [CrossRef]
- Lim, S.; Jung, J.; Yunusbaev, U.; Ilyasov, R.; Kwon, H.W. Characterization and its implication of a novel taste receptor detecting nutrients in the honey bee, Apis mellifera. Sci. Rep. 2019, 9, 11620. [Google Scholar] [CrossRef]
- Tharwat, A.; Gaber, T.; Ibrahim, A.; Hassanien, A.E. Linear discriminant analysis: A detailed tutorial. AI Commun. 2017, 30, 169–190. [Google Scholar] [CrossRef]
- Ariza, G.; Arbulu, A.A.; González, N.; Jurado, J.M.L.; Bermejo, J.V.D.; Vallejo, M.E.C. Data mining-based discriminant analysis as a tool for the study of egg quality in native hen breeds. Sci. Rep. 2022, 12, 15873. [Google Scholar] [CrossRef]
- Mukaka, M.M. Statistics corner: A guide to appropriate use of correlation coefficient in medical research. Malawi Med. J. 2012, 24, 69–71. [Google Scholar]
- Hinkle, D.E.; Wiersma, W.; Jurs, S.G. Applied Statistics for the Behavioral Sciences, 5th ed.; Houghton Mifflin: Boston, MA, USA, 2003; p. 756. [Google Scholar]
- Höcherl, N.; Siede, R.; Illies, I.; Gätschenberger, H.; Tautz, J. Evaluation of the nutritive value of maize for honey bees. J. Insect Physiol. 2012, 58, 278–285. [Google Scholar] [CrossRef]
- Sun, G.Y.; Hu, X.; Yu, J.; Wang, H.F.; Liu, Z.G.; Xu, B.H. Effects of dietary arginine on physiological function of Apis mellifera ligustica worker bee larvae. Chin. J. Anim. Nutr. 2022, 34, 3918–3929. [Google Scholar]
- Negri, P.; Ramirez, L.; Quintana, S.; Szawarski, N.; Maggi, M.; Le Conte, Y.; Lamattina, L.; Eguaras, M. Dietary Supplementation of Honey Bee Larvae with Arginine and Abscisic Acid Enhances Nitric Oxide and Granulocyte Immune Responses after Trauma. Insects 2017, 8, 85. [Google Scholar] [CrossRef]
- Carlesso, D.; Smargiassi, S.; Pasquini, E.; Bertelli, G.; Baracchi, D. Nectar non-protein amino acids (NPAAs) do not change nectar palatability but enhance learning and memory in honey bees. Sci. Rep. 2021, 11, 11721. [Google Scholar] [CrossRef]
- Tafi, E.; Sagona, S.; Meucci, V.; Bortolotti, L.; Galloni, M.; Bogo, G.; Gatta, D.; Casini, L.; Barberis, M.; Nepi, M.; et al. Effect of amino acid enriched diets on hemolymph amino acid composition in honey bees. Arch. Insect Biochem. Physiol. 2024, 115, e22085. [Google Scholar] [CrossRef]
- Stanimirović, Z.; Glavinić, U.; Ristanić, M.; Jelisić, S.; Vejnović, B.; Niketić, M.; Stevanović, J. Diet Supplementation Helps Honey Bee Colonies in Combat Infections by Enhancing their Hygienic Behaviour. Acta Vet. 2022, 72, 145–166. [Google Scholar] [CrossRef]
- Colin, T.; Lim, M.Y.; Quarrell, S.R.; Allen, G.R.; Barron, A.B. Effects of thymol on European honey bee hygienic behaviour. Apidologie 2019, 50, 141–152. [Google Scholar] [CrossRef]
- Peixoto, L.G.; Calábria, L.K.; Garcia, L.; Capparelli, F.E.; Goulart, L.R.; de Sousa, M.V.; Espindola, F.S. Identification of major royal jelly proteins in the brain of the honeybee Apis mellifera. J. Insect Physiol. 2009, 55, 671–677. [Google Scholar] [CrossRef]
- Ramanathan, A.N.K.G.; Nair, A.J.; Sugunan, V.S. A review on Royal Jelly proteins and peptides. J. Funct. Foods 2018, 44, 255–264. [Google Scholar] [CrossRef]
- Haydak, M.H. Honey bee nutrition. Annu. Rev. Entomol. 1970, 15, 143–156. [Google Scholar] [CrossRef]
- Renzi, M.T.; Rodríguez-Gasol, N.; Medrzycki, P.; Porrini, C.; Martini, A.; Burgio, G.; Maini, S.; Sgolastra, F. Combined effect of pollen quality and thiamethoxam on hypopharyngeal gland development and protein content in Apis mellifera. Apidologie 2016, 47, 779–788. [Google Scholar] [CrossRef]
- Nelson, C.M.; Ihle, K.E.; Fondrk, M.K.; Page, R.E., Jr.; Amdam, G.V. The Gene vitellogenin Has Multiple Coordinating Effects on Social Organization. PLoS Biol. 2007, 5, e62. [Google Scholar] [CrossRef]
- Zayed, A.R.G. Understanding the relationship between brain gene expression and social behavior: Lessons from the honey Bee. Annu. Rev. Genet. 2012, 46, 591–615. [Google Scholar] [CrossRef] [PubMed]
- Rana, A.; Singh, G.; Gupta, G. Prospects of probiotics in beekeeping: A review for sustainable approach to boost honeybee health. Arch. Microbiol. 2024, 206, 205. [Google Scholar]
Ingredients | Diet 1 | Diet 2 | Diet 3 |
---|---|---|---|
Brewer’s yeast | 39.69 | 39.69 | 39.69 |
Egg yolk powder | 2.21 | 2.21 | 2.21 |
Defatted soybean powder | - | 2.21 | - |
Sugar | 35.36 | 35.36 | 35.36 |
Boiled water | 7.16 | 7.16 | 5.16 |
Canola oil | 1.01 | 1.01 | 1.01 |
Cellulose | 0.88 | 0.88 | 0.88 |
Wheat bran powder | 0.88 | 0.88 | 0.88 |
Multiple vitamins | 0.44 | 0.44 | 0.44 |
L-methionine | 0.10 | 0.10 | 0.10 |
L-lysine | 0.24 | 0.24 | 0.24 |
Citric acid | 1.85 | 1.85 | 1.85 |
Tangerine juice | 4.00 | 4.00 | 10.00 |
Soytide powder | 2.21 | - | 2.21 |
Apple juice | 4.00 | 4.00 | - |
Chlorella powder | 0.08 | - | - |
Gene | Primer Sequence (5′-3′) | Size (bp) | |
---|---|---|---|
vg | F R | GTTGGAGAGCAACATGCAGA TCGATCCATTCCTTGATGGT | 150 |
ß-actin | F R | AGGAATGGAAGCTTGCGGTA AATTTTCATGGTGGATGGTGC | 181 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, H.; Frunze, O.; Lee, J.-H.; Kwon, H.-W. Enhancing Honey Bee Health: Evaluating Pollen Substitute Diets in Field and Cage Experiments. Insects 2024, 15, 361. https://doi.org/10.3390/insects15050361
Kim H, Frunze O, Lee J-H, Kwon H-W. Enhancing Honey Bee Health: Evaluating Pollen Substitute Diets in Field and Cage Experiments. Insects. 2024; 15(5):361. https://doi.org/10.3390/insects15050361
Chicago/Turabian StyleKim, Hyunjee, Olga Frunze, Jeong-Hyeon Lee, and Hyung-Wook Kwon. 2024. "Enhancing Honey Bee Health: Evaluating Pollen Substitute Diets in Field and Cage Experiments" Insects 15, no. 5: 361. https://doi.org/10.3390/insects15050361