Hesperitin-Copper(II) Complex Regulates the NLRP3 Pathway and Attenuates Hyperuricemia and Renal Inflammation
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Animals
2.3. Biochemical Assays
2.4. Histopathological Observation
2.5. RT-PCR
2.6. Western Blot
2.7. Statistical Analysis
3. Results
3.1. Organ Index and BW of Mice
3.2. Serum Physicochemical Indexes of HUA Mice
3.3. Histopathological Observation of the Kidneys in HUA Mice
3.4. Activities of XO and ADA
3.5. Protein and mRNA Expression Level of UA Transporters in the Kidneys
3.6. Oxidative Stress in the Kidneys
3.7. NLRP3 Inflammatory Pathway
3.8. Content of Cytokines in the Kidneys
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Nutmakul, T. A review on benefits of quercetin in hyperuricemia and gouty arthritis. Saudi Pharm. J. 2022, 30, 918–926. [Google Scholar] [CrossRef]
- Zhu, Y.; Zhang, R.; Wei, Y.; Cai, M.; Ma, Y.; Gu, R.; Zhang, H.; Pan, X. Rice peptide and collagen peptide prevented potassium oxonate-induced hyperuricemia and renal damage. Food Biosci. 2021, 42, 101147. [Google Scholar] [CrossRef]
- Ejaz, A.A.; Nakagawa, T.; Kanbay, M.; Kuwabara, M.; Kumar, A.; Arroyo, F.E.G.; Roncal-Jimenez, C.; Sasai, F.; Kang, D.-H.; Jensen, T.; et al. Hyperuricemia in Kidney Disease: A Major Risk Factor for Cardiovascular Events, Vascular Calcification, and Renal Damage. Semin Nephrol. 2020, 40, 574–585. [Google Scholar] [CrossRef]
- Agnoletti, D.; Cicero, A.F.G.; Borghi, C. The Impact of Uric Acid and Hyperuricemia on Cardiovascular and Renal Systems. Cardiol. Clin. 2021, 39, 365–376. [Google Scholar] [CrossRef]
- Wang, Q.; Duoji, Z.; Feng, C.; Fei, T.; Ma, H.; Wang, S.; Ciren, W.; Yang, T.; Ling, H.; Ma, B.; et al. Associations and pathways between residential greenness and hyperuricemia among adults in rural and urban China. Environ. Res. 2022, 215, 114406. [Google Scholar] [CrossRef]
- Liu, G.; Chen, X.; Lu, X.; Zhao, J.; Li, X. Sunflower head enzymatic hydrolysate relives hyperuricemia by inhibiting crucial proteins (xanthine oxidase, adenosine deaminase, uric acid transporter1) and restoring gut microbiota in mice. J. Funct. Foods 2020, 72, 104055. [Google Scholar] [CrossRef]
- Sung, Y.; Yuk, H.J.; Kim, D. Saengmaeksan, a traditional herbal formulation consisting of Panax ginseng, ameliorates hyperuricemia by inhibiting xanthine oxidase activity and enhancing urate excretion in rats. J. Ginseng. Res. 2021, 45, 565–574. [Google Scholar] [CrossRef]
- Huang, Y.; Wu, C.; Guo, L.; Zhang, X.; Xia, D. Effects of polysaccharides-riched Prunus mume fruit juice concentrate on uric acid excretion and gut microbiota in mice with adenine-induced chronic kidney disease. Curr. Res. Food. Sci. 2022, 5, 2135–2145. [Google Scholar] [CrossRef]
- Han, S.; Wei, R.; Han, D.; Zhu, J.; Luo, W.; Ao, W.; Zhong, G. Hypouricemic effects of extracts from Urtica hyperborea Jacq. ex Wedd. in hyperuricemia mice through XOD, URAT1, and OAT1. Biomed. Res. Int. 2020, 2020, 2968135. [Google Scholar] [CrossRef]
- Qian, X.; Wang, X.; Luo, J.; Liu, Y.; Pang, J.; Zhang, H.; Xu, Z.; Xie, J.; Jiang, X.; Ling, W. Hypouricemic and nephroprotective roles of anthocyanins in hyperuricemic mice. Food Funct. 2019, 10, 867–878. [Google Scholar] [CrossRef]
- Bao, R.; Chen, Q.; Li, Z.; Wang, D.; Wu, Y.; Liu, M.; Zhang, Y.; Wang, T. Eurycomanol alleviates hyperuricemia by promoting uric acid excretion and reducing purine synthesis. Phytomedicine 2022, 96, 153850. [Google Scholar] [CrossRef]
- Ooi, K.L.; Zakaria, R.; Tan, M.L.; Sulaiman, S.F. The influence of chemical composition of potent inhibitors in the hydrolyzed extracts of anti-hyperuricemic plants to their xanthine oxidase activities. J. Ethnopharmacol. 2021, 278, 114294. [Google Scholar] [CrossRef]
- Noh, S.; Lee, S.H.; Shin, K.Y.; Lee, C.K.; Cho, I.H.; Kim, H.; Suh, Y. SP-8203 reduces oxidative stress via SOD activity and behavioral deficit in cerebral ischemia. Pharmacol. Biochem. Behav. 2011, 98, 150–154. [Google Scholar] [CrossRef]
- Tan, M.; Zhu, J.; Pan, Y.; Chen, Z.; Liang, H.; Liu, H.; Wang, H. Synthesis, cytotoxic activity, and DNA binding properties of copper (II) complexes with hesperetin, naringenin, and apigenin. Bioinorg. Chem. Appl. 2009, 2009, 347872. [Google Scholar] [CrossRef]
- Bai, H.; Zhang, Z.; Ma, X.; Shen, M.; Li, R.; Li, S.; Qiu, D.; Gao, L. Inhibition of the NLRP3/caspase-1 signaling cascades ameliorates ketamine-induced renal injury and pyroptosis in neonatal rats. Biomed. Pharmacother. 2022, 152, 113229. [Google Scholar] [CrossRef]
- Balakumar, P.; Alqahtani, A.; Khan, N.A.; Mahadevan, N.; Dhanaraj, S.A. Mechanistic insights into hyperuricemia-associated renal abnormalities with special emphasis on epithelial-to-mesenchymal transition: Pathologic implications and putative pharmacologic targets. Pharmacol. Res. 2020, 161, 105209. [Google Scholar] [CrossRef]
- Lee, J.E.; Lee, P.; Yoon, Y.-C.; Han, B.S.; Ko, S.; Park, M.S.; Lee, Y.J.; Kim, S.E.; Cho, Y.J.; Lim, J.H.; et al. Vactosertib, TGF-β receptor I inhibitor, augments the sensitization of the anti-cancer activity of gemcitabine in pancreatic cancer. Biomed. Pharmacother. 2023, 162, 114716. [Google Scholar] [CrossRef]
- El-Fawal, R.; El Fayoumi, H.M.; Mahmoud, M.F. Diosmin and crocin alleviate nephropathy in metabolic syndrome rat model: Effect on oxidative stress and low-grade inflammation. Biomed. Pharmacother. 2018, 102, 930–937. [Google Scholar] [CrossRef]
- Ernst, M.E.; Fravel, M.A. Febuxostat: A selective xanthine-oxidase / xanthine-dehydrogenase inhibitor for the management of hyperuricemia in adults with gout. Clin. Ther. 2009, 31, 2503–2518. [Google Scholar] [CrossRef]
- Singh, M.; Kaur, M.; Silakari, O. Flavones: An important scaffold for medicinal chemistry. Eur. J. Med. Chem. 2014, 84, 206–239. [Google Scholar] [CrossRef]
- Lodhi, S.; Vadnere, G.P.; Patil, K.D.; Patil, T.P. Protective effects of luteolin on injury induced inflammation through reduction of tissue uric acid and pro-inflammatory cytokines in rats. J. Tradit. Complement Med. 2020, 10, 60–69. [Google Scholar] [CrossRef]
- Chen, Y.; Zhao, Z.; Li, Y.; Yang, Y.; Li, L.; Jiang, Y.; Lin, C.; Cao, Y.; Zhou, P.; Tian, Y.; et al. Baicalein alleviates hyperuricemia by promoting uric acid excretion and inhibiting xanthine oxidase. Phytomedicine 2021, 80, 153374. [Google Scholar] [CrossRef]
- Xu, Y.-Y.; Zhu, L.-P.; Zheng, X.; Jiang, C.-H.; Liu, J.-J.; Zhang, J.; Yin, Z.-Q. Protective effects of Cyclocarya paliurus on hyperuricemia and urate-induced inflammation. J. Funct. Food 2022, 94, 105130. [Google Scholar] [CrossRef]
- Feng, S.; Wu, S.; Xie, F.; Yang, C.S.; Shao, P. Natural compounds lower uric acid levels and hyperuricemia: Molecular mechanisms and prospective. Trends Food Sci. Technol. 2022, 123, 87–102. [Google Scholar] [CrossRef]
- Ribeiro, A.P.D.; Pereira, A.G.; Todo, M.C.; Fujimori, A.S.S.; dos Santos, P.P.; Dantas, D.; Fernandes, A.A.; Zanati, S.G.; Hassimotto, N.M.A.; Zornoff, L.A.M.; et al. Pera orange (Citrus sinensis) and Moro orange (Citrus sinensis (L.) Osbeck) juices attenuate left ventricular dysfunction and oxidative stress and improve myocardial energy metabolism in acute doxorubicin-induced cardiotoxicity in rats. Nutrition 2021, 91, 111350. [Google Scholar] [CrossRef]
- Pandey, P.; Khan, F. A mechanistic review of the anticancer potential of hesperidin, a natural flavonoid from citrus fruits. Nutr. Res. 2021, 92, 21–31. [Google Scholar] [CrossRef]
- Haidari, F.; Ali Keshavarz, S.; Reza Rashidi, M.; Mohammad Shahi, M. Orange juice and hesperetin supplementation to hyperuricemic rats alter oxidative stress markers and xanthine oxidoreductase activity. J. Clin. Biochem. Nutr. 2009, 45, 285–291. [Google Scholar] [CrossRef]
- Roy, S.; Mallick, S.; Chakraborty, T.; Ghosh, N.; Singh, A.K.; Manna, S.; Majumdar, S. Synthesis, characterisation and antioxidant activity of luteolin-vanadium (II) complex. Food Chem. 2015, 173, 1172–1178. [Google Scholar] [CrossRef]
- Cazarolli, L.H.; Zanatta, L.; Jorge, A.P.; de Sousa, E.; Horst, H.; Woehl, V.M.; Pizzolatti, M.G.; Szpoganicz, B.; Silva, F.R.M.B. Follow-up studies on glycosylated flavonoids and their complexes with vanadium: Their anti-hyperglycemic potential role in diabetes. Chem. Biol. Interact. 2006, 163, 177–191. [Google Scholar] [CrossRef]
- Li, J.; Wang, L.; Bai, H.; Yang, B.; Yang, H. Synthesis, characterization, and anti-inflammatory activities of rare earth metal complexes of luteolin. Med. Chem. Res. 2011, 20, 88–92. [Google Scholar] [CrossRef]
- Xu, D.; Hu, M.; Wang, Y.; Cui, Y. Antioxidant activities of quercetin and its complexes for medicinal application. Molecules 2019, 24, 1123. [Google Scholar] [CrossRef]
- Lin, S.; Zeng, L.; Zhang, G.; Liao, Y.; Gong, D. Synthesis, characterization and xanthine oxidase inhibition of Cu (II)-chrysin complex. Spectrochim. Acta Part A 2017, 178, 71–78. [Google Scholar] [CrossRef]
- Liu, K.; Zeng, N.; Pan, J.H.; Gong, D.M.; Zhang, G.W. Synthesis, characterization, toxicity evaluation and inhibitory effect of hesperitin-copper (II) complex on xanthine oxidase. J. Mol. Liq. 2022, 368, 120812. [Google Scholar] [CrossRef]
- Zhang, M.; Cui, R.; Zhou, Y.; Ma, Y.; Jin, Y.; Gou, X.; Yang, J.; Wu, X. Uric acid accumulation in the kidney triggers mast cell degranulation and aggravates renal oxidative stress. Toxicology 2023, 483, 153387. [Google Scholar] [CrossRef] [PubMed]
- Jang, M.G.; Song, H.; Kim, J.H.; Oh, J.M.; Park, J.Y.; Ko, H.C.; Hur, S.-P.; Kim, S.-J. Prevention of hyperuricemia by Clerodendrum trichotomum leaf extract in potassium oxonate-induced mice. Dev. Rerprod. 2020, 24, 89–100. [Google Scholar] [CrossRef] [PubMed]
- Hwa, K.S.; Chung, D.; Chung, Y.C.; Chun, H.K. Hypouricemic effects of anthocyanin extracts of purple sweet potato on potassium oxonate-induced hyperuricemia in mice. Phytother. Res. 2011, 25, 1415–1417. [Google Scholar] [CrossRef]
- Yotsu-Yamashita, M.; Yamaki, H.; Okoshi, N.; Araki, N. Distribution of homologous proteins to puffer fish saxitoxin and tetrodotoxin binding protein in the plasma of puffer fish and among the tissues of Fugu pardalis examined by Western blot analysis. Toxicon 2010, 55, 1119–1124. [Google Scholar] [CrossRef]
- Luo, X.; Zhou, L.; Wang, S.; Yuan, J.; Chang, Z.; Hu, Q.; Chen, Y.; Liu, Y.; Huang, Y.; Wang, B.; et al. The therapeutic effect and the potential mechanism of flavonoids and phenolics of Moringa oleifera Lam. Leaves against hyperuricemia mice. Molecules 2022, 27, 8237. [Google Scholar] [CrossRef]
- Meng, Z.; Yan, Y.; Tang, Z.; Guo, C.; Li, N.; Huang, W.; Ding, G.; Wang, Z.; Xiao, W.; Yang, Z. Anti-hyperuricemic and nephroprotective effects of rhein in hyperuricemic mice. Planta Med. 2015, 81, 279–285. [Google Scholar] [CrossRef]
- Jiang, Y.; Lin, Y.; Hu, Y.; Song, X.; Pan, H.; Zhang, H. Caffeoylquinic acid derivatives rich extract from Gnaphalium pensylvanicum willd. Ameliorates hyperuricemia and acute gouty arthritis in animal model. BMC Complement. Altern. Med. 2017, 17, 320. [Google Scholar] [CrossRef]
- Cui, D.; Liu, S.; Tang, M.; Lu, Y.; Zhao, M.; Mao, R.; Wang, C.; Yuan, Y.; Li, L.; Chen, Y.; et al. Phloretin ameliorates hyperuricemia-induced chronic renal dysfunction through inhibiting NLRP3 inflammasome and uric acid reabsorption. Phytomedicine 2020, 66, 153111. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Tan, M.; Li, K.; Leung, P.; Ko, C. Green tea polyphenols decreases uric acid level through xanthine oxidase and renal urate transporters in hyperuricemic mice. J. Ethnopharmacol. 2015, 175, 14–20. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Liu, P.-G.; Liang, W.-Q.; Hu, Y.-J.; Xu, P.; Zhou, J.; Pu, J.-B.; Zhang, H.-J. Luteolin-4′-O-glucoside and its aglycone, two major flavones of Gnaphalium affine D. Don, resist hyperuricemia and acute gouty arthritis activity in animal models. Phytomedicine 2018, 41, 54–61. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Wei, L.; Han, Z.; Xiong, H.; Han, W. Comparative pharmacokinetic study of hesperetin after oral administration in normal and hyperuricemia rats by UPLC-MS/MS. Curr. Clin. Pharmacol. 2020, 15, 155–161. [Google Scholar] [CrossRef]
- Asiltas, B.; Surmen-Gur, E.; Uncu, G. Prediction of first-trimester preeclampsia: Relevance of the oxidative stress marker MDA in a combination model with PP-13, PAPP-A and beta-HCG. Pathophysiology 2018, 25, 131–135. [Google Scholar] [CrossRef]
- Hao, M.; Liu, R. Molecular mechanism of CAT and SOD activity change under MPA-CdTe quantum dots induced oxidative stress in the mouse primary hepatocytes. Spectrochim. Acta Part A 2019, 220, 117104. [Google Scholar] [CrossRef]
- El-Megharbel, S.M.; Al-Salmi, F.A.; Refat, M.S.; Hamza, R.Z. Selenium/Chitosan-folic acid metal complex ameliorates hepatic damage and oxidative injury in male rats exposed to sodium fluoride. Crystals 2021, 11, 1354. [Google Scholar] [CrossRef]
- Su, X.; Liu, B.; Wang, S.; Wang, Y.; Zhang, Z.; Zhou, H.; Li, F. NLRP3 inflammasome: A potential therapeutic target to minimize renal ischemia/reperfusion injury during transplantation. Transpl. Immunol. 2022, 75, 101718. [Google Scholar] [CrossRef]
- Nunes, P.R.; Romao-Veiga, M.; Peracoli, M.T.S.; Peracoli, J.C.; Sandrim, V.C. Potential role of uric acid to activate NLRP3 inflammasome triggering endothelial dysfunction in preeclampsia. Clin. Immunol. Commun. 2022, 2, 69–75. [Google Scholar] [CrossRef]
- Qi, X.; Ma, Y.; Guan, K.; Liu, C.; Wang, R.; Ma, Y.; Niu, T. Whey protein peptide PEW attenuates hyperuricemia and associated renal inflammation in potassium oxonate and hypoxanthine-induced rat. Food Biosci. 2023, 51, 102311. [Google Scholar] [CrossRef]
- Lin, K.; Luo, W.; Yang, N.; Su, L.; Zhou, H.; Hu, X.; Wang, Y.; Khan, Z.A.; Huang, W.; Wu, G.; et al. Inhibition of MyD88 attenuates angiotensin II-induced hypertensive kidney disease via regulating renal inflammation. Int. Immunopharmacol. 2022, 112, 109218. [Google Scholar] [CrossRef]
- Zhou, Z.; Ying, C.; Zhou, X.; Shi, Y.; Xu, J.; Zhu, Y.; Wang, M.; Li, Y.; Li, X.; Xiang, J. Aerobic exercise training alleviates renal injury in db/db mice through inhibiting Nox4-mediated NLRP3 inflammasome activation. Exp. Gerontol. 2022, 168, 111934. [Google Scholar] [CrossRef]
- Dinda, B.; Dinda, S.; DasSharma, S.; Banik, R.; Chakraborty, A.; Dinda, M. Therapeutic potentials of baicalin and its aglycone, baicalein against inflammatory disorders. Eur. J. Med. Chem. 2017, 131, 68–80. [Google Scholar] [CrossRef]
- Sah, O.S.P.; Yu, X.Q. Associations between hyperuricemia and chronic kidney disease: A review. Nephro-Urol. Mon. 2015, 7, e27233. [Google Scholar] [CrossRef]
- Zhuang, J.; Zhou, X.; Liu, T.; Zhang, S.; Yuan, F.; Zhang, L.; Yang, Z.; Chen, Y. Astaxanthin attenuated hyperuricemia and kidney inflammation by inhibiting uric acid synthesis and the NF-κ B/NLRP3 signaling pathways in potassium oxonate and hypoxanthine-induced hyperuricemia mice. Pharmazie 2021, 76, 551–558. [Google Scholar] [CrossRef]
- Chen, N.; Wang, R.; Li, H.; Wang, W.; Wang, L.; Yin, X.; Yao, R.; Yang, B. Flavonoid extract of saffron by-product alleviates hyperuricemia via inhibiting xanthine oxidase and modulating gut microbiota. Phytother. Res. 2022, 36, 4604–4619. [Google Scholar] [CrossRef]
- Battelli, M.G.; Bortolotti, M.; Polito, L.; Bolognesi, A. The role of xanthine oxidoreductase and uric acid in metabolic syndrome. Biochim. Biophys. Acta (BBA) Mol. Basis Dis. 2018, 1864, 2557–2565. [Google Scholar] [CrossRef]
- Wang, X.; Cui, Z.; Luo, Y.; Huang, Y.; Yang, X. In vitro xanthine oxidase inhibitory and in vivo anti-hyperuricemic properties of sodium kaempferol-3′-sulfonate. Food Chem. Toxicol. 2023, 177, 113854. [Google Scholar] [CrossRef] [PubMed]
- Hu, W.; Xu, D. Identification of anti-hyperuricemic components from Cichorium intybus L. taproots. Food Biosci. 2023, 56, 103145. [Google Scholar] [CrossRef]
- Huang, Y.; Li, C.; Xu, W.; Li, F.; Xu, C.; Wu, C.; Wang, Y.; Zhang, X.; Xia, D. Kaempferol suppresses inflammation in mice suffering from both hyperuricemia and gouty arthritis through inhibiting NLRP3 inflammasome and NF-κB pathway. Res. Sq. 2023. [Google Scholar] [CrossRef]
- Wu, H.; Zhou, M.; Lu, G.; Yang, Z.; Ji, H.; Hu, Q. Emodinol ameliorates urate nephropathy by regulating renal organic ion transporters and inhibiting immune inflammatory responses in rats. Biomed. Pharmacother. 2017, 96, 727–735. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Dong, Y.; Na, S.; Han, R.; Wei, C.; Chen, G. Saponins extracted from Dioscorea collettii rhizomes regulate the expression of urate transporters in chronic hyperuricemia rats. Biomed. Pharmacother. 2017, 93, 88–94. [Google Scholar] [CrossRef] [PubMed]
- Lian, D.; Yuan, H.; Yin, X.; Wu, Y.; He, R.; Huang, Y.; Chen, Y. Puerarin inhibits hyperglycemia-induced inter-endothelial junction through suppressing endothelial Nlrp3 inflammasome activation via ROS-dependent oxidative pathway. Phytomedicine 2019, 55, 310–319. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.; Wu, Y.; Qu, C.; Lin, Y.; Yi, X.; Gao, C.; Cai, J.; Su, Z.; Zeng, H. Hypouricemic effect of gallic acid, a bioactive compound from Sonneratia apetala leaves and branches, on hyperuricemic mice. Food Funct. 2022, 13, 10275–10290. [Google Scholar] [CrossRef] [PubMed]
- Bulugonda, R.K.; Kumar, K.A.; Gangappa, D.; Beeda, H.; Philip, G.H.; Rao, D.M.; Faisal, S.M. Mangiferin from Pueraria tuberosa reduces inflammation via inactivation of NLRP3 inflammasome. Sci. Rep. 2017, 7, 42683. [Google Scholar] [CrossRef] [PubMed]
- Zhou, S.; Li, Y.; Hong, Y.; Zhong, Z.; Zhao, M. Puerarin protects against sepsis-associated encephalopathy by inhibiting NLRP3/Caspase-1/GSDMD pyroptosis pathway and reducing blood-brain barrier damage. Eur. J. Pharmacol. 2023, 945, 175616. [Google Scholar] [CrossRef]
- Zhu, C.; Zhang, L.; Liu, Z.; Li, C.; Bai, Y.; Wang, L. Atractylenolide III reduces NLRP3 inflammasome activation and Th1/Th2 imbalances in both in vitro and in vivo models of asthma. Clin. Exp. Pharmacol. Physiol. 2020, 47, 1360–1367. [Google Scholar] [CrossRef]
- Chung, H.; Vilaysane, A.; Lau, A.; Stahl, M.; Morampudi, V.; Bondzi-Simpson, A.; Platnich, J.M.; A Bracey, N.; French, M.-C.; Beck, P.L.; et al. NLRP3 regulates a non-canonical platform for caspase-8 activation during epithelial cell apoptosis. Cell Death Differ. 2016, 23, 1331–1346. [Google Scholar] [CrossRef]
- Antonopoulos, C.; Russo, H.M.; El Sanadi, C.; Martin, B.N.; Li, X.; Kaiser, W.J.; Mocarski, E.S.; Dubyak, G.R. Caspase-8 as an effector and regulator of NLRP3 inflammasome signaling. J. Biol. Chem. 2015, 290, 20167–20184. [Google Scholar] [CrossRef]
- Lebeaupin, C.; Proics, E.; de Bieville, C.H.D.; Rousseau, D.; Bonnafous, S.; Patouraux, S.; Adam, G.; Lavallard, V.J.; Rovere, C.; Le Thuc, O.; et al. ER stress induces NLRP3 inflammasome activation and hepatocyte death. Cell Death Dis. 2015, 6, e1879. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (3′-5′) |
---|---|---|
URAT1 | CAGCACCTTCAGGTCCACAA | TCTGCGCCCAAACCTATCTG |
GLUT9 | CACCAGCAGAGGAGGACAAA | GCTGGTCTGGAGCACCTCTA |
OAT1 | GCTGGTACTCCTCCTCTGGA | GGATAGGCATCCATTCCACATT |
GAPDH | ACATCATCCCTGCATCCACT | GTCCTCAGTGTAGCCCAAG |
Group | UA (mmol/L) | Cr (µmol/L) | BUN (mmol/L) |
---|---|---|---|
Normal | 136 ± 24.3 d | 46 ± 2.4 d | 8 ± 1.2 d |
Diseased | 241 ± 13.2 a | 67 ± 3.4 a | 15 ± 1.0 a |
Alp | 161 ± 14.8 b | 62 ± 4.1 b | 14 ± 0.7 b |
Hsp | 202 ± 24.0 b | 60 ± 3.3 b | 11 ± 1.2 c |
LHC | 194 ± 19.9 b | 61 ± 2.7 b | 12 ± 1.1 c |
MHC | 166 ± 21.1 c | 56 ± 2.6 c | 9 ± 1.1 d |
HHC | 149 ± 19.8 c | 54 ± 3.2 c | 9 ± 0.8 d |
Group | XOD Activity (U/L) | Inhibition Rate (%) | ADA Activity (U/L) | Inhibition Rate (%) |
---|---|---|---|---|
Normal | 206 ± 23.0 f | - | 258 ± 18.5 a | - |
Diseased | 364 ± 28.9 a | - | 268 ± 12.0 a | - |
Alp | 220 ± 15.0 ef | 39.5 | 252 ± 22.1 a | 5.9 |
Hsp | 324 ± 23.5 b | 10.9 | 258 ± 15.7 a | 3.7 |
LHC | 273 ± 18.1 c | 25.0 | 245 ± 16.3 a | 8.5 |
MHC | 240 ± 13.5 d | 34.0 | 218 ± 9.7 b | 18.4 |
HHC | 224 ± 19.4 de | 38.4 | 205 ± 10.8 b | 23.2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Peng, X.; Liu, K.; Hu, X.; Gong, D.; Zhang, G. Hesperitin-Copper(II) Complex Regulates the NLRP3 Pathway and Attenuates Hyperuricemia and Renal Inflammation. Foods 2024, 13, 591. https://doi.org/10.3390/foods13040591
Peng X, Liu K, Hu X, Gong D, Zhang G. Hesperitin-Copper(II) Complex Regulates the NLRP3 Pathway and Attenuates Hyperuricemia and Renal Inflammation. Foods. 2024; 13(4):591. https://doi.org/10.3390/foods13040591
Chicago/Turabian StylePeng, Xi, Kai Liu, Xing Hu, Deming Gong, and Guowen Zhang. 2024. "Hesperitin-Copper(II) Complex Regulates the NLRP3 Pathway and Attenuates Hyperuricemia and Renal Inflammation" Foods 13, no. 4: 591. https://doi.org/10.3390/foods13040591