Next Article in Journal
Spatial Characteristics and Driving Forces of the Water Footprint of Spring Maize Production in Northern China
Next Article in Special Issue
A Novel PCR-Based Functional Marker of Rice Blast Resistance Gene Pi25
Previous Article in Journal
An Empirical Investigation of the “Mezzogiorno Trap” in China’s Agricultural Economy: Insights from Data Envelopment Analysis (2015–2021)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agriculture
Volume 13
Issue 9
10.3390/agriculture13091807
agriculture-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Breeding of Zheyou810, an Indica–Japonica Hybrid Rice Variety with Superior Quality and High Yield

by
Jian Song
,
Yongtao Cui
,
Honghuan Fan
,
Liqun Tang
and
Jianjun Wang
*
Zhejiang Academy of Agricultural Sciences, Hangzhou 310022, China
*
Author to whom correspondence should be addressed.
Agriculture 2023, 13(9), 1807; https://doi.org/10.3390/agriculture13091807
Submission received: 23 August 2023 / Revised: 3 September 2023 / Accepted: 7 September 2023 / Published: 13 September 2023
(This article belongs to the Special Issue Innovations and Advances in Rice Molecular Breeding)
Browse Figures
Review Reports Versions Notes

Abstract

:
Rice heterosis has played a significant role in improving rice yields in China since the 1970s. The utilization of heterosis between the indica and japonica subspecies of rice is especially important in this regard. However, inter-subspecies hybridization between indica and japonica rice is hampered by the inadequate seed-setting rate and inferior rice quality of hybrid offspring, which has limited its development. The discovery and cloning of wide-compatibility gene S5-n and the granular starch synthase gene Wx have provided a solution to this problem, paving the way for the breeding of inter-subspecies hybrid rice. Here we demonstrated the breeding process of Zheyou810 and its performances in regional trials. Employing marker-assisted selection through the utilization of KASP (Kompetitive Allele-Specific PCR), a high-yielding and superior-quality indica–japonica hybrid rice variety named Zheyou810 was developed. Zheyou810 achieved an average yield of 10,737.75 kg/ha (12.58% higher than control Jiayou5) in the national regional trials across 2019 and 2020, and 11,777.25 kg/ha (13.36% higher than Jiayou5) in the production trial in 2020, respectively. The quality of rice has also been improved, reaching the standards set by the Ministry of Agriculture of the People’s Republic of China for Grade 3 premium rice (NY/T593). In 2021, Zheyou810 was approved by the national examination showing broad application prospects.

1. Introduction

Over the past four decades, substantial advancements have been made in harnessing heterosis among rice varieties. However, the practical application of heterosis among rice subspecies in production has been impeded by hybrid incompatibility. The primary challenge stems from the limited cloning and utilization of genes controlling the fertility of indica–japonica hybrids.
In the 1980s, Japanese scholars identified a phenomenon known as “wide-compatibility” rice, which exhibited a significantly higher seed setting rate when crossbred with both indica and japonica rice [1]. Despite this discovery, the specific gene responsible for this trait remained elusive, with speculation centered on the S5 gene region of the wide-compatibility rice variety. A breakthrough occurred in 2008 when Academician Zhang’s team identified the S5 gene, later featured as the cover story in PNAS [2]. Their pioneering research, titled “A killer-protector system regulates both hybrid sterility and segregation distortion in rice,” was successfully published in the journal “Science” in 2012, This publication successfully unveiled the mechanism behind the reproductive isolation between the rice indica and japonica subspecies [3].
The S5-n gene encodes an aspartyl protease that influences the fertility of female gametes and the seed setting rate in rice [2]. Further investigations revealed that the S5 locus encompasses three alleles: S5-i, an indica allele; S5-j, a japonica allele; and S5-n, a neutral allele. In indica and japonica rice, the S5-i and S5-j proteins exhibit two amino acid variations, contributing to hybrid sterility and the establishment of reproductive isolation, distinguishing the indica and japonica subspecies. However, the presence of the S5-n allele acts as a bridge, facilitating gene flow between these two subspecies. Generally, hybrids with the genotype S5-i/S5-j tend to be a predominantly sterile, whereas hybrids with genotypes containing S5-n along with either S5-i or S5-j tend to be predominantly fertile [3]. In 2023, the research team led by Jianmin Wan successfully identified the main locus RSH12, responsible for the occurrence of hybrid pollen sterility in the context of inter-subspecies hybridization between indica and japonica rice in the journal “Cell”. This locus comprises two closely linked genes informally named “destroyers” and “guardians”. The “destroyers” negatively impact the fertility of all pollen, resulting in sterility. They were found to interact with a vital protein within the mitochondria, the cell’s energy factory, disrupting its energy generation capacity, leading to pollen sterility. Conversely, the “guardians” interact with the “destroyers”, preventing their entry into the mitochondria and neutralizing their detrimental effects. Additionally, the “guardians” transport the “destroyers” to the autophagosome, a cellular organelle responsible for degradation, thus eliminating their negative impact and ensuring the normal pollen development. Interestingly, the functional types of this gene are inherited only by some indica rice farmers, while japonica rice farmers may not have inherited this functional type due to geographical differences. As these genes are unevenly distributed among rice species or subspecies, the phenomenon of pollen sterility after their hybridization is common [4].
With the continuous improvement in living standards, the demand for high-quality rice, especially in terms of taste and cooking quality, has been on the rise. Rice taste quality has become a pivotal factor for consumers when purchasing rice. This quality of rice is primarily determined by the expression of the wax gene (Wx), which regulates amylose content. Japanese scientist Yoshio Sano’s discovery of the Wx gene in 1984,marked a significant milestone [5], leading to the identification of multiple alleles, including Wxa, Wxb, Wxin, Wxop, Wxhp, Wxmq, and Wxmp [6,7,8,9,10,11]. In non-glutinous varieties, the Wx gene exhibits two allelic variants, Wxa and Wxb. In indica rice, Wxa is the predominant variant, contributing to higher amylose content, which yields firmer and less sticky cooked rice. In contrast, in japonica rice, Wxb is the prevalent variant, leading to lower amylose content, and resulting in stickier and softer cooked rice. Sequence analysis reveals that compared to Wxa, Wxb undergoes a specific genetic mutation, where a G nucleotide is replaced with a T nucleotide at the 5’ splice site of the first intron, causing a reduction in intron 1 splicing efficiency and abnormal splicing, ultimately leading to decreased amylose content [6,11,12]. Even within the F2 generation of indica–japonica hybrid rice, which displays the same F1 phenotype, there can be significant variability in amylose content, potentially impacting a significant impact in the taste and texture of cooked rice [11,13]. Therefore, the selection and breeding of parents with the desired Wx gene isotype based on molecular markers play a pivotal role in enhancing the hybrid rice’s quality.
To generate an indica–japonica hybrid rice variety that exhibits high yield and superior quality, our initial focus was on developing a restorer line which carries the S5-n and Wxb alleles using KASP marker-assisted selection. Subsequently, the new indica–japonica hybrid rice Zheyou810 was developed through breeding with the new indica restorer Zhehuizhi810 and the japonica CMS line Zhe08A. Finally, Zheyou810 participated in the official trials of “single-season late japonica rice in the Yangtze River middle and lower reaches” in 2019 and 2020. The variety underwent official evaluations for yield, grain quality, and other agronomic characteristics.

2. Materials and Methods

2.1. Plant Materials

The new hybrid rice variety Zheyou810 was developed through a cross between the cytoplasmic male sterile japonica line Zhe08A and the indica restorer line Zhehuizhi810. Both parent lines carried the favorable allele Wxb at the Wx locus for low amylose content but contained different alleles at S5 locus. Zhehuizhi810 was created from an indica cross of F1317 and H702. F1317 is a high-yield restorer line with the S5-n allele, while H702 is a superior-quality restorer line with the Wxb allele. The allelic information at the S5 and Wx loci of the aforementioned parents and hybrid variety are listed in Table 1.

2.2. Development of KASP Markers

In order to identify any genetic alterations at the S5 and Wx loci, two KASP markers were devised. Based on the analysis of approximately 200 bp of DNA sequences flanked both upstream and downstream the SNP locus, KASP primers were crafted in accordance with established protocols using Primer 3 [14]. The conventional fluorescence probes, including FAM (5′-GAAGGTGACCAAGTTCATGCT-3′) and HEX (5′-GAAGGTCGGAGTCAACGGATT-3′), were used alongside an allele-specific primer targeting the SNP in the 3′ end (Table 2).

2.3. DNA Isolation and KASP Genotyping

Rice penultimate leaves (1–2 cm in size) were collected during the heading stage and placed into a 96-well plate. The plate was freeze-dried for 24 h. Two steel beads were added to each well, and a 2 min grinding step was performed. Next, 400 μL of DNA buffer was added, followed by incubation in a 55 °C water bath for 20 min. After the incubation period, 400 μL of isopropanol was added and carefully mixed to ensure thorough integration. The sample was then centrifuged at 3700 rpm for 20 min, followed by supernatant discarding and 1000 μL of 75% ethanol adding. Another 10 min centrifugation step at 3700 rpm followed, and the supernatant was discarded. The sample was air-dried and rehydrated with 200 μL of molecular-grade water. The DNA concentration was calibrated to a final concentration of 50 ng/μL using the precise measurements obtained from Nanodrop One C-1000 spectrophotometer (Thermo Fisher, Wilmington, NC, USA).
For KASP genotyping, a PCR instrument was employed using 96-well plates. The included reaction mix was prepared by combining 2 μL DNA, which was adjusted to a concentration of 50 ng/μL, with 5 μL of 2× KASP Master Mix. Additionally, 0.14 μL of each KASP primer was included in the mixture. Fluorescence signals post-PCR were measured using a plate reader. Wx and S5 SNPs were genotyped using the KASP assay, with distinct color codes for homozygous genotypes. The KASP assays were conducted by Shanghai Bay Gene Bio technologies Limited (Shanghai, China). The genotyping data obtained were visualized utilizing SNP viewer2 (LGC Limited, Cambridge, UK).

2.4. Experiment Field Management and Investigation of Agronomic Characteristics and Rice Quality

The parent materials, namely F1317, H702, and Zhehuizhi810, were cultivated in a research field situated at Zhejiang Academy of Agricultural Sciences (30°27′ N, 120°14′ E, Zhejiang) during both summer and winter seasons, as well as in Lingshui (18°50′ N, 109°94′ E, Hainan). In the years 2019 and 2020, hybrid Zheyou810 seeds participated in the single-season late japonica rice trials organized by the National Joint Organization. The control variety used for comparison was Jiayou 5. According to the requirements of the national regional trials, Zheyou810 was tested at 10 locations across provinces (please refer to Table S1 for site information). Each trial site featured 3 randomly arranged plots, with 240 plants per plot. The agronomic characteristics such as growing period, effective panicles, plant height, panicle length, number of filled grains per panicle, seed setting rate, thousand grain weight, and yield data were recorded and compiled into reports by each trial site according to national standards.
The rice samples for rice quality were obtained by cultivating and harvesting seeds from experimental plots managed by Wuhu Qingyi River Seed Industry Co., Ltd. (Wuhai, China), the Crop Institute of Shanghai Academy of Agricultural Sciences, and Zhejiang Academy of Agricultural Sciences in both 2019 and 2020. Rice quality analysis was outsourced to the Center for Food Quality Supervision and Testing (Wuhan) Ministry of Agriculture and Rural Affairs PRC.

2.5. Data Statistical Analysis

Experimental data were statistically analyzed using Excel (Microsoft, Albuquerque, NM, USA) and SPSS11.5 software (IBM, Armonk, NY, USA). One-way ANOVA was conducted to analyze the variance, and the t-test was utilized at significance levels of p < 0.05 and p < 0.01.

3. Results

3.1. Molecular Marker-Assisted Selection of Restorer Line Zhehuizhi810

The breeding process of the restorer line Zhehuizhi810 is depicted in Figure 1 and described in detail below.
In the year 2013, the female progenitor, a highly productive restorer line named F1317 was employed as the female progenitor, while the indica restorer line H702 served as the male counterpart, culminating in a hybrid creation. The resulting first-generation (F1) progeny was meticulously nurtured as a single plant in Hainan during the spring season of 2014. Subsequently, for the second-generation (F2), seeds were obtained through a combination of direct seeding and mixed harvesting in Hangzhou during the summer of 2014. The third-generation (F3) seeds were reaped in Hainan during the spring of 2015, leading to the cultivation of a fourth-generation (F4) single-plant population in Hangzhou during the summer of 2015. Among these, a total of 93 plants exhibiting superior agronomic traits were selected for genotyping using S5 and Wx.
The S5 KASP marker classified the 93 plants into three groups, with 8 plants having the T/T genotype (S5-i) with a red signal as H702; 82 plants having the G/G genotype (S5-n) with a blue signal as F1317; one plant having the G/T genotype (S5-i/S5-n) with a purple signal; and two plants which could not be genotyped. Similarly, the Wx KASP marker divided the 93 individual plants into three groups: 9 plants had the G/G genotype (Wxa) with a red signal as F1317; 69 plants had the T/T genotype (Wxb) with a blue signal as H702; and 15 plants had the G/T genotype (Wxb/Wxa) with a purple signal. Subsequently, 62 individual plants were found to carry both Wxb and S5-n alleles, making them suitable as intermediate materials for breeding a new variety in the next generation. In the winter of 2015, the selected 62 individual plants were re-verified using S5 KASP and Wx KASP, and the results showed that both S5-n and Wxb were present (Figure 2).
Meanwhile, the above 62 candidate restorer lines were firstly crossed with Zhe08A during the spring of 2016. Subsequently, in the summer of the same year, extensive evaluations were conducted to assess the yield and rice quality of the resulting combinations. To be deemed successful, these combinations needed to satisfy special criteria: a yield increase of more than 10% compared to the control Jiayou5, and rice quality meeting the Grade 3 standard set by the relevant government department. Among the various crosses, the 10th restorer line exhibited exceptional performance when paired with Zhe08A. It not only surpassed the yield requirements but also met the specified rice quality standards. As a result of its exceptional performance, this particular combination was given the distinguished name of Zhehuizhi810.

3.2. Breeding of Indica–Japonica Hybrid Rice Zheyou810

During the spring of 2017, the initial stages of Zheyou810’s small-scale seed production commenced in Hainan. This process involved the restorer line Zhehuizhi810 and the male-sterile line Zhe08A. The seeds harvested from this endeavor were subsequently utilized for both autonomous regional trials and official trials. In the summers of 2017 and 2018, an initial two-year autonomous evaluation trial of Zheyou810 was conducted, yielding impressive results in terms of yield. This led to its recommendation for inclusion in official trials. In 2019, Zheyou810 participated for the first time in the official organization’s trials specifically focused on the single-season late japonica rice in the middle and lower reaches of the Yangtze River. Throughout these trials, Zheyou810 exhibited exceptional comprehensive traits and successfully met the synchronization requirements between regional and production trials. Continuing into the following year, 2020, Zheyou810 simultaneously engaged in the second year of regional and production trials, consistently delivering outstanding performance when compared to control Jiayou5 and meeting the rigorous approval standards. By 2021, the remarkable performance of Zheyou810 had gained recognition and approval from the National Variety Approval Committee, earning the designation of National Approval for Rice 20210385 (Figure 3). This marked a significant milestone in the journey of Zheyou810, affirming its excellence and potential contribution to the rice cultivation industry.

3.3. Production Performance and Agronomic Traits of Zheyou810

In the period from 2019 to 2020, Zheyou810 underwent national single-season late japonica rice regional trials, participating in a total of 10 regional trials spread across five provinces (Table S1). Remarkably, this variety showed a remarkable increase in yield production throughout these trials. In 2019, Zheyou810 exhibited a significant yield increase of 13.07% compared to Jiayou5, and in 2020, it continued to impress with a yield increase of 12.09%, both of which were considered highly significant (Figure 4). Over the course of the two-year evaluation, the average yield of Zheyou810 reached 10,737.75 kg/ha, which was 12.58% higher than that of the control Jiayou5. It is worth mentioning that all trials showed increasing production (Table S2). During the production trials in 2020, Zheyou810 continued to shine with an average yield of 11,777.25 kg/ha, which was 13.36% higher than that of Jiayou5, with all trials increasing production (Table S3). These findings further reinforced the exceptional yield potential of Zheyou810.
In the study conducted between 2019 and 2020, a total of 240 plants underwent cultivation across 10 distinct trial zones, each with three repetitions. The main focus was to analyze the agronomic characteristics of Zheyou810. When combining data from both years, it was observed that Zheyou810 displayed comparable effective panicle counts and fruiting rates to the control Jiayou5, measuring at 243.0 × 104/ha and 82.2%, respectively. However, Zheyou810 exhibited a longer average growth period of 153.2 days over the two-year span, which surpassed Jiayou5 by 4.4 days. Furthermore, Zheyou810 showcased elevated plant height, longer panicles, and a higher grain count per panicle in comparison to Jiayou5. The measurements were recorded at 125.5 cm for plant height, 22.0 cm for panicle length, and 229.9 grains per panicle, respectively. These distinctive traits contribute to the high yield potential of Zheyou810, despite its slightly lower thousand-grain weight of 24.7 g compared to the control variety Jiayou5 (Table 3).

3.4. Rice Quality of Zheyou810

Wxa regulates the development of elevated amylose content, resulting in rice typically containing over 25% amylose, with some varieties reaching beyond 30%. On the other hand, Wxb predominantly appears in glutinous rice variants, which exhibit significantly lower amylose content compared to rice strains containing Wxa that typically ranges between 15% to 18%. According to the cooking rice variety quality standards set forth in the People’s Republic of China’s agricultural industry (NY/T 593-2021), rice amylose content falling within the 13–20% range qualifies as premium quality rice, and a range of 13–18% designates it as Grade 1 premium quality rice. In the years 2019 and 2020, Zheyou810 underwent comprehensive analysis and evaluation conducted by the Center for Food Quality Supervision and Testing (Wuhan) Ministry of Agriculture and Rural Affairs PRC. The determined amylose content stood at 16.6% and 15.7%, respectively, both aligning with the benchmark for Grade 1 premium quality rice. Furthermore, Zheyou810 exhibited a commendable head rice rate and transparency that fulfilled the criteria for Grade 1 premium quality rice. The two-year assessment yielded results for other essential rice quality indicators: gel consistency at 61 mm and 77 mm, alkali dissipation value at 6.2 and 6.1, and chalkiness degree at 3.6% and 4.6%, which fulfilled the criteria for Grade 3 premium quality rice. These findings finally led to the classification of Zheyou810 as a third-tier edible rice variety (Table 4).

4. Discussion

The KASP marker technology has revolutionized breeding programs due to its efficient and precise detection of genetic variations, significantly impacting various crops such as cotton, maize, soybean, and wheat, where it has played a crucial role in the development of new varieties possessing improved traits [15]. For instance, researchers Rasheed et al. identified a major QTL linked to grain yield in wheat using KASP markers [16], and Jagtap et al. used KASP markers to expedite the breeding of heat-resilient maize [17]. A study successfully developed and validated a KASP assay linked to low Kunitz trypsin inhibitor (KTI) levels in soybean seeds, which holds promise for marker-assisted breeding to facilitate the incorporation of low KTI content in soybean seeds [18]. In cotton, ten validated KASP markers have been used to enhance Verticillium wilt resistance [19]. Additionally, this technology has also made notable strides in rice breeding programs, where it has been used to identify markers associated with disease resistance, grain quality, and yield-related traits. For example, several studies have reported the successful use of KASP markers for identifying blast resistance genes, including Pi2 and Pi9 [20,21]. KASP markers have also been utilized to identify markers associated with other important diseases, such as bacterial blight [22] and bakanae disease [23]. Additionally, KASP markers have been used to identify markers associated with grain quality, such as amylose content [24,25,26], cooking quality [27], and aroma [28,29]. In this study, KASP markers were employed to screen restorer lines of the Wxb type with low amylose content, which has subsequently led to significant enhancements in rice quality. Moreover, KASP markers have been utilized to identify genetic markers that are closely linked to yield-related traits in rice. For example, KASP markers have been used to identify markers linked to panicle length [30,31], grain size [32], and grain weight [33]. This study mainly uses KASP markers to improve yield by enhancing seed setting rate, a significant yield-related trait.
The S5-n gene has been successfully applied since its cloning in 2008. This gene fragment deletion is a common genetic variation that is widely present in wide-compatibility rice and exhibits certain genetic diversity. Therefore, using the S5-n gene fragment deletion as a molecular marker, it is possible to genotype different individuals in an F2 population, study the relationship between genotype and phenotype, and also evaluate and screen rice germplasm resources. The marker has also been used to distinguish F2 strains from a high-generation stable indica restorer line and to detect hybrid rice materials [34]. The wide-compatibility characteristics and resilience of three indica–japonica intermediary wide-compatibility restorer lines, CH58, C84, and C927, have also been studied [35]. The lines were found to carry the S5-n gene and exhibit higher seed-setting rates than the control japonica restorer line, indicating the potential for improved fertility in indica–japonica hybrids [32]. Furthermore, the broad-compatibility gene S5-n has been introduced into the maintainer line Zhen5B and the restorer line SIR2622 using molecular marker-assisted breeding, resulting in significant improvements in the fertility of indica–japonica hybrids [36]. Based on the research conducted, it is evident that the introduction of the S5-n molecular marker into restorer lines improves the hybrid vigor of the indica–japonica hybrid F1. To enhance the selection efficiency of S5-n and minimize costs, this study developed a high-throughput KASP marker for S5-n detection. Subsequently, the selected restorer lines with the S5-n molecular marker were crossed with the sterile japonica line Zhe08A. As a result, a new variety called Zheyou810 was successfully bred, which displayed normal fertility and excellent comprehensive traits, laying the foundation for subsequent high-energy detection of S5-n.
The “Waxy gene” (Wx) plays a pivotal role in controlling amylose content, and its multiple alleles have led to improvements in rice quality [11,37,38,39]. In order to address the issue of high amylose content, the Wxa gene was replaced with the Wxb gene using molecular markers, leading to a decrease in chain starch content and a notable enhancement in cooking and eating quality [11,40]. For instance, Liu et al. utilized PCR-AccI molecular markers to introduce Wxb into the indica hybrid rice parents Longtefu and Zhenshan97 [11]. Similarly, Chen used molecular marker-assisted selection to obtain a high-quality early indica rice line Ganzaoyou57, which exhibited both high yields and low amylose content [36]. Also, the Wxb gene was inserted into Teqing and Xieyou 57, leading to significant improvements in cooking and eating qualities [11,40]. This approach is also applicable to the indica–japonica hybrid rice in our research, as shown in the successful testing of Wxb genotype lines from indica restorer lines against the japonica sterile Zhe08A genotype Wxb. In rice quality evaluation, greater gel viscosity corresponds to superior rice quality. Previous studies have shown a negative relationship between amylose content and gel viscosity. In this research, the introduction of the Wxb gene ensured a uniform Wx locus genotype in the hybrid. This simultaneously reduced the amylose content and increased gel viscosity, thereby elevating the hybrid to a premium rice quality level. The Center for Food Quality Supervision and Testing (Wuhan), Ministry of Agriculture and Rural Affairs PRC, assessed the rice quality as Grade 3 Premium Rice, significantly enhancing the effectiveness of rice quality selection.
In this research, we initially conducted field-based comprehensive agronomic trait selection and identified 93 exceptional individuals from a pool of approximately 900 individual plants. Subsequent analysis using S5 KASP detection revealed a genotype distribution of 82:1:8 among these 93 plants. Notably, a significant proportion exhibited the S5-n genotype, which might be attributed to its potential to enhance fruiting rates, thus simplifying the selection process from the initial 900 plants. Additionally, by employing Wx KASP detection, we observed a genotype ratio of 69:15:9 among the samples. While the proportion of heterozygotes almost matched the theoretical 12.5%, the ratios of pure homozygous Wxb and Wxa largely diverged. This discrepancy might be attributed to the non-random selection of the 93 individuals based on agronomic traits. Further investigation is required to ascertain the specific agronomic traits associated with Wxb within this particular parental cross combination.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agriculture13091807/s1, Table S1: Information of 10 testing sites, including longitude, latitude, and altitude. Table S2: Yield and Main Agronomic Economic Traits of Zheyou810 in Various Trial Sites in Regional trials of 2019 and 2020. Table S3: Yield, Growth Period, and Main Agronomic Economic Traits of Zheyou810 in Various Trial Sites in production trial of 2020.

Author Contributions

J.S.—drafted and wrote the manuscript; Y.C. and L.T.—reviewed and commented; H.F.—drew the figures.; J.W.—supervised this study and funded this manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Zhejiang Provincial Natural Science Foundation, grant number LQ20C130007; and Zhejiang Provincial Key Special Projects, grant number 2021C02063-1.

Data Availability Statement

Not applicable.

Acknowledgments

We thank all experimental sites for providing detailed data on yield and agronomic traits. We would like to express our heartfelt gratitude to Yeyang Fan from the China National Rice Research Institute for his valuable advice.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ikehashi, H.; Araki, H. Screening and genetic analysis of wide-compatibility in F1 hybrids of distant crosses in rice, Oryza sativa L. Tech. Bull. Trop. Agric. Res. Cent. 1987, 2, 231–241. [Google Scholar]
  2. Chen, J.; Ding, J.; Ouyang, Y.; Du, H.; Yang, J.; Cheng, K.; Zhao, J.; Qiu, S.; Zhang, X.; Yao, J.; et al. A triallelic system of S5 is a major regulator of the reproductive barrier and compatibility of indica–japonica hybrids in rice. Proc. Natl. Acad. Sci. USA 2008, 105, 11436–11441. [Google Scholar] [CrossRef] [PubMed]
  3. Yang, J.; Zhao, X.; Cheng, K.; Du, H.; Ouyang, Y.; Chen, J.; Qiu, S.; Huang, J.; Jiang, Y.; Jiang, L. A killer-protector system regulates both hybrid sterility and segregation distortion in rice. Science 2012, 337, 1336–1340. [Google Scholar] [CrossRef]
  4. Wang, C.; Wang, J.; Lu, J.; Xiong, Y.; Zhao, Z.; Yu, X.; Zheng, X.; Li, J.; Lin, Q.; Ren, Y.; et al. A natural gene drive system confers reproductive isolation in rice. Cell 2023, 186, 3577–3592.e18. [Google Scholar] [CrossRef]
  5. Sano, Y. Differential regulation of waxy gene expression in rice endosperm. Theor. Appl. Genet. 1984, 68, 467–473. [Google Scholar] [CrossRef]
  6. Cai, X.L.; Wang, Z.Y.; Xing, Y.Y.; Zhang, J.L.; Hong, M.M. Aberrant splicing of intron 1 leads to the heterogeneous 5′ UTR and decreased expression of waxy gene in rice cultivars of intermediate amylose content. Plant J. 1998, 14, 459–465. [Google Scholar] [CrossRef] [PubMed]
  7. Zhang, H.; Zhang, D.; Wang, M.; Sun, J.; Qi, Y.; Li, J.; Wei, X.; Han, L.; Qiu, Z.; Tang, S.; et al. A core collection and mini core collection of Oryza sativa L. in China. Theor. Appl. Genet. 2011, 122, 49–61. [Google Scholar] [CrossRef]
  8. Fujita, N.; Yoshida, M.; Kondo, T.; Saito, K.; Utsumi, Y.; Tokunaga, T.; Nishi, A.; Satoh, H.; Park, J.-H.; Jane, J.-L.; et al. Characterization of SSIIIa-Deficient Mutants of Rice: The Function of SSIIIa and Pleiotropic Effects by SSIIIa Deficiency in the Rice Endosperm. Plant Physiol. 2007, 144, 2009–2023. [Google Scholar] [CrossRef]
  9. Zhou, L.; Chen, S.; Yang, G.; Zha, W.; Cai, H.; Li, S.; Chen, Z.; Liu, K.; Xu, H.; You, A. A perfect functional marker for the gene of intermediate amylose content Wx-in in rice (Oryza sativa L.). Crop. Breed. Appl. Biotechnol. 2018, 18, 103–109. [Google Scholar] [CrossRef]
  10. Jin, L.; Lu, Y.; Shao, Y.; Zhang, G.; Xiao, P.; Shen, S.; Corke, H.; Bao, J. Molecular marker assisted selection for improvement of the eating, cooking and sensory quality of rice (Oryza sativa L.). J. Cereal Sci. 2010, 51, 159–164. [Google Scholar] [CrossRef]
  11. Liu, Q.-Q.; Li, Q.-F.; Cai, X.-L.; Wang, H.-M.; Tang, S.-Z.; Yu, H.-X.; Wang, Z.-Y.; Gu, M.-H. Molecular Marker-Assisted Selection for Improved Cooking and Eating Quality of Two Elite Parents of Hybrid Rice. Crop. Sci. 2006, 46, 2354–2360. [Google Scholar] [CrossRef]
  12. Isshiki, M.; Morino, K.; Nakajima, M.; Okagaki, R.J.; Wessler, S.R.; Izawa, T.; Shimamoto, K. A naturally occurring functional allele of the rice waxy locus has a GT to TT mutation at the 5′ splice site of the first intron. Plant J. 1998, 15, 133–138. [Google Scholar] [CrossRef]
  13. Jie, M. Research on rice quality and high quality attainment rate of Chinese hybrid japonica rice. Hybrid Rice 2007, 22, 1. [Google Scholar]
  14. Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
  15. Varshney, R.K.; Terauchi, R.; McCouch, S.R. Harvesting the Promising Fruits of Genomics: Applying Genome Sequencing Technologies to Crop Breeding. PLoS Biol. 2014, 12, e1001883. [Google Scholar] [CrossRef]
  16. Rasheed, A.; Wen, W.; Gao, F.; Zhai, S.; Jin, H.; Liu, J.; Guo, Q.; Zhang, Y.; Dreisigacker, S.; Xia, X.; et al. Development and validation of KASP assays for genes underpinning key economic traits in bread wheat. Theor. Appl. Genet. 2016, 129, 1843–1860. [Google Scholar] [CrossRef] [PubMed]
  17. Jagtap, A.B.; Vikal, Y.; Johal, G.S. Genome-wide development and validation of cost-effective KASP marker assays for genetic dissection of heat stress tolerance in maize. Int. J. Mol. Sci. 2020, 21, 7386. [Google Scholar] [CrossRef] [PubMed]
  18. Rosso, M.L.; Shang, C.; Song, Q.; Escamilla, D.; Gillenwater, J.; Zhang, B. Development of Breeder-Friendly KASP Markers for Low Concentration of Kunitz Trypsin Inhibitor in Soybean Seeds. Int. J. Mol. Sci. 2021, 22, 2675. [Google Scholar] [CrossRef]
  19. Zhao, Y.; Chen, W.; Cui, Y.; Sang, X.; Lu, J.; Jing, H.; Wang, W.; Zhao, P.; Wang, H. Detection of candidate genes and development of KASP markers for Verticillium wilt resistance by combining genome-wide association study, QTL-seq and transcriptome sequencing in cotton. Theor. Appl. Genet. 2021, 134, 1063–1081. [Google Scholar] [CrossRef]
  20. Tian, D.; Guo, X.; Zhang, Z.; Wang, M.; Wang, F. Improving blast resistance of the rice restorer line, Hui 316, by introducing Pi9 or Pi2 with marker-assisted selection. Biotechnol. Biotechnol. Equip. 2019, 33, 1195–1203. [Google Scholar] [CrossRef]
  21. Wei, Y.; Li, X.; He, X.; Chen, H.; Chen, Y.; Huang, K.; Lu, D.; Guo, S. Development and evaluation of rice blast resistance gene (Pi9) SNP molecular markers based on KASP technology. Southwest China J. Agric. Sci. 2019, 32, 1216–1222. [Google Scholar]
  22. Liu, Y.; Wang, F.; Zhang, A.; Kong, D.; Liu, G.; Luo, L.; Yu, X. Development and validation of functional markers (tetra-primer ARMS and KASP) for the bacterial blight resistance gene xa5 in rice. Australas. Plant Pathol. 2021, 50, 323–327. [Google Scholar] [CrossRef]
  23. Cheon, K.-S.; Jeong, Y.-M.; Lee, Y.-Y.; Oh, J.; Kang, D.-Y.; Oh, H.; Kim, S.L.; Kim, N.; Lee, E.; Baek, J. Kompetitive allele-specific PCR marker development and quantitative trait locus mapping for bakanae disease resistance in Korean japonica rice varieties. Plant Breed. Biotechnol. 2019, 7, 208–219. [Google Scholar] [CrossRef]
  24. Lee, S.-M.; Kwon, Y.-H.; Kang, J.-W.; Lee, J.-Y.; Jo, S.; Shin, D.; Cha, J.-K.; Park, D.-S.; Cho, J.-H.; Lee, J.-H. Classification of Korean Rice Cultivars through Amylose Content Using Molecular Markers Targeting the Waxy Locus. Korean Soc. Breed. Sci. 2021, 53, 361–372. [Google Scholar] [CrossRef]
  25. Kim, M.-S.; Yang, J.-Y.; Yu, J.-K.; Lee, Y.; Park, Y.-J.; Kang, K.-K.; Cho, Y.-G. Breeding of high cooking and eating quality in rice by Marker-Assisted Backcrossing (MABc) using KASP markers. Plants 2021, 10, 804. [Google Scholar] [CrossRef]
  26. Adeva, C.C.; Lee, H.-S.; Kim, S.-H.; Jeon, Y.-A.; Shim, K.-C.; Luong, N.H.; Kang, J.-W.; Kim, C.-S.; Cho, J.-H.; Ahn, S.-N. Two complementary genes, SBE3 and GBSS1 contribute to high amylose content in japonica cultivar Dodamssal. Plant Breed. Biotechnol. 2020, 8, 354–367. [Google Scholar] [CrossRef]
  27. Yang, G.; Chen, S.; Chen, L.; Gao, W.; Huang, Y.; Huang, C.; Zhou, D.; Wang, J.; Liu, Y.; Huang, M. Development and utilization of functional KASP markers to improve rice eating and cooking quality through MAS breeding. Euphytica 2019, 215, 66. [Google Scholar] [CrossRef]
  28. Addison, C.K.; Angira, B.; Kongchum, M.; Harrell, D.L.; Baisakh, N.; Linscombe, S.D.; Famoso, A.N. Characterization of haplotype diversity in the BADH2 aroma gene and development of a KASP SNP assay for predicting aroma in US rice. Rice 2020, 13, 47. [Google Scholar] [CrossRef] [PubMed]
  29. Steele, K.; Tulloch, M.Q.; Burns, M.; Nader, W. Developing KASP markers for identification of basmati rice varieties. Food Anal. Methods 2021, 14, 663–673. [Google Scholar] [CrossRef]
  30. Luong, N.H.; Jeon, Y.-A.; Shim, K.-C.; Kim, S.; Lee, H.-S.; Adeva, C.; Ahn, S.-N. Characterization of the Spikelet Number per Panicle QTL qSPP7 Using a Nearly Isogenic Line Derived from an Interspecific Cross in Rice. Plant Breed. Biotechnol. 2019, 7, 245–256. [Google Scholar] [CrossRef]
  31. Li, C.; Tang, H.; Luo, W.; Zhang, X.; Mu, Y.; Deng, M.; Liu, Y.; Jiang, Q.; Chen, G.; Wang, J. A novel, validated, and plant height-independent QTL for spike extension length is associated with yield-related traits in wheat. Theor. Appl. Genet. 2020, 133, 3381–3393. [Google Scholar] [CrossRef]
  32. Shin, Y.; Won, Y.J.; Lee, C.; Cheon, K.-S.; Oh, H.; Lee, G.-S.; Baek, J.; Yoon, I.S.; Kim, S.L.; Cha, Y.-S. Identification of grain size-related QTLs in Korean japonica rice using genome resequencing and high-throughput image analysis. Agriculture 2022, 12, 51. [Google Scholar] [CrossRef]
  33. Wang, Z.; Yan, L.; Chen, Y.; Wang, X.; Huai, D.; Kang, Y.; Jiang, H.; Liu, K.; Lei, Y.; Liao, B. Detection of a major QTL and development of KASP markers for seed weight by combining QTL-seq, QTL-mapping and RNA-seq in peanut. Theor. Appl. Genet. 2022, 135, 1779–1795. [Google Scholar] [CrossRef] [PubMed]
  34. Yang, J.; Wang, J.; Cao, Q.; Chen, Z.; Zhong, W. Development of functional markers for the rice wide compatibility gene S5-n and its application. Acta Agron. Sin. 2009, 35, 7. [Google Scholar] [CrossRef]
  35. Lin, J.; Song, X.; Wu, M.; Cheng, S. Breeding technology innovation of indica-japonica super hybrid rice and varietal breeding. Sci. Agric. Sin 2016, 49, 207–218. [Google Scholar]
  36. Chen, M.L.; Shen, Y.M.; Luo, S.Y.; Xiong, H.J.; Wu, X.Y.; Hu, L.X. Molecular marker-assisted selection for high-quality early indica rice cultivar ‘Ganzao You57’. Mol. Plant Breed. 2021, 19, 5. [Google Scholar]
  37. Wang, Z.Y.; Zheng, F.Q.; Shen, G.Z.; Gao, J.P.; Snustad, D.P.; Li, M.G.; Zhang, J.L.; Hong, M.M. The amylose content in rice endosperm is related to the post-transcriptional regulation of the waxy gene. Plant J. 1995, 7, 613–622. [Google Scholar] [CrossRef] [PubMed]
  38. Zeng, D.; Tian, Z.; Rao, Y.; Dong, G.; Yang, Y.; Huang, L.; Leng, Y.; Xu, J.; Sun, C.; Zhang, G. Rational design of high-yield and superior-quality rice. Nat. Plants 2017, 3, 17031. [Google Scholar] [CrossRef]
  39. Yi, M.; Nwe, K.T.; Vanavichit, A.; Chai-arree, W.; Toojinda, T. Marker assisted backcross breeding to improve cooking quality traits in Myanmar rice cultivar Manawthukha. Field Crop. Res. 2009, 113, 178–186. [Google Scholar] [CrossRef]
  40. Ni, D.; Zhang, S.; Chen, S.; Xu, Y.; Li, L.; Li, H.; Wang, Z.; Cai, X.; Li, Z.; Yang, J. Improving cooking and eating quality of Xieyou57, an elite indica hybrid rice, by marker-assisted selection of the Wx locus. Euphytica 2011, 179, 355–362. [Google Scholar] [CrossRef]
Agriculture 13 01807 g001
Figure 1. Marker-assisted selection breeding of the restore line Zhehuizhi810.
Figure 1. Marker-assisted selection breeding of the restore line Zhehuizhi810.
Agriculture 13 01807 g001
Agriculture 13 01807 g002
Figure 2. KASP assay of 93 selected F4 plants for S5 gene (A) and Wx gene (B). Note: (A) Homozygous G/G, T/T, and G/T represent the S5-n, S5-i, and heterozygous genotype, respectively. (B) Homozygous T/T, G/G, and G/T indicate the Wxb, Wxa, and heterozygous genotype, respectively.
Figure 2. KASP assay of 93 selected F4 plants for S5 gene (A) and Wx gene (B). Note: (A) Homozygous G/G, T/T, and G/T represent the S5-n, S5-i, and heterozygous genotype, respectively. (B) Homozygous T/T, G/G, and G/T indicate the Wxb, Wxa, and heterozygous genotype, respectively.
Agriculture 13 01807 g002
Agriculture 13 01807 g003
Figure 3. Breeding process of Zheyou810.
Figure 3. Breeding process of Zheyou810.
Agriculture 13 01807 g003
Agriculture 13 01807 g004
Figure 4. Yield of Zheyou810 undertaken by national regional trials in 2019 and 2020, respectively. Note: Data are the means and SD (n = 10), ** p < 0.01, Student t-test.
Figure 4. Yield of Zheyou810 undertaken by national regional trials in 2019 and 2020, respectively. Note: Data are the means and SD (n = 10), ** p < 0.01, Student t-test.
Agriculture 13 01807 g004
Table 1. Rice materials used in this study.
Table 1. Rice materials used in this study.
Line/VarietySubspeciesS5 LocusWx Locus
F1317indicaS5-nWxa
H702indicaS5-iWxb
Zhehuizhi810indicaS5-nWxb
Zhe08AjaponicaS5-jWxb
Zheyou810indica–japonicaS5-n/S5-jWxb
Table 2. Primers for KASP assay used in this study.
Table 2. Primers for KASP assay used in this study.
GenePrimerPrimer Sequence (5′-3′) *
WxKwxa-F1GAAGGTGACCAAGTTCATGCTAGGAAGAACATCTGCAAGG
Kwxb-F2GAAGGTCGGAGTCAACGGATTAGGAAGAACATCTGCAAGT
Kwx-RTTAATTAATTAATTTCCAGCCC
S5KS5i-F1GAAGGTGACCAAGTTCATGCTAAGAAGGGATTAAATTTGCTCGCT
KS5n-F2GAAGGTCGGAGTCAACGGATTAAGAAGGGATTAAATTTGCTCGCG
KS5-RCATACTGTGCTTTGCTACTTACCG
* FAM-probe: GAAGGTGACCAAGTTCATGCT, HEX-probe: GAAGGTCGGAGTCAACGGATT; The italic letter in the 3′ end refers to SNP.
Table 3. The agronomic traits performance of Zheyou810 in 2019 and 2020, respectively.
Table 3. The agronomic traits performance of Zheyou810 in 2019 and 2020, respectively.
VarYearGP EP PH PL NFGPSS TGW
ZY2019151.5 ± 9.3244.5 ± 49.5126.6 ± 5.122.1 ± 0.8244.8 ± 51.485.1 ± 3.625.3 ± 1.6
JY2019147.5 ± 8.6248.8 ± 33.6109.7 ± 4.619.1 ± 1.1168.0 ± 41.285.8 ± 2.129.1 ± 1.1
ZY2020154.9 ± 7.2241.5 ± 37.5124.4 ± 4.321.9 ± 1.8215.0 ± 40.979.3 ± 7.724.0 ± 0.9
JY2020150.1 ± 6.4246.2 ± 41.2109.3 ± 3.519.7 ± 0.9176.6 ± 39.886.4 ± 5.428.7 ± 1.2
ZYMean153.2 ± 8.3243.0 ± 87.0125.5 ± 4.722.0 ± 2.6229.9 ± 46.282.2 ± 5.724.7 ± 1.3
JYMean148.8 ± 6.6247.5 ± 54.2109.5 ± 5.319.4 ± 1.9172.3 ± 63.486.1 ± 6.828.9 ± 1.0
Note: Var, Variety; ZY, Zheyou810; JY, Jiayou5; GP, Growing period (d); EP, Effective panicles (104/ha); PH, Plant height (cm); PL, Panicle length (cm); NFGP, Number of filled grains per panicle; SS, Seed setting rate (%); TGW, Thousand grain weight (g); CK, Control variety Jiayou5.
Table 4. Quality performances of Zheyou810.
Table 4. Quality performances of Zheyou810.
Index20192020Grade
Amylose content (%)16.615.71
Gel consistency (mm)61773
Alkali dissipation value6.26.13
Head rice rate (%)72.172.21
Chalkiness degree (%)3.64.63
Transparency111
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Song, J.; Cui, Y.; Fan, H.; Tang, L.; Wang, J. Molecular Breeding of Zheyou810, an Indica–Japonica Hybrid Rice Variety with Superior Quality and High Yield. Agriculture 2023, 13, 1807. https://doi.org/10.3390/agriculture13091807

AMA Style

Song J, Cui Y, Fan H, Tang L, Wang J. Molecular Breeding of Zheyou810, an Indica–Japonica Hybrid Rice Variety with Superior Quality and High Yield. Agriculture. 2023; 13(9):1807. https://doi.org/10.3390/agriculture13091807

Chicago/Turabian Style

Song, Jian, Yongtao Cui, Honghuan Fan, Liqun Tang, and Jianjun Wang. 2023. "Molecular Breeding of Zheyou810, an Indica–Japonica Hybrid Rice Variety with Superior Quality and High Yield" Agriculture 13, no. 9: 1807. https://doi.org/10.3390/agriculture13091807

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop