Next Article in Journal
Genomic Analysis of Kitasatospora setae to Explore Its Biosynthetic Potential Regarding Secondary Metabolites
Previous Article in Journal
Rumi and Pasteurized Kareish Cheeses Are a Source of β-Lactam-Resistant Salmonella in the Nile Delta Region of Egypt: Insights into Their Incidence, AMR Pattern, Genotypic Determinants of Virulence and β-Lactam Resistance
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 13
Issue 5
10.3390/antibiotics13050458
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detection of Salmonella Pathogenicity Islands and Antimicrobial-Resistant Genes in Salmonella enterica Serovars Enteritidis and Typhimurium Isolated from Broiler Chickens

by
Tsepo Ramatla
1,2,
Ntelekwane G. Khasapane
1,*,
Lungile N. Mlangeni
2,
Prudent Mokgokong
2,
Taole Ramaili
3,
Rendani Ndou
2,
Jane S. Nkhebenyane
1,
Kgaugelo Lekota
2 and
Oriel Thekisoe
2
1
Centre for Applied Food Safety and Biotechnology, Department of Life Sciences, Central University of Technology, 1 Park Road, Bloemfontein 9300, South Africa
2
Unit for Environmental Sciences and Management, North-West University, Potchefstroom 2531, South Africa
3
Department of Animal Health, School of Agriculture, North-West University, Mmabatho 2735, South Africa
*
Author to whom correspondence should be addressed.
Antibiotics 2024, 13(5), 458; https://doi.org/10.3390/antibiotics13050458
Submission received: 16 April 2024 / Revised: 6 May 2024 / Accepted: 14 May 2024 / Published: 16 May 2024
(This article belongs to the Special Issue Antimicrobial Resistance and Infections in Veterinary Settings)
Browse Figures
Review Reports Versions Notes

Abstract

:
Rapid growth in commercial poultry production is one of the major sources of Salmonella infections that leads to human salmonellosis. The two main Salmonella enterica serovars associated with human salmonellosis are enteritidis and typhimurium. The aim of this study was to determine the prevalence of S. enterica serovars Enteritidis and S. Typhimurium as well as their Salmonella pathogenicity islands (SPI) and antibiotic resistance profiles in broiler chicken feces from slaughterhouses. A total of 480 fecal samples from broiler chickens that were grouped into 96 pooled samples were identified to have Salmonella spp. using the invA gene, whilst the Spy and sdfI genes were used to screen for the presence of S. Enteritidis and S. Typhimurium serovars, respectively, by polymerase chain reaction (PCR) assays. The isolates were also screened for the presence of Salmonella pathogenicity islands (SPIs) using PCR. The disc diffusion assay was performed to determine the antibiotic resistance profiles of the isolates. A total of 36 isolates were confirmed as Salmonella spp. through amplification of the invA gene. Out of 36 confirmed Salmonella spp. a total of 22 isolates were classified as S. Enteritidis (n = 8) and were S. Typhimurium (n = 14) serovars. All (n = 22) S. Enteritidis and S. Typhimurium isolates possessed the hilA (SPI-1), ssrB (SPI-2) and pagC (SPI-11) pathogenicity islands genes. Amongst these serovars, 50% of the isolates (n = 11/22) were resistant to tetracycline and nalidixic acid. Only 22% of the isolates, S. Typhimurium (13.6%) and S. Enteritidis (9.1%) demonstrated resistance against three or more antibiotic classes. The most detected antibiotic resistance genes were tet(K), mcr-1, sulI and strA with 13 (59.1%), 9 (40.9%), 9 (40.9%) and 7 (31.8%), respectively. The findings of this study revealed that S. Typhimurium is the most prevalent serotype detected in chicken feces. To reduce the risk to human health posed by salmonellosis, a stringent public health and food safety policy is required.

1. Introduction

Salmonella is a member of the Enterobacteriaceae family, and it is facultatively anaerobic, Gram-negative, oxidase-negative, rod-shaped, mobile, and exhibits peritrichous flagellation [1]. It was named after D.E. Salmon, an American bacteriologist and veterinarian who isolated “hog cholera bacillus” together with T. Smith in 1885 [2]. A variety of gastrointestinal disorders can be caused by Salmonella microorganisms, which frequently colonize the intestinal tract of humans and animals [3]. Globally, Salmonella enterica Typhimurium and Enteritidis are the most common Salmonella serotypes causing gastroenteritis in humans [4]. The serotypes Enteritidis and Typhimurium can be isolated from chickens before slaughter and from humans who have become ill after eating infected chicken meat [5]. Globally, poultry production is expanding rapidly to meet demand [6]. A chicken contaminated with Salmonella spp. is considered unfit for human consumption [7]. Salmonellosis outbreaks are frequently linked to chicken products because chickens are carriers of the Salmonella bacterium in their guts with potential for vertical transmission [8].
The virulence factors result in bacteria invading, adhering, and replicating inside host cells. Virulence factors also enable bacteria to cause disease by overcoming the host defences [9]. Salmonella has several known virulence factors, which are found in Salmonella pathogenicity islands (SPIs), prophages, fimbrial clusters and plasmids [10]. Most of the virulence genes involved in pathogenesis are located in the SPI-1 and SPI-2 pathogenicity islands in the genome of Salmonella [11]. Due to the requirement of SPI-1 and the type II secretion system (T3SS) for pathogenicity, Salmonella strains lacking SPI-1 and SPI-2 are unable to generate intestinal inflammation [12,13].
While pathogenicity islands enable bacteria to induce disease, the resistance islands are genomic islands that offer antimicrobial resistance to antibiotics which still promotes the advantage of bacterial infection to cause disease. Genetically encoded antibiotic resistance can be considered a subtype of virulence factors as they promote host pathogenesis, thereby allowing chronic diseases [14,15].
The global rise of antibiotic resistant (AR) bacteria is a major public health problem [1]. Antibiotic resistance genes (ARGs) have emerged in human and animal infections due to the excessive use of antimicrobial drugs in animals raised for food, frequently without the advice or supervision of a specialist [16,17]. The first report of Salmonella resistance to a single antibiotic was published in the early 1960s [18]. One of the causes for the emergence of AR might be due to the use of antimicrobials for metaphylaxis, prophylaxis, treatments, and growth promotion [19]. Salmonella Typhimurium and non-Typhimurium isolates have been reported to develop antibiotic resistance, especially in resource-poor countries [20,21]. Several studies have been conducted in South Africa on the prevalence of Salmonella in chickens [6,20,21,22]. A study done in the North West Province, South Africa, discovered that chicken samples acquired from various retail shops were contaminated with Salmonella [6]. However, there is a scarcity of data regarding the prevalence, virulence, and antibiotic resistance of Salmonella of broiler chickens at slaughterhouses in South Africa. Therefore, the objective of this study was to determine the prevalence of S. Enteritidis and S. Typhimurium serovars, SPIs, and antibiotic resistance from faecal samples of broiler chickens collected from the slaughterhouse in the North West Province of South Africa.

2. Results

2.1. Prevalence of S. Typhimurium and S. Enteritidis Serovars

A total of 96 pooled fecal samples of broiler chickens were used for isolation of S. Typhimurium and S. Enteritidis serovars using XLD agar, resulting in a total of 48 non-repetitive presumptive isolates. Amplification of the invA Salmonella genus-specific gene revealed that 75% (36/48) of the isolates were Salmonella spp. All the 36 Salmonella isolates were further screened for the presence of S. Typhimurium and S. Enteritidis serovars targeting Spy and sdfI genes, respectively. Eight (22.2%) isolates were confirmed as S. Enteritidis, while fourteen (38.9%;) were S. Typhimurium (Figure 1). The 16S rRNA gene sequence analysis of the S. Typhimurium and S. Enteritidis revealed a high percentage of nucleotide similarity (99.9%) to the reference NCBI GenBank sequences of the respective. The representative isolates were deposited in GenBank under accession numbers OR416208 and OR416209 for S. Typhimurium as well as (OR416957 and OR41695) for S. Enteritidis.

2.2. Detection of Virulence Genes in S. Typhimurium and S. Enteritidis

Twenty-two S. Typhimurium and S. Enteritidis isolates, that were positively confirmed by PCR, were further screened for the presence of the following virulence genes: hilA, ssrB, marT, sopB, pagN, vexA, nlpI, bapA, pagC, oafA, spvB and cdtB. None of the isolates harbored the pagN gene of the SPI-1 (Figure 2). All the 22 isolates (S. Typhimurium and S. Enteritidis) possessed hilA (SPI-1), ssrB (SPI-2) and pagC (SPI-11) genes. The bapA (SPI-9), sopB (SPI-5), marT (SPI-3), vexA (SPI-7), nlpI (SPI-7), and oafA (SPI-12) genes were present in 8 (36.4%), 7 (31.8%), 5 (22.7%), 4 (18.2%), 4 (18.2%) and 3 (13.6%) of the two Salmonella serovars, respectively. While the chromosomal cdtB and plasmid spvB genes were detected from 6 (27.3%) and 4 (18.2%) isolates, respectively.

2.3. Phenotypic Detection of Antibiotic Resistance Profiles

Antimicrobial susceptibility testing of the 22 isolates demonstrated a wide range of antimicrobial resistance profiles against only the nine drugs tested. Fifty percent of the isolates were resistant to tetracycline and nalidixic acid. This was followed by eight (36.4%), six (27.3%), six (27.3%), five (22.7%), four (18.2%), four (18.2%), and two (9.1%), isolates that were resistant to colistin sulphate, ciprofloxacin, chloramphenicol, streptomycin, ampicillin, amoxicillin-clavulanic acid, and gentamicin, respectively. All the isolates were fully susceptible to the cefepime antibiotic (Figure 3). Five isolates, that is, S. Typhimurium n = 3 (13.6%) and S. Enteritidis n = 2 (9.1%) were multidrug-resistant (MDR) as they demonstrated resistance to three or more antibiotic classes. All intermediate isolates were considered to be susceptible.

2.4. Genotypic Detection of Antibiotic Resistance Profiles

The data presented in Figure 4 shows the successful amplification of the antibiotic resistance genes in S. Typhimurium and S. Enteritidis isolates. A total of 22 isolates possessed tet(K), tet(O), tet(A) and tet(K), 13 (59.1%), 6 (27.3%), 4 (18.2%) and 3 (14.5%), respectively; these genes are associated with tetracycline resistance. Additionally, 9 (40.9%) and 8 (36.2%) of the isolates harbored colistin resistance genes mcr-1 and mcr-4, respectively. Furthermore, some isolates possessed aminoglycoside resistance associated genes strA n = 7 (31.8%), strB n = 4 (18.2%), aadA n = 4 (18.2%) and aadE n = 1 (4.5%), while others harbored sulphonamides resistance genes; sulI (40.9%) and sulII (4.5%), respectively. For the beta-lactamase, 32 isolates possessed CTX-M (45.5%), ampC (36.4%), TEM (36.4%), OXA (18.2%) and SHV (9.1%), respectively. Antibiotic resistance genes for tetracycline (tet(X), tet(P)), colistin (mcr-2, mcr-3, mcr-5), sulphonamides (sulIII) and CARB were not amplified in all screened isolates.

2.5. Coexistence of Phenotypic and Genotypic Antibiotic Resistance Traits

Out of eleven isolates that showed phenotypic resistance to tetracycline using phenotypic disc diffusion assay, n = 2 isolates carried tet(A), n = 4 tet(O), n = 8 tet(W) and n = 1 tet(K) genes encoding tetracycline resistance. Moreover, three isolates that showed phenotypic resistance to colistin harbored the mcr-1 gene, while n = 4 isolates carried the mcr-4 gene. Three isolates with phenotypic resistance to amoxicillin carried TEM, n = 1 harbored both OXA and CTX-M genes. Three isolates showed phenotypic resistance to streptomycin and carried the strA gene, while one isolate harbored strB gene. One isolate with positive phenotypic resistance to ampicillin carried both CTX-M and ampC genes.

3. Discussion

Salmonella Enteritidis and S. Typhimurium serovars are frequent causes of foodborne illness and death. The Salmonella pathogenicity island 1 (SPI-1) and the type 3 secretion system (TTSS) contain a potential inner membrane component called the invasion protein A gene (invA) [23]. It affects the host cell by delivering type III secreted effectors and is required for the invasion of epithelial cells [23]. The invA gene has been used in numerous studies to identify and confirm Salmonella spp. [8,24,25,26,27]. Since it has been established that the invA gene is only found in Salmonella species, molecular diagnostic techniques can be used to successfully confirm the existence of this genus [28,29]. In order to ascertain the prevalence of Salmonella species in broiler chickens, the invA gene was employed in this study. As a result, 75% (36/48) of the isolates were identified as Salmonella. This finding is higher than the previous prevalence reported in Türkiye and Egypt, whereby 38.2% and 20% of Salmonella serovars were isolated from chickens, respectively [30,31].
The Salmonella isolates (36/48) in this study were further screened for the presence of S. Enteritidis and S. Typhimurium, where eight (22.2%) isolates were confirmed as S. Enteritidis, while 14 (38.9%) were S. Typhimurium. A comparative study conducted in Egypt reported a low prevalence of S. Typhimurium (3%) and S. Enteritidis (2%) serovars in chicken meat [32]. Another study conducted in Egypt recorded a low prevalence of S. Enteritidis (9%), while the same study recorded high prevalence of S. Typhimurium (86.6%) in chickens [23]. These are further supported by observations in poultry meat, where only 9% (36/400) of the isolates were positive for S. Typhimurium and S. Enteritidis [3]. However, the only limitation of this study is that selective enrichment broths such as Rappaport–Vassiliadis broth or Muller–Kauffmann tetrathionate used to increase the isolation rate of Salmonella was not used.
The present study also sought to determine the occurrence of SPIs from S. Typhimurium and S. Enteritidis isolated from poultry meat. The SPI-1 (hilA) gene was detected in all isolates in this study. The invasion of epithelial cells by Salmonella is promoted by SPI-1 [25]. In Salmonella infections, these effectors play a variety of roles, including rearranging the host cytoskeleton, recruiting immune cells, regulating cell metabolism, secreting fluid, and regulating inflammation [33]. The hilA gene directly induces the expression of two SPI-1 genes (invF and sicA) that encode SPI-1 T3SS apparatus components. The SPI-1 T3SS effectors that are encoded both inside and outside SPI-1 are activated by invF, a transcriptional activator of the AraC family [25,34]. All the isolates in this study possessed the SPI-2 (ssrB) and SPI-11 (pagC) pathogenicity islands. The SPI-2 secretes effectors to promote formation of an intracellular Salmonella-containing vacuole (SCV), which provides S. Typhimurium with an ideal environment to replicate [35]. The ssrB gene is autoregulated, and it activates SPI-2 and SPI-2 co-regulated genes in response to unknown signals [36,37]. The genes encoded on SPI-13 play an important role in intracellular viability. A cluster in SPI-13 encodes putative lyase, hydrolase, oxidase, and arylsulphatase regulators, and deletion of this island attenuates Salmonella's ability to reproduce [12,38]. Furthermore, the SPIs such as SPI-9 (bapA), SPI-5 (sopB), SPI-3 (marT), SPI-7 (vexA), nlpI (SPI-7), and SPI-12 (oafA) were detected in few isolates in this study. This indicates that all isolates of both S. Enteritidis and S. Typhimurium serovars are very important in human and animal infections.
The cytolethal distending toxin B (cdtB) was detected in 27.3% in this study. This gene has previously been detected in 4.92% of isolates obtained from children with salmonellosis in China [22]. In the cytolethal distending toxin (CDT) complex, cdtB is the active form, with a similar amino acid sequence to that of DNase I in mammals [39,40]. The protein homologue of the CDT active component is encoded by the gene cdtB. The common bacterial infection that produces this toxin damages DNA, causing cell cycle arrest and cellular distension [41]. The spvB gene that encodes for an enzyme that ADP-ribosylates actin and destabilizes the cytoskeleton of eukaryotic cells was also detected at a low percentage. Three virulence-related genes are found in the spv region, including the transcriptional regulator spvR and the two structural genes spvB and spvC, of which spvB is the most significant [42,43,44]. The spvB gene is believed to contain two functional domains based on homologies of two separate protein classes [45]. The spvB gene has been identified as an ADP-ribosyl transferase that stimulates the breakdown of host cell actin, which in turn causes cytotoxicity in macrophages and pathogenicity in mice [46].
Primarily, antimicrobial drugs are essential to both human and animal health and survival on a global scale [17]. In the Alborz Province of Iran, Sodagari et al. [47] first introduced tetracycline as the most efficient antibiotic against Salmonella in chickens. The results of the present study showed that half of S. Typhimurium and S. Enteritidis strains showed the greatest level of antibiotic resistance to tetracycline and nalidixic acid. These results are lower than the results obtained in a previous study conducted by Nazari Moghadam et al. [3], where 72.2% and 61.2% of the identified Salmonella isolates were resistant to tetracycline and nalidixic acid, respectively. Furthermore, the study conducted in Iran [48] documented 100% resistance to nalidixic acid and 92.3% resistance to tetracycline. The high resistance to the antibiotics contradicts the previous study which reported a low prevalence of resistance against nalidixic acid (14.3%) [49] from chicken samples in the North West province of South Africa. These differences could be explained by geographical location and sample types. Colistin sulphate, ciprofloxacin, chloramphenicol, streptomycin, ampicillin, amoxicillin–clavulanic acid, and gentamicin were detected at low percentages; eight (36.4%), six (27.3%), six (27.3%), five (22.7%), four (18.2%), four (18.2%), and two (9.1%), respectively. This observed prevalence is lower than the reported prevalence from the study conducted by El-Sharkawy et al. [25], whereby 100% of the isolates possessed gentamycin and 89.7% harbored streptomycin. The study conducted by Ezzatpanah et al. [50] in Iran reported the highest rates of nalidixic acid (86.7%) and amoxicillin (45.3%) from poultry samples. This might be because antimicrobial drugs were used more often than usual in the intensive livestock farming system where these studies were conducted.
Moreover, 22% of the isolates demonstrated resistance against three or more antibiotic classes in this study. Studies conducted in Cameroon and Malaysia reported relatively low MDR prevalence of 13% and 23.5% for non-typhoidal Salmonella isolates, respectively [51,52]. In contrast, high MDR prevalence of 81.1% and 100% was reported by studies conducted in China and Bangladesh, respectively [53,54].
It was discovered that several drugs evaluated in this study had antibiotic resistance genes associated with them. In this study, four tet genes were detected, namely, tet(K) (59%), tet(O) (27.3%), tet(A) (18.2%) and tet(K) (5.4%). The study by Adesiji et al. [55] in India reported high detection of tetA (100%) from Salmonella spp. isolated from human, poultry, and seafood sources. In South Africa, more than 70% of antibiotics used in raising livestock can be purchased without a prescription, leading to a rise in antibiotic resistance within the country [19]. Tetracyclines are the most commonly used, or overused, antibiotics in livestock production in South Africa. This is due to the fact that they are extensively accessible and reasonably priced over-the-counter veterinary drugs [56].
Aminoglycoside resistance associated genes strA, strB, aadA and aadE were detected in this study at 31.8%, 18.2%, 18.2% and 14.5%, respectively. Similar observations have been reported in previous studies [25,57,58]. The sul genes, which code for sulphonamide resistance, were detected in this study. The sulI and sulII were detected in nine (40.9%) and one (4.5%) of the samples, respectively. This is lower compared to a previous study conducted in Egypt, where 57% of the isolates carried sul1 gene [25]. The most commonly reported genes among isolates resistant to sulfonamide are sul1 and sul2, which are also present in plasmids of other Salmonella species that are still widely distributed in bacterial plasmids that are Gram-negative [19,59]. Furthermore, 40.9% and 36.2% of the S. Typhimurium and S. Enteritidis isolates possessed mcr-1 and mcr-4 genes, encoding for colistin resistance. A study conducted previously in Italy reported that 2.96% Salmonella isolates harbored the mcr-2 gene, while only 1.69% possessed the mcr-4 gene [60]. Mei et al. [61] reported that only 2.02% of the Salmonella strains harbored the mcr-1 gene in China. This raises serious concern, as antibiotics like colistin and carbapenems are used to treat MDR bacterial infections in humans [62]. None of the isolates used in this study were tet(X), tet(P), mcr-2, mcr-3, mcr-5, sulIII or carB positive.
Animal and human infections, notably those brought on by Salmonella serovars, are frequently treated with beta-lactams [8,63]. During the last decade, Salmonella isolates carrying ESBLs have spread worldwide [63]. The beta-lactam-resistant bla genes, namely, CTX-M, ampC, TEM, OXA and SHVI genes are detected in 45.5%, 36.4%, 36.4%, 18.2% and 9.1%, respectively, in this study. Yang et al. [64] detected a higher prevalence of blaTEM in 51.6% of resistant Salmonella isolates from retail meats at the marketplace in China. The study conducted on retail meat in Canada by Aslam et al. [65], recorded that 17% of the Salmonella isolates harbored the blaTEM gene. In China, 81.2% of the Salmonella isolates from chickens carried the blaTEM gene, although all isolates were negative for the blaCTX-M gene [66]. Siddiky et al. [67] detected positive blaTEM genes in 69.62% Salmonella isolates from poultry processing environments in wet markets in Dhaka, Bangladesh. In addition, the study conducted in Central Ethiopia reported the detection of blaTEM, blaTEM-1, blaTEM-57, and blaOXA in 79% of the animals and human non-typhoidal Salmonella isolates [68]. Currently, blaCTX-M enzymes are the most common type of ESBL because they are derived from the environment [69]. Based on the amino acid composition of the enzyme, the blaCTX-M enzyme can be divided into five subgroups as follows: blaCTX-M-1, blaCTX-M-2, blaCTX-M-8, blaCTX-M-9, and blaCTX-M-25 [19]. Globally, the prevalence of carbapenem-resistant Enterobacteriaceae has increased due to the growing use of carbapenems to treat ESBL-producing infections [70].

4. Materials and Methods

4.1. Sampling

Fecal samples were collected from the ceca/rectum of healthy broiler chickens from four different chicken abattoirs around Mahikeng city of North West Province, South Africa. We randomly collected a total of 480 chicken fecal samples, post-evisceration, from the intestines in slaughterhouses which resulted in 96 pools (5 chickens per pool). Thereafter, the samples were placed in a cooler box and then transported to the laboratory.

4.2. Microbiological Analysis

Fecal content (1 g) was weighed and transferred to a sterile container. Then, 10 milliliters of peptone water (BPW Oxoid, Biolab, Johannesburg, South Africa) was added and the mixture was homogenized by vortexing for 2 min and then incubated at 37 °C for 24 h. Thereafter, bacterial cells were streaked onto xylose–lysine–deoxycholate agar (XLD) (Merck, Wadeville, South Africa) after being incubated at 37 °C overnight for 24 h. The colonies were examined for their morphological appearance on the plate (colonies with or without black centers, colorless or opaque-white colonies surrounded by pink or red zones). Three to five colonies were selected per culture and purified on XLD agar and then incubated at 37 °C for 24 h. The Gram staining, catalase, Simmons citrate test, urease, and Triple sugar iron (TSI) agar tests were performed according to Akinola et al. [24]. The Gram-negative rods and the catalase-positive samples were preserved and stored in 20% glycerol (Merck, SA) at −80 °C.

4.3. Genomic DNA Extraction

The boiling–centrifugation method was conducted for the extraction of bacterial genomic DNA [71,72]. Briefly, pure colonies of each isolate were aseptically homogenized in 100 μL of sterile distilled water. The suspensions were separately boiled at 100 °C for 15 min and centrifuged at 10,000 rpm for 10 min. Thereafter, the supernatant was transferred to a new microcentrifuge tube and was used as template DNA for polymerase chain reaction (PCR). DNA concentration was measured with a NanoDrop spectrophotometer (ThermoFischer, Waltham, MA, USA). Pure DNA has a 260/280 ratio of between 1.8 and 2.0; phenol and contamination are indicated by a ratio above 2.0, and protein contamination is indicated by a ratio below 1.8.

4.4. Molecular Identification of Salmonella Serovars

The PCR assays with following primers were used for amplification of Salmonella serovars: for the invA gene PCR assay (280 bp) for S. enterica; invA-F: GTG AAA TTA TCG CCA CGT TCG GGC AA and invA-R: TCA TCG CAC CGT CAA AGG AAC C [8], sdfI gene PCR assay (304 bp) for S. enterica serovar Enteritidis using the primers: SdfI -F: TGT GTT TTA TCT GAT GCA AGA GG and SdfI -R: TGA ACT ACG TTC GTT CTT CTG G [73], and Spy gene PCR assay (401 bp) for S. enterica serovar Typhimurium; Spy-F: TTG TTC ACT TTT TAC CCC TGA A and Spy-R: CCC TGA CAG CCG TTA GAT ATT and also fliC gene PCR assay (433 bp) for serovar S. Typhimurium fliC-F: CCCCGCTTACAGGTGGACTAC and fliC-R: AGCGGGTTTTCGGTGGTTGT [67]. The reaction volume of 25 μL, contained 12.5 μL PCR Master Mix [AmpliTaq Gold® DNA Polymerase 0.05 units/µL, Gold buffer 930 mM Tris/HCl pH 8.05, 100 mM KCl0, 400 mM of each dNTP and 5 mM MgCl2] (Applied Biosystems, Foster City, CA, USA), 2 μL template DNA, 1 μL of 10 μM each primer utilizing and 8.5 μL nuclease-free water. The thermal cycling was conducted on an Engine T100 ThermalTM cycler (BioRad, Singapore) with the following conditions: an initial step of denaturation at 94 °C for 5 min, then 30 cycles of denaturation at 94 °C for 45 s, annealing at 58 °C for 45 s, and extension at 72 °C for 60 s, followed by a single concluding extension step at 72 °C for 7 min. Salmonella Typhimurium (ATCC:14028TM) and S. Enteritidis (ATCC:13076TM) were used as positive controls, whilst and Escherichia coli (ATCC:259622TM) was used as negative control. PCR products were electrophoresed on a 1.5% (w/v) agarose gel stained with ethidium bromide and visualized under ultraviolet (UV) light. A 100 bp DNA molecular weight marker (PROMEGA, Madison, WI, USA) was used to determine the size of the PCR amplicons. The Syngene InGenius Bioimager (Cambridge, UK) was used to capture the images.

4.5. Identification of Salmonella Serovars Using 16S rRNA

A PCR assay was conducted with bacterial universal primers (27F: AGA GTT TGA TCM TGG CTC AG and 1492R: GGT TAC CTT GTT ACG ACT T) targeting the 16S rRNA gene [74,75]. The PCR conditions were as follows: 96 °C for 4 min for initial denaturation step, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 57 °C for 30 s and extension at 72 °C for 1 min, and one step of final extension at 72 °C for 10 min. PCR amplicons were subjected to cycle sequencing using BigDye Terminator cycle sequencing kit (v 3.1) and electrophoresed on the SeqStudio genetic analyzer of the UESM Sequencing facility of North-West University, Potchefstroom. Four representative sequences were submitted to nucleotide Basic Local Alignment Search Tool (BLASTn) (https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 12 October 2023) in order to confirm the isolate’s identity.

4.6. Detection of Virulence Genes

To identify the zoonotic potential of the S. Enteritidis and S. Typhimurium that we have isolated, genomic DNA samples of Salmonella isolates were screened for the presence of twelve virulence genes (hilA, ssrB, marT, sopB, pagN, vexA, nlpI, bapA, pagC, oafA, spvB and cdtB) detected by PCR [76]. A PCR mixture of 25 μL, consisted of 8.5 μL nuclease-free water, 12.5 μL 2X PCR Mix (AmpliTaq Gold® DNA Polymerase 0.05 units/µL, Gold buffer 930 mM Tris/HCl pH 8.05, 100 mM KCl0, 400 mM of each dNTP and 5 mM MgCl2) (Applied Biosystems, CA, USA), 2 μL template DNA, and 1 μL of each primer. A DNA free template (nuclease-free water) was included as a negative control. The PCR reactions were subjected to initial denaturation at 94 °C for 5 min, for one cycle, denaturation at 94 °C for 5 min, annealing at (45–66.5 °C) (Table 1) for 45 s; extension at 72 °C for 1 min; and then final extension at 72 °C for 10 min.

4.7. Phenotypic Antimicrobial Susceptibility Test

Antimicrobial susceptibility of Salmonella isolates was tested for 10 different antimicrobial agents using the Kirby-Bauer disc diffusion method on Mueller Hinton Agar (Oxoid Ltd., Basingstoke, UK). Antibiotics used in this study were 10 μg ampicillin (AMP), 30 μg tetracycline (TET), 10 μg gentamicin (GEN), 5 μg ciprofloxacin (CIP), 25 μg streptomycin (STR), 30 μg cefepime (FEP), 30 μg chloramphenicol (CHL), 30 μg nalidixic acid (NA), 20/10 μg amoxicillin–clavulanic acid (ACA) and 10 μg colistin sulphate (CS). Results were interpreted following the Clinical and Laboratory Standards Institute (CLSI 2018) guidelines coupled with PHE archive based on the European Union protocol for the monitoring of AMR [77]. Resistance to three or more antimicrobials of different classes was considered to be multidrug resistance (MDR) [1].

4.8. Genotypic Detection of Antibiotic Resistance Genes

Twenty-four antibiotic resistance genes, tetracycline [tet(A), tet(O), tet(X), tet(P), tet(W) and tet(K)], colistin [mcr-1, mcr-2, mcr-3, mcr-4 and mcr-5], sulphonamides [sulI, sulII and sulIII], aminoglycoside [strA, strB, aadA, and aadE] β-lactamase [ampC, SHV, OXA, CARB, TEM and CTX-M], were screened from S. typhimurium and S. enteritidis isolates using their respective PCR assays (Supplementary Table S1). A DNA free template (nuclease-free water) was included as a negative control.

4.9. Statistical Analysis

To analyze the data, virulence gene identification, antibiotic susceptibility testing, and antibiotic resistant genes were entered into Excel (Microsoft Excel 2016: Microsoft Corporation, Redmond, DC, USA). The Bubble plot of the antibiotic resistance profile was generated using ChipPlot (https://www.chiplot.online/#, accessed on 8 November 2023).

5. Conclusions

The S. Typhimurium was the most detected serovar compared to S. Enteritidis in fecal samples from broiler chickens. This study has pioneered the detection of SPI genes in S. Typhimurium and S. Enteritidis isolates found in broiler chicken feces in South Africa. Furthermore, considerable levels of resistance to the colistin and aminoglycosides antibiotic classes were detected in the S. Typhimurium and S. Enteritidis isolates used in this investigation, raising concerns about a potential risk to human health. Moreover, our findings show that colistin and aminoglycoside resistance is increasing among Salmonella species in the region. The recovered S. Typhimurium and S. Enteritidis isolates possessed MDR and several virulence gene profiles.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antibiotics13050458/s1, Table S1. List of antibiotic resistance genes primers used in this study. References [49,78,79,80,81,82,83] are cited in the supplementary materials.

Author Contributions

T.R. (Tsepo Ramatla), O.T. and K.L., study conceptualization and design; T.R. (Tsepo Ramatla), P.M., L.N.M. and T.R. (Taole Ramaili), laboratory analysis; K.L. and O.T., funding acquisition.; O.T., R.N. and K.L., supervised the study; P.M., N.G.K., J.S.N. and T.R. (Tsepo Ramatla), data analysis and curation; T.R. (Tsepo Ramatla) and N.G.K. interpreted the data and drafted the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by NRF Incentive grant for rated researchers (GUN: 118949) made available to O.T.

Institutional Review Board Statement

The ethical approval was received from the Ethical Committee of the Animal Health Research Division at the North-West university, South Africa (NWU-00511-18-A5). All methods were performed in accordance with the relevant guidelines and regulations.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data and materials of the study will be available from the corresponding author on reasonable request. The sequences of two strains analyzed were deposited in the National Library of Medicine, National Center for Biology Information (NCBI), GenBank nucleotide sequence database. The accession numbers assigned as OR416208 and OR416209 for S. typhmurium (https://www.ncbi.nlm.nih.gov/nuccore/ OR416208 and OR416209), OR123649 (https://www.ncbi.nlm.nih.gov/nuccore/ OR123649) and OR416957 and OR41695 for S. enteritidis (https://www.ncbi.nlm.nih.gov/nuccore/ OR416957 and OR41695).

Conflicts of Interest

The authors declare that this study was conducted in the absence of any competing interest whatsoever.

References

  1. Alghoribi, M.F.; Doumith, M.; Alrodayyan, M.; Al Zayer, M.; Köster, W.L.; Muhanna, A.; Aljohani, S.M.; Balkhy, H.H.; Desin, T.S. S. Enteritidis and S. Typhimurium harboring SPI-1 and SPI-2 are the predominant serotypes associated with human salmonellosis in Saudi Arabia. Front. Cell. Infect. Microbiol. 2019, 9, 187. [Google Scholar] [CrossRef] [PubMed]
  2. Salmon, D.E.; Smith, T. Report on Swine Plague. US Bureau of Animal Industries, Second Annual Report; US Gov’t. Printing Office: Washington, DC, USA, 1885; p. 184. [Google Scholar]
  3. Nazari Moghadam, M.; Rahimi, E.; Shakerian, A.; Momtaz, H. Prevalence of Salmonella Typhimurium and Salmonella Enteritidis isolated from poultry meat: Virulence and antimicrobial-resistant genes. BMC Microbiol. 2023, 23, 168. [Google Scholar] [CrossRef] [PubMed]
  4. Edris, A.; Hassan, M.; Shaltout, F.; El-Hosseny, S. Detection of E. coli and Salmonella organisms in cattle and camel meat. BVMJ 2013, 25, 198–204. [Google Scholar]
  5. de Freitas, C.G.; Santana, Â.P.; da Silva, P.H.; Gonçalves, V.S.; Barros, M.D.; Torres, F.A.; Murata, L.S.; Perecmanis, S. PCR multiplex for detection of Salmonella Enteritidis, Typhi and Typhimurium and occurrence in poultry meat. Int. J. Food Microbiol. 2010, 139, 15–22. [Google Scholar] [CrossRef] [PubMed]
  6. Olobatoke, R.Y.; Mulugeta, S.D. Incidence of non-typhoidal Salmonella in poultry products in the North West Province, South Africa. S. Afr. J. Sci. 2015, 111, 1–7. [Google Scholar] [CrossRef] [PubMed]
  7. Agunos, A.; Ibuki, M.; Yokomizo, F.; Mine, Y. Effect of dietary β 1–4 mannobiose in the prevention of Salmonella Enteritidis infection in broilers. Br. Poult. Sci. 2007, 48, 331–341. [Google Scholar] [CrossRef] [PubMed]
  8. Ramatla, T.A.; Mphuthi, N.; Ramaili, T.; Taioe, M.O.; Thekisoe, O.M.; Syakalima, M. Molecular detection of virulence genes in Salmonella spp. isolated from chicken faeces in Mafikeng, South Africa. J. S. Afr. Vet. Assoc. 2020, 91, 1994. [Google Scholar] [CrossRef] [PubMed]
  9. Majowicz, S.E.; Musto, J.; Scallan, E.; Angulo, F.J.; Kirk, M.; O’Brien, S.J.; Jones, T.F.; Fazil, A.; Hoekstra, R.M.; International Collaboration on Enteric Disease ‘Burden of Illness’ Studies. The global burden of nontyphoidal Salmonella gastroenteritis. Clin. Infect. Dis. 2010, 50, 882–889. [Google Scholar] [CrossRef] [PubMed]
  10. Prasanna Kumar, V. Studies on Virulence, Antimicrobial Resistance and Genetic Diversity of Salmonella Typhimurium Isolates from North India; GB Pant University of Agriculture and Technology: Pantnagar, Uttarakhand, 2016. [Google Scholar]
  11. De la Cruz, M.A.; Pérez-Morales, D.; Palacios, I.J.; Fernández-Mora, M.; Calva, E.; Bustamante, V.H. The two-component system CpxR/A represses the expression of Salmonella virulence genes by affecting the stability of the transcriptional regulator HilD. Front. Microbiol. 2015, 6, 807. [Google Scholar] [CrossRef]
  12. Haneda, T.; Ishii, Y.; Shimizu, H.; Ohshima, K.; Iida, N.; Danbara, H.; Okada, N. Salmonella type III effector SpvC, a phosphothreonine lyase, contributes to reduction in inflammatory response during intestinal phase of infection. Cell. Microbiol. 2012, 14, 485–499. [Google Scholar] [CrossRef]
  13. Card, R.; Vaughan, K.; Bagnall, M.; Spiropoulos, J.; Cooley, W.; Strickland, T.; Davies, R.; Anjum, M.F. Virulence characterisation of Salmonella enterica isolates of differing antimicrobial resistance recovered from UK livestock and imported meat samples. Front. Microbiol. 2016, 7, 640. [Google Scholar] [CrossRef] [PubMed]
  14. Shoaib, M.; Aqib, A.I.; Muzammil, I.; Majeed, N.; Bhutta, Z.A.; Kulyar, M.F.; Fatima, M.; Zaheer, C.F.; Muneer, A.; Murtaza, M.; et al. MRSA compendium of epidemiology, transmission, pathophysiology, treatment, and prevention within one health framework. Front. Microbiol. 2023, 13, 1067284. [Google Scholar] [CrossRef] [PubMed]
  15. Schroeder, M.; Brooks, B.D.; Brooks, A.E. The complex relationship between virulence and antibiotic resistance. Genes 2017, 18, 39. [Google Scholar] [CrossRef] [PubMed]
  16. Qiao, M.; Ying, G.G.; Singer, A.C.; Zhu, Y.G. Review of antibiotic resistance in China and its environment. Environ. Int. 2018, 110, 160–172. [Google Scholar] [CrossRef] [PubMed]
  17. Ramatla, T.; Tutubala, M.; Motlhaping, T.; de Wet, L.; Mokgokong, P.; Thekisoe, O.; Lekota, K. Molecular detection of Shiga toxin and extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli isolates from sheep and goats. Mol. Biol. Rep. 2024, 51, 57. [Google Scholar] [CrossRef] [PubMed]
  18. Pui, C.F.; Wong, W.C.; Chai, L.C.; Tunung, R.; Jeyaletchumi, P.; Noor Hidayah, M.S.; Ubong, A.; Farinazleen, M.G.; Cheah, Y.K.; Son, R. Salmonella: A foodborne pathogen. Int. Food Res. J. 2011, 18, 465–473. [Google Scholar]
  19. Ramatla, T.; Tawana, M.; Onyiche, T.E.; Lekota, K.E.; Thekisoe, O. Prevalence of antibiotic resistance in Salmonella serotypes concurrently isolated from the environment, animals, and humans in South Africa: A systematic review and meta-analysis. Antibiotics 2021, 10, 1435. [Google Scholar] [CrossRef]
  20. Mossoro-Kpinde, C.D.; Manirakiza, A.; Mbecko, J.R.; Misatou, P.; Le Faou, A.; Frank, T. Antimicrobial resistance of enteric Salmonella in Bangui, central African republic. J. Trop. Med. 2015, 2015, 483974. [Google Scholar] [CrossRef] [PubMed]
  21. Parry, C.M.; Threlfall, E.J. Antimicrobial resistance in typhoidal and nontyphoidal salmonellae. Curr. Opin. Infect. Dis. 2008, 21, 531–538. [Google Scholar] [CrossRef]
  22. Zishiri, O.T.; Mkhize, N.; Mukaratirwa, S. Prevalence of virulence and antimicrobial resistance genes in Salmonella spp. isolated from commercial chickens and human clinical isolates from South Africa and Brazil. Onderstepoort J. Vet. Res. 2016, 83, a1067. [Google Scholar] [CrossRef]
  23. Ramatla, T.; Taioe, M.O.; Thekisoe, O.M.; Syakalima, M. Confirmation of antimicrobial resistance by using resistance genes of isolated Salmonella spp. in chicken houses of North West, South Africa. World’s Vet. J. 2019, 9, 158–165. [Google Scholar] [CrossRef]
  24. Akinola, S.A.; Mwanza, M.; Ateba, C.N. Occurrence, genetic diversities and antibiotic resistance profiles of Salmonella serovars isolated from chickens. Infect. Drug Resist. 2019, 12, 3327–3342. [Google Scholar] [CrossRef] [PubMed]
  25. El-Sharkawy, H.; Tahoun, A.; El-Gohary, A.E.; El-Abasy, M.; El-Khayat, F.; Gillespie, T.; Kitade, Y.; Hafez, H.M.; Neubauer, H.; El-Adawy, H. Epidemiological, molecular characterization and antibiotic resistance of Salmonella enterica serovars isolated from chicken farms in Egypt. Gut Pathog. 2017, 9, 8. [Google Scholar] [CrossRef] [PubMed]
  26. Ateba, C.N.; Mochaiwa, B. Use of invA gene specific PCR analysis for the detection of virulent Salmonella species in beef products in the north west province, South Africa. J. Food Nutr. Res. 2014, 2, 294–300. [Google Scholar] [CrossRef]
  27. Lou, L.; Zhang, P.; Piao, R.; Wang, Y. Salmonella pathogenicity island 1 (SPI-1) and its complex regulatory network. Front. Cell. Infect. Microbiol. 2019, 9, 270. [Google Scholar] [CrossRef] [PubMed]
  28. Mohammed, B.T. Identification and bioinformatic analysis of invA gene of Salmonella in free range chicken. Braz. J. Biol. 2022, 84, e263363. [Google Scholar] [CrossRef] [PubMed]
  29. Mashayekh, Z.; Khaki, P. Detection of invA, sivH, and agfA virulence genes in Salmonella spp. isolated from broiler breeder farms in Alborz Province, Iran. Arch. Razi Inst. 2022, 77, 607. [Google Scholar] [CrossRef] [PubMed]
  30. Refai, M.; Hatem, M.E.; Elhariri, M.; Salem, G.H.; El-Said, A.H. Using of molecular biology techniques compared with conventional detection methods for detection of Salmonella in cattle in Egypt. J. Am. Sci. 2017, 13, 46–50. [Google Scholar] [CrossRef]
  31. Fekry, E.; Ammar, A.M.; Hussien, A.E. Molecular detection of InvA, OmpA and Stn genes in Salmonella serovars from broilers in Egypt. Alex. J. Vet. Sci. 2018, 68, 188–195. [Google Scholar] [CrossRef]
  32. Dishan, A.; Hizlisoy, H.; Onmaz, N.E.; Yildirim, Y.; Gonulalan, Z.; Al, S. Comprehensive analysis of Salmonella in poultry meat and products in Türkiye: Prevalence, antibiotic susceptibility and genomic characterisation. Int. J. Food Sci. Technol. 2024, 59, 3412–3422. [Google Scholar] [CrossRef]
  33. Dowidar, M.S.; Homouda, S.N.; Abd El Tawab, A.A. Antibiogram Pattern and Molecular Characterization of Multiple drug resistant Salmonella Isolated from Different Food Products in Egypt. Benha Vet. Med. J. 2024, 46, 119–124. [Google Scholar] [CrossRef]
  34. Tarabees, R.; Elsayed, M.S.; Shawish, R.; Basiouni, S.; Shehata, A.A. Isolation and characterization of Salmonella Enteritidis and Salmonella Typhimurium from chicken meat in Egypt. J. Infect. Dev. Ctries. 2017, 11, 314–319. [Google Scholar] [CrossRef]
  35. Myeni, S.K.; Wang, L.; Zhou, D. SipB-SipC complex is essential for translocon formation. PLoS ONE 2013, 8, e60499. [Google Scholar] [CrossRef] [PubMed]
  36. Eichelberg, K.; Galán, J.E. Differential regulation of Salmonella Typhimurium type III secreted proteins by pathogenicity island 1 (SPI-1)-encoded transcriptional activators InvF and HilA. Infect. Immun. 1999, 67, 4099–4105. [Google Scholar] [CrossRef]
  37. Walthers, D.; Carroll, R.K.; Navarre, W.W.; Libby, S.J.; Fang, F.C.; Kenney, L.J. The response regulator SsrB activates expression of diverse Salmonella pathogenicity island 2 promoters and counters silencing by the nucleoid-associated protein H-NS. Mol. Microbiol. 2007, 65, 477–493. [Google Scholar] [CrossRef] [PubMed]
  38. Feng, X.; Walthers, D.; Oropeza, R.; Kenney, L.J. The response regulator SsrB activates transcription and binds to a region overlapping OmpR binding sites at Salmonella pathogenicity island 2. Mol. Microbiol. 2004, 54, 823–835. [Google Scholar] [CrossRef] [PubMed]
  39. Ilyas, B.; Tsai, C.N.; Coombes, B.K. Evolution of Salmonella-host cell interactions through a dynamic bacterial genome. Front. Cell. Infect. Microbiol. 2017, 7, 428. [Google Scholar] [CrossRef] [PubMed]
  40. Nešić, D.; Hsu, Y.; Stebbins, C.E. Assembly and function of a bacterial genotoxin. Nature 2004, 429, 429–433. [Google Scholar] [CrossRef]
  41. Mezal, E.H.; Bae, D.; Khan, A.A. Detection and functionality of the CdtB, PltA, and PltB from Salmonella enterica serovar Javiana. Pathog. Dis. 2014, 72, 95–103. [Google Scholar] [CrossRef]
  42. Haghjoo, E.; Galán, J.E. Identification of a transcriptional regulator that controls intracellular gene expression in Salmonella Typhi. Mol. Microbiol. 2007, 64, 1549–1561. [Google Scholar] [CrossRef]
  43. Libby, S.J.; Lesnick, M.; Hasegawa, P.; Kurth, M.; Belcher, C.; Fierer, J.; Guiney, D.G. Characterization of the spv locus in Salmonella enterica serovar Arizona. Infect. Immun. 2002, 70, 3290–3294. [Google Scholar] [CrossRef]
  44. Derakhshandeh, A.; Firouzi, R.; Khoshbakht, R. Association of three plasmid-encoded spv genes among different Salmonella serotypes isolated from different origins. Indian. J. Microbiol. 2013, 53, 106–110. [Google Scholar] [CrossRef] [PubMed]
  45. Li, Y.Y.; Wang, T.; Gao, S.; Xu, G.M.; Niu, H.; Huang, R.; Wu, S.Y. Salmonella plasmid virulence gene spvB enhances bacterial virulence by inhibiting autophagy in a zebrafish infection model. Fish. Shellfish. Immunol. 2016, 49, 252–259. [Google Scholar] [CrossRef] [PubMed]
  46. Lesnick, M.L.; Reiner, N.E.; Fierer, J.; Guiney, D.G. The Salmonella spvB virulence gene encodes an enzyme that ADP-ribosylates actin and destabilizes the cytoskeleton of eukaryotic cells. Mol. Microbiol. 2001, 39, 1464–1470. [Google Scholar] [CrossRef] [PubMed]
  47. Passaris, I.; Cambré, A.; Govers, S.K.; Aertsen, A. Bimodal expression of the Salmonella Typhimurium spv operon. Genetics 2018, 210, 621–635. [Google Scholar] [CrossRef] [PubMed]
  48. Sodagari, H.R.; Mashak, Z.; Ghadimianazar, A. Prevalence and antimicrobial resistance of Salmonella serotypes isolated from retail chicken meat and giblets in Iran. J. Infect. Dev. Ctries. 2015, 9, 463–469. [Google Scholar] [CrossRef] [PubMed]
  49. Ramatla, T.; Mileng, K.; Ndou, R.; Mphuti, N.; Syakalima, M.; Lekota, K.E.; Thekisoe, O.M. Molecular detection of integrons, colistin and β-lactamase resistant genes in Salmonella enterica serovars Enteritidis and Typhimurium isolated from chickens and rats inhabiting poultry farms. Microorganisms 2022, 10, 313. [Google Scholar] [CrossRef]
  50. Ezzatpanah, A.; Moradi, B.S.; Khaki, P.; Ghaderi, R.; Seyedan Jasbi, S. Isolation, determination of serotype and pattern of antibiotic resistance of isolated Salmonella from poultry in Arak. Iran. Vet. J. 2013, 9, 88–96. [Google Scholar]
  51. Matchawe, C.; Machuka, E.M.; Kyallo, M.; Bonny, P.; Nkeunen, G.; Njaci, I.; Esemu, S.N.; Githae, D.; Juma, J.; Nfor, B.M.; et al. Detection of antimicrobial resistance, pathogenicity, and virulence potentials of non-typhoidal Salmonella isolates at the yaounde abattoir using whole-genome sequencing technique. Pathogens 2022, 11, 502. [Google Scholar] [CrossRef]
  52. Mohammed Jajere, S.; Hassan, L.; Zakaria, Z.; Abu, J.; Abdul Aziz, S. Antibiogram profiles and risk factors for multidrug resistance of salmonella enterica recovered from village chickens (gallus gallus domesticus linnaeus) and other environmental sources in the central and southern peninsular malaysia. Antibiotics 2020, 9, 701. [Google Scholar] [CrossRef]
  53. Zhang, L.; Fu, Y.; Xiong, Z.; Ma, Y.; Wei, Y.; Qu, X.; Zhang, H.; Zhang, J.; Liao, M. Highly prevalent multidrug-resistant Salmonella from chicken and pork meat at retail markets in Guangdong, China. Front. Microbiol 2018, 9, 2104. [Google Scholar] [CrossRef] [PubMed]
  54. Parvin, M.S.; Hasan, M.M.; Ali, M.Y.; Chowdhury, E.H.; Rahman, M.T.; Islam, M.T. Prevalence and multidrug resistance pattern of Salmonella carrying extended-spectrum β-lactamase in frozen chicken meat in Bangladesh. J. Food Prot. 2020, 83, 2107–2121. [Google Scholar] [CrossRef] [PubMed]
  55. Adesiji, Y.O.; Deekshit, V.K.; Karunasagar, I. Antimicrobial-resistant genes associated with Salmonella spp. isolated from human, poultry, and seafood sources. Food Sci. Nutr. 2014, 2, 436–442. [Google Scholar] [CrossRef] [PubMed]
  56. Mokgophi, T.M.; Gcebe, N.; Fasina, F.; Adesiyun, A.A. Antimicrobial resistance profiles of Salmonella isolates on chickens processed and retailed at outlets of the informal market in Gauteng Province, South Africa. Pathogens 2021, 10, 273. [Google Scholar] [CrossRef] [PubMed]
  57. Zou, W.; Frye, J.G.; Chang, C.W.; Liu, J.I.; Cerniglia, C.E.; Nayak, R.A. Microarray analysis of antimicrobial resistance genes in Salmonella enterica from preharvest poultry environment. J. Appl. Microbiol. 2009, 107, 906–914. [Google Scholar] [CrossRef] [PubMed]
  58. Glenn, L.M.; Lindsey, R.L.; Frank, J.F.; Meinersmann, R.J.; Englen, M.D.; Fedorka-Cray, P.J.; Frye, J.G. Analysis of antimicrobial resistance genes detected in multidrug-resistant Salmonella enterica serovar Typhimurium isolated from food animals. Microb. Drug Resist. 2011, 17, 407–418. [Google Scholar] [CrossRef] [PubMed]
  59. Mąka, Ł.; Maćkiw, E.; Ścieżyńska, H.; Modzelewska, M.; Popowska, M. Resistance to sulfonamides and dissemination of sul genes among Salmonella spp. isolated from food in Poland. Foodborne Pathog. Dis. 2015, 12 (Suppl. S5), 383–389. [Google Scholar] [CrossRef] [PubMed]
  60. Bertelloni, F.; Cagnoli, G.; Turchi, B.; Ebani, V.V. Low Level of Colistin Resistance and mcr Genes Presence in Salmonella spp.: Evaluation of Isolates Collected between 2000 and 2020 from Animals and Environment. Antibiotics 2022, 11, 272. [Google Scholar] [CrossRef]
  61. Mei, C.Y.; Jiang, Y.; Ma, Q.C.; Lu, M.J.; Wu, H.; Wang, Z.Y.; Jiao, X.; Wang, J. Chromosomally and Plasmid-Located mcr in Salmonella from Animals and Food Products in China. Microbiol. Spectr. 2022, 10, e02773-22. [Google Scholar] [CrossRef]
  62. Raeisi, E.; Ghiamirad, M. Survey on prevalence of Salmonella serogroups and antibiotics susceptibility pattern in chicken meat in Ardabil, Iran. J. Ardabil Univ. Med. Sci. 2015, 15, 320–329. [Google Scholar]
  63. Hasman, H.; Mevius, D.; Veldman, K.; Olesen, I.; Aarestrup, F.M. β-Lactamases among extended-spectrum β-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. 2005, 56, 115–121. [Google Scholar] [CrossRef] [PubMed]
  64. Yang, J.; Zhang, Z.; Zhou, X.; Cui, Y.; Shi, C.; Shi, X. Prevalence and characterization of antimicrobial resistance in Salmonella enterica isolates from retail foods in Shanghai, China. Foodborne Pathog. Dis. 2020, 17, 35–43. [Google Scholar] [CrossRef] [PubMed]
  65. Aslam, M.; Checkley, S.; Avery, B.; Chalmers, G.; Bohaychuk, V.; Gensler, G.; Reid-Smith, R.; Boerlin, P. Phenotypic and genetic characterization of antimicrobial resistance in Salmonella serovars isolated from retail meats in Alberta, Canada. Food Microbiol. 2012, 32, 110–117. [Google Scholar] [CrossRef]
  66. Lu, Y.; Wu, C.M.; Wu, G.J.; Zhao, H.Y.; He, T.; Cao, X.Y.; Dai, L.; Xia, L.N.; Qin, S.S.; Shen, J.Z. Prevalence of antimicrobial resistance among Salmonella isolates from chicken in China. Foodborne Pathog. Dis. 2011, 8, 45–53. [Google Scholar] [CrossRef] [PubMed]
  67. Siddiky, N.A.; Sarker, S.; Khan, S.R.; Rahman, T.; Kafi, A.; Samad, M.A. Virulence and antimicrobial resistance profile of non-typhoidal Salmonella enterica serovars recovered from poultry processing environments at wet markets in Dhaka, Bangladesh. PLoS ONE 2022, 17, e0254465. [Google Scholar] [CrossRef]
  68. Eguale, T.; Birungi, J.; Asrat, D.; Njahira, M.N.; Njuguna, J.; Gebreyes, W.A.; Gunn, J.S.; Djikeng, A.; Engidawork, E. Genetic markers associated with resistance to beta-lactam and quinolone antimicrobials in non-typhoidal Salmonella isolates from humans and animals in central Ethiopia. Antimicrob. Resist. Infect. Control 2017, 6, 13. [Google Scholar] [CrossRef] [PubMed]
  69. Palmeira, J.D.; Ferreira, H.M. “Extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae in cattle production–a threat around the world. Heliyon 2020, 6, e03206. [Google Scholar] [CrossRef]
  70. Logan, L.K.; Weinstein, R.A. “The epidemiology of carbapenem-resistant Enterobacteriaceae: The impact and evolution of a global menace. J. Infect. Dis. 2017, 215, S28–S36. [Google Scholar] [CrossRef]
  71. Dashti, A.A.; Jadaon, M.M.; Abdulsamad, A.M.; Dashti, H.M. Heat treatment of bacteria: A simple method of DNA extraction for molecular techniques. Kuwait Med. J. 2009, 41, 117–122. [Google Scholar]
  72. Shin, S.K.; Lee, Y.; Kwon, H.; Rhee, J.S.; Kim, J.K. Validation of Direct Boiling Method for Simple and Efficient Genomic DNA Extraction and PCR-based Macroalgal Species Determination. J. Phycol. 2021, 57, 1368–1372. [Google Scholar] [CrossRef]
  73. Thung, T.Y.; Radu, S.; Mahyudin, N.A.; Rukayadi, Y.; Zakaria, Z.; Mazlan, N.; Tan, B.H.; Lee, E.; Yeoh, S.L.; Chin, Y.Z.; et al. Prevalence, virulence genes and antimicrobial resistance profiles of Salmonella serovars from retail beef in Selangor, Malaysia. Front. Microbiol. 2018, 8, 2697. [Google Scholar] [CrossRef] [PubMed]
  74. Mlangeni, L.N.; Ramatla, T.; Lekota, K.E.; Price, C.; Thekisoe, O.; Weldon, C. Occurrence, Antimicrobial Resistance, and Virulence Profiles of Salmonella Serovars Isolated from Wild Reptiles in South Africa. Int. J. Microbiol. 2024, 2024, 5213895. [Google Scholar] [CrossRef]
  75. Khasapane, N.G.; Koos, M.; Nkhebenyane, S.J.; Khumalo, Z.T.; Ramatla, T.; Thekisoe, O. Detection of staphylococcus isolates and their antimicrobial resistance profiles and virulence genes from subclinical mastitis cattle milk using MALDI-TOF MS, PCR and sequencing in free state province, South Africa. Animals 2024, 14, 154. [Google Scholar] [CrossRef] [PubMed]
  76. Yue, M.; Li, X.; Liu, D.; Hu, X. Serotypes, antibiotic resistance, and virulence genes of Salmonella in children with diarrhea. J. Clin. Lab. Anal. 2020, 34, e23525. [Google Scholar] [CrossRef] [PubMed]
  77. European Food Safety Authority, European Centre for Disease Prevention and Control. The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2016. EFSA J. 2018, 16, e05182. [Google Scholar]
  78. Sun, W.; Qian, X.; Gu, J.; Wang, X.-J.; Duan, M.-L. Mechanism and Effect of Temperature on Variations in Antibiotic Resistance Genes during Anaerobic Digestion of Dairy Manure. Sci. Rep. 2016, 6, 30237. [Google Scholar] [CrossRef] [PubMed]
  79. Jiang, L.; Hu, X.; Xu, T.; Zhang, H.; Sheng, D.; Yin, D. Prevalence of antibiotic resistance genes and their relationship with antibiotics in the Huangpu River and the drinking water sources, Shanghai, China. Sci. Total. Environ. 2013, 458-460, 267–272. [Google Scholar] [CrossRef] [PubMed]
  80. Hong, B.; Ba, Y.; Niu, L.; Lou, F.; Zhang, Z.; Liu, H.; Pan, Y.; Zhao, Y. A Comprehensive Research on Antibiotic Resistance Genes in Microbiota of Aquatic Animals. Front. Microbiol. 2018, 9, 1617. [Google Scholar] [CrossRef]
  81. Gundran, R.S.; Cardenio, P.A.; Villanueva, M.A.; Sison, F.B.; Benigno, C.C.; Kreausukon, K.; Pichpol, D.; Punyapornwithaya, V. Prevalence and distribution of blaTX-M, blaSHV, blaTEM genes in extended-spectrum β-lactamase-producing E. coli isolates from broiler farms in the Philippines. BMC Vet. Res. 2019, 15, 227. [Google Scholar] [CrossRef]
  82. Liu, G.; Ding, L.; Han, B.; Piepers, S.; Naqvi, S.A.; Barkema, H.W.; Ali, T.; De Vliegher, S.; Xu, S.; Gao, J. Characteristics of Escherichia coli Isolated from Bovine Mastitis Exposed to Subminimum Inhibitory Concentrations of Cefalotin or Ceftazidime. BioMed Res. Int. 2018, 2018, 4301628. [Google Scholar] [CrossRef]
  83. Xu, J.; Xu, Y.; Wang, H.; Guo, C.; Qiu, H.; He, Y.; Zhang, Y.; Li, X.; Meng, W. Occurrence of antibiotics and antibiotic resistance genes in a sewage treatment plant and its effluent-receiving river. Chemosphere 2015, 119, 1379–1385. [Google Scholar] [CrossRef] [PubMed]
Antibiotics 13 00458 g001
Figure 1. Salmonella spp. from pooled fecal samples of broiler chickens.
Figure 1. Salmonella spp. from pooled fecal samples of broiler chickens.
Antibiotics 13 00458 g001
Antibiotics 13 00458 g002
Figure 2. Virulence genes profiles of S. Typhimurium and S. Enteritidis isolated from the feces of broiler chickens.
Figure 2. Virulence genes profiles of S. Typhimurium and S. Enteritidis isolated from the feces of broiler chickens.
Antibiotics 13 00458 g002
Antibiotics 13 00458 g003
Figure 3. Bubble plot shows the phenotypic antimicrobial resistance profiles detected in 22 isolates of S. Typhimurium and S. Enteritidis from broiler chickens. The circles shaded blue indicate the resistant antibiotics that were detected in each isolate.
Figure 3. Bubble plot shows the phenotypic antimicrobial resistance profiles detected in 22 isolates of S. Typhimurium and S. Enteritidis from broiler chickens. The circles shaded blue indicate the resistant antibiotics that were detected in each isolate.
Antibiotics 13 00458 g003
Antibiotics 13 00458 g004
Figure 4. Bubble plot of the antimicrobial resistance gene (ARGs) profiles of S. Typhimurium and S. Enteritidis isolates from broiler chickens. The grey circles indicate the ARGs that were detected in each isolate.
Figure 4. Bubble plot of the antimicrobial resistance gene (ARGs) profiles of S. Typhimurium and S. Enteritidis isolates from broiler chickens. The grey circles indicate the ARGs that were detected in each isolate.
Antibiotics 13 00458 g004
Table 1. The oligonucleotide primers used for detection of virulence associated genes of Salmonella isolates.
Table 1. The oligonucleotide primers used for detection of virulence associated genes of Salmonella isolates.
GeneLocationPrimer NamePrimer Sequence (5′-3′)Amplicon Size (bp)Annealing Temp (°C)
hilASPI-1hilA-F
hilA-R 		GACAGAGCTGGACCACAATAAGACA
GAGCGTAATTCATCGCCTAAAC		31255 °C
ssrBSPI-2ssrB-F
ssrB-R		CTCATTCTTCGGGCACAGTTA
CCTTATTACCCTGGCCTCATTT		55855 °C
marTSPI-3marT- F
marT-R 		CGTCGTCTCACAACAAACATTC
CTGACAAATCAATGCCGTAACC		55655 °C
sopBSPI-5sopB-F
sopB-R		TCACTAAAAACCCAGGAGGCTTTT
CGCCATCTTTATTGCGGATTTTTA		100065 °C
pagNSPI-6pagN-F
pagN-R		TTCCAGCTTCCAGTACGTTTAG
GCCTTTGTGTCTGCATCATAAG		44055 °C
vexASPI-7vexA-F
vexA-R		AAACTAAGCGCTCCCGATAC
CAGTCGCGCAGTGAAATAATG		50455 °C
nlpISPI-8nlpI-F
nlpI-R		AGTCTTGGTTTGAGGGCATTAG
TTCTTTCGCCTGCTTCTCATTA		33355 °C
bapASPI-9bapA-F
bapA-R		TAAGCGTCGGACTTGGAATG
CGTTCTTCAGCGTGTAGGTATAG		54355 °C
pagCSPI-11pagC-F
pagC-R		CGCCTTTTCCGTGGGGTATGC
GAAGCCGTTTATTTTTGTAGAGGAGATGTT		45466.5 °C
oafASPI-12oafA-F
oafA-R		CGAGTGACTGGAACCAAAGA
CAAGCATAGAGCCAGAGTAGAG		51055 °C
spvBPlasmidspvB-F
spvB-R		CTATCAGCCCCGCACGGAGAGCAGTTTTTA
GGAGGAGGCGGTGGCGGTGGCATCATA		71766.5 °C
cdtBGenomecdtB-F
cdtB-R		ACAACTGTCGCATCTCGCCCCGTCATT
CAATTTGCGTGGGTTCTGTAGGTGCGAGT		26866.5 °C
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ramatla, T.; Khasapane, N.G.; Mlangeni, L.N.; Mokgokong, P.; Ramaili, T.; Ndou, R.; Nkhebenyane, J.S.; Lekota, K.; Thekisoe, O. Detection of Salmonella Pathogenicity Islands and Antimicrobial-Resistant Genes in Salmonella enterica Serovars Enteritidis and Typhimurium Isolated from Broiler Chickens. Antibiotics 2024, 13, 458. https://doi.org/10.3390/antibiotics13050458

AMA Style

Ramatla T, Khasapane NG, Mlangeni LN, Mokgokong P, Ramaili T, Ndou R, Nkhebenyane JS, Lekota K, Thekisoe O. Detection of Salmonella Pathogenicity Islands and Antimicrobial-Resistant Genes in Salmonella enterica Serovars Enteritidis and Typhimurium Isolated from Broiler Chickens. Antibiotics. 2024; 13(5):458. https://doi.org/10.3390/antibiotics13050458

Chicago/Turabian Style

Ramatla, Tsepo, Ntelekwane G. Khasapane, Lungile N. Mlangeni, Prudent Mokgokong, Taole Ramaili, Rendani Ndou, Jane S. Nkhebenyane, Kgaugelo Lekota, and Oriel Thekisoe. 2024. "Detection of Salmonella Pathogenicity Islands and Antimicrobial-Resistant Genes in Salmonella enterica Serovars Enteritidis and Typhimurium Isolated from Broiler Chickens" Antibiotics 13, no. 5: 458. https://doi.org/10.3390/antibiotics13050458

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop