Establishment of a Simple, Sensitive, and Specific Salmonella Detection Method Based on Recombinase-Aided Amplification Combined with dsDNA-Specific Nucleases
Abstract
:1. Introduction
2. Methods and Materials
2.1. Reagents and Materials
2.2. Bacterial Preparation and DNA Extraction
2.3. Construction of Target Gene pMD19-T-hilA Vector
2.4. Design and Screening of RAA Primers and dsDNAse Probes
2.5. Establishment of RAA-dsDNase Detection Method
2.6. RAA-dsDNase Reaction Condition Optimization
2.7. Sensitivity and Specificity Analysis of RAA-dsDNase and PCR Specificity Analysis
2.8. Establishment of One-Pot RAA-dsDNase-UV and One-Pot RAA-dsDNase-LFD Detection Methods
2.9. Sensitivity and Specificity Analysis of One-Pot RAA-dsDNase-UV and One-Pot RAA-dsDNase-LFD
2.10. Detection of Salmonella in Real Samples
3. Results
3.1. Design and Screening of RAA Primers and dsDNAse Probes
3.2. RAA-dsDNase Principle and Feasibility Analysis
3.3. Optimization of Reaction Buffer
3.4. Optimization of dsDNase Dosage
3.5. Optimization of Reaction Time
3.6. Sensitivity and Specificity Analysis of RAA-dsDNase and PCR Specificity Analysis
3.7. Establishment of One-Pot RAA-dsDNase-UV and One-Pot RAA-dsDNase-LFD Detection Methods
3.8. Sensitivity and Specificity Analysis of One-Pot RAA-dsDNase-UV and One-Pot RAA-dsDNase-LFD
3.9. Results of Salmonella Analysis in Tissues Using One-Pot RAA-dsDNase-UV and One-Pot RAA-dsDNase-LFD
3.10. Results of Salmonella Analysis in Milk Using One-Pot RAA-dsDNase-UV and One-Pot RAA-dsDNase-LFD
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gao, W.; Huang, H.; Zhu, P.; Yan, X.; Fan, J.; Jiang, J.; Xu, J. Recombinase polymerase amplification combined with lateral flow dipstick for equipment-free detection of Salmonella in shellfish. Bioprocess Biosyst. Eng. 2018, 41, 603–611. [Google Scholar] [CrossRef] [PubMed]
- Xue, L.; Guo, R.; Huang, F.; Qi, W.; Liu, Y.; Cai, G.; Lin, J. An impedance biosensor based on magnetic nanobead net and MnO2 nanoflowers for rapid and sensitive detection of foodborne bacteria. Biosens. Bioelectron. 2020, 173, 112800. [Google Scholar]
- Delibato, E.; Volpe, G.; Romanazzo, D.; De Medici, D.; Toti, L.; Moscone, D.; Palleschi, G. Development and application of an electrochemical plate coupled with immunomagnetic beads (ELIME) array for Salmonella enterica detection in meat samples. J. Agric. Food Chem. 2009, 57, 7200–7204. [Google Scholar] [CrossRef] [PubMed]
- Jarvis, N.A.; O’Bryan, C.A.; Dawoud, T.M.; Park, S.H.; Kwon, Y.M.; Crandall, P.G.; Ricke, S.C. An overview of Salmonella thermal destruction during food processing and preparation. Food Control 2016, 68, 280–290. [Google Scholar] [CrossRef]
- Shen, Y.; Xu, L.; Li, Y. Biosensors for rapid detection of Salmonella in food: A review. Compr. Rev. Food Sci. Food Saf. 2021, 20, 149–197. [Google Scholar] [CrossRef] [PubMed]
- Fang, J.; Wu, Y.; Qu, D.; Ma, B.; Yu, X.; Zhang, M.; Han, J. Propidium monoazide real-time loop-mediated isothermal amplification for specific visualization of viable Salmonella in food. Lett. Appl. Microbiol. 2018, 67, 79–88. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Wang, J.; Sun, X.X.; Wang, J.; Chen, Z.; Xu, X.; Dong, M.; Guo, Y.N.; Wang, Y.; Chen, P.; et al. Development and Evaluation of the Rapid and Sensitive RPA Assays for Specific Detection of Salmonella spp. in Food Samples. Front. Cell. Infect. Microbiol. 2021, 11, 631921. [Google Scholar] [CrossRef] [PubMed]
- Mei, X.; Zhai, X.; Lei, C.; Ye, X.; Kang, Z.; Wu, X.; Xiang, R.; Wang, Y.; Wang, H. Development and application of a visual loop-mediated isothermal amplification combined with lateral flow dipstick (LAMP-LFD) method for rapid detection of Salmonella strains in food samples. Food Control 2019, 104, 9–19. [Google Scholar] [CrossRef]
- Margot, H.; Stephan, R.; O’Mahony, E.; Iversen, C. Comparison of rapid cultural methods for the detection of Salmonella species. Int. J. Food Microbiol. 2013, 163, 47–50. [Google Scholar] [CrossRef] [PubMed]
- Hong, H.; Sun, C.; Wei, S.; Sun, X.; Mutukumira, A.; Wu, X. Development of a real-time recombinase polymerase amplification assay for rapid detection of Salmonella in powdered infant formula. Int. Dairy J. 2020, 102, 104579. [Google Scholar] [CrossRef]
- Vinayaka, A.C.; Ngo, T.A.; Kant, K.; Engelsmann, P.; Dave, V.P.; Shahbazi, M.A.; Wolff, A.; Bang, D.D. Rapid detection of Salmonella enterica in food samples by a novel approach with combination of sample concentration and direct PCR. Biosens. Bioelectron. 2019, 129, 224–230. [Google Scholar] [CrossRef]
- Muñoz, N.; Diaz-Osorio, M.; Moreno, J.; Sánchez-Jiménez, M.; Cardona-Castro, N. Development and evaluation of a multiplex real-time polymerase chain reaction procedure to clinically type prevalent Salmonella enterica serovars. J. Mol. Diagn. JMD 2010, 12, 220–225. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.; Zhou, X.; Shan, Y.; Yue, H.; Huang, R.; Hu, J.; Xing, D. Sensitive detection of a bacterial pathogen using allosteric probe-initiated catalysis and CRISPR-Cas13a amplification reaction. Nat. Commun. 2020, 11, 267. [Google Scholar] [CrossRef]
- An, B.; Zhang, H.; Su, X.; Guo, Y.; Wu, T.; Ge, Y.; Zhu, F.; Cui, L. Rapid and Sensitive Detection of Salmonella spp. Using CRISPR-Cas13a Combined With Recombinase Polymerase Amplification. Front. Microbiol. 2021, 12, 732426. [Google Scholar] [CrossRef]
- Lamas, A.; Santos, S.B.; Prado, M.; Garrido-Maestu, A. Phage amplification coupled with loop-mediated isothermal amplification (PA-LAMP) for same-day detection of viable Salmonella Enteritidis in raw poultry meat. Food Microbiol. 2023, 115, 104341. [Google Scholar] [CrossRef]
- da Silva, E.C.; de Oliveira, C.D.; Ribeiro, L.F.M.; Casas, M.R.T.; Pereira, J.G.; Possebon, F.S.; Junior, J.P.A. Salmonella detection with LAMP and qPCR and identification of serovars of interest by multiplex qPCR in poultry carcasses. Braz. J. Microbiol. [Publ. Braz. Soc. Microbiol.] 2023, 54, 2173–2182. [Google Scholar] [CrossRef]
- Zhu, L.; Liang, Z.; Xu, Y.; Chen, Z.; Wang, J.; Zhou, L. Ultrasensitive and Rapid Visual Detection of Escherichia coli O157:H7 Based on RAA-CRISPR/Cas12a System. Biosensors 2023, 13, 659. [Google Scholar] [CrossRef]
- Tian, Y.; Fan, Z.; Xu, L.; Cao, Y.; Chen, S.; Pan, Z.; Gao, Y.; Li, H.; Zheng, S.; Ma, Y.; et al. CRISPR/Cas13a-assisted rapid and portable HBV DNA detection for low-level viremia patients. Emerg. Microbes Infect. 2023, 12, e2177088. [Google Scholar] [CrossRef]
- Li, F.; Ye, Q.; Chen, M.; Zhou, B.; Zhang, J.; Pang, R.; Xue, L.; Wang, J.; Zeng, H.; Wu, S.; et al. An ultrasensitive CRISPR/Cas12a based electrochemical biosensor for Listeria monocytogenes detection. Biosens. Bioelectron. 2021, 179, 113073. [Google Scholar] [CrossRef]
- Zhang, X.; He, X.; Zhang, Y.; Chen, L.; Pan, Z.; Huang, Y.; Li, H. A new method for the detection of Mycobacterium tuberculosis based on the CRISPR/Cas system. BMC Infect. Dis. 2023, 23, 680. [Google Scholar] [CrossRef]
- Liu, W.; Yue, S.; Zheng, X.; Hu, M.; Cao, J.; Zheng, Y. aFARP-ChIP-seq, a convenient and reliable method for genome profiling in as few as 100 cells with a capability for multiplexing ChIP-seq. Epigenetics 2019, 14, 877–893. [Google Scholar] [CrossRef] [PubMed]
- Robertson, N.M.; Toscano, A.E.; LaMantia, V.E.; Hizir, M.S.; Rana, M.; Balcioglu, M.; Sheng, J.; Yigit, M.V. Unlocked Nucleic Acids for miRNA detection using two dimensional nano-graphene oxide. Biosens. Bioelectron. 2017, 89, 551–557. [Google Scholar] [CrossRef] [PubMed]
- Fahlen, T.F.; Mathur, N.; Jones, B.D. Identification and characterization of mutants with increased expression of hilA, the invasion gene transcriptional activator of Salmonella typhimurium. FEMS Immunol. Med. Microbiol. 2000, 28, 25–35. [Google Scholar] [CrossRef] [PubMed]
- Chu, J.; Shin, J.; Kang, S.; Shin, S.; Chung, Y.J. Rapid and sensitive detection of Salmonella species targeting the hilA gene using a loop-mediated isothermal amplification assay. Genom. Inform. 2023, 19, e30. [Google Scholar] [CrossRef] [PubMed]
- Bajaj, V.; Hwang, C.; Lee, C.A. hilA is a novel ompR/toxR family member that activates the expression of Salmonella typhimurium invasion genes. Mol. Microbiol. 1995, 18, 715–727. [Google Scholar] [CrossRef] [PubMed]
- Pathmanathan, S.G.; Cardona-Castro, N.; Sánchez-Jiménez, M.M.; Correa-Ochoa, M.M.; Puthucheary, S.D.; Thong, K.L. Simple and rapid detection of Salmonella strains by direct PCR amplification of the hilA gene. J. Med. Microbiol. 2003, 52, 773–776. [Google Scholar] [CrossRef] [PubMed]
- Koulenti, D.; Song, A.; Ellingboe, A.; Abdul-Aziz, M.H.; Harris, P.; Gavey, E.; Lipman, J. Infections by multidrug-resistant Gram-negative Bacteria: What’s new in our arsenal and what’s in the pipeline? Int. J. Antimicrob. Agents 2019, 53, 211–224. [Google Scholar] [CrossRef] [PubMed]
- Law, J.W.; Mutalib, N.S.A.; Chan, K.G.; Lee, L.H. Rapid methods for the detection of foodborne bacterial pathogens: Principles, applications, advantages and limitations. Front. Microbiol. 2014, 5, 770. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Sun, P.; Shao, W.; Yang, C.; Chen, L.; Zhu, A.; Pan, Z. Detection and Molecular Identification of Salmonella Pathogenic Islands and Virulence Plasmid Genes of Salmonella in Xuzhou Raw Meat Products. J. Food Prot. 2023, 85, 1790–1796. [Google Scholar] [CrossRef] [PubMed]
- Mohanapriya, K.; Agri, H.; Anbazhagan, S.; Khawaskar, D.; Jayakumar, V.; Lalrinzuala, M.V.; K, M.H.; I, S.; Mariappan, A.K.; Abhishek; et al. Development and validation of multiplex PCR based molecular serotyping of Salmonella serovars associated with poultry in India. J. Microbiol. Methods 2023, 207, 106710. [Google Scholar] [CrossRef]
- Heymans, R.; Vila, A.; van Heerwaarden, C.A.M.; Jansen, C.C.C.; Castelijn, G.A.A.; van der Voort, M.; Biesta-Peters, E.G. Rapid detection and differentiation of Salmonella species, Salmonella Typhimurium and Salmonella Enteritidis by multiplex quantitative PCR. PLoS ONE 2018, 13, e0206316. [Google Scholar] [CrossRef] [PubMed]
- Vichaibun, V.; Kanchanaphum, P. Quantitative LAMP and PCR Detection of Salmonella in Chicken Samples Collected from Local Markets around Pathum Thani Province, Thailand. Int. J. Food Sci. 2020, 2020, 8833173. [Google Scholar] [CrossRef]
- Mao, X.; Zhao, Y.; Jiang, J.; Du, Q.; Tu, B.; Li, J.; Wang, F. Sensitive and high-accuracy detection of Salmonella based on CRISPR/Cas12a combined with recombinase polymerase amplification. Lett. Appl. Microbiol. 2023, 75, 899–907. [Google Scholar] [CrossRef] [PubMed]
- Cai, Q.; Shi, H.; Sun, M.; Ma, N.; Wang, R.; Yang, W.; Qiao, Z. Sensitive Detection of Salmonella Based on CRISPR-Cas12a and the Tetrahedral DNA Nanostructure-Mediated Hyperbranched Hybridization Chain Reaction. J. Agric. Food Chem. 2023, 70, 16382–16389. [Google Scholar] [CrossRef] [PubMed]
- Bohez, L.; Dewulf, J.; Ducatelle, R.; Pasmans, F.; Haesebrouck, F.; Van Immerseel, F. The effect of oral administration of a homologous hilA mutant strain on the long-term colonization and transmission of Salmonella Enteritidis in broiler chickens. Vaccine 2008, 26, 372–378. [Google Scholar] [CrossRef] [PubMed]
- Xia, X.; Ma, B.; Zhang, T.; Lu, Y.; Khan, M.R.; Hu, Y.; Lei, C.; Deng, S.; He, Q.; He, G.; et al. G-Quadruplex-Probing CRISPR-Cas12 Assay for Label-Free Analysis of Foodborne Pathogens and Their Colonization In Vivo. ACS Sens. 2023, 6, 3295–3302. [Google Scholar] [CrossRef] [PubMed]
- Crăciunaş, C.; Keul, A.L.; Flonta, M.; Cristea, M. DNA-based diagnostic tests for Salmonella strains targeting hilA, agfA, spvC and sef genes. J. Environ. Manag. 2012, 95, S15–S18. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Zhu, S.; Zhang, X.; Ren, Y.; He, J.; Zhou, J.; Yin, L.; Wang, G.; Zhong, T.; Wang, L.; et al. Advances in the application of recombinase-aided amplification combined with CRISPR-Cas technology in quick detection of pathogenic microbes. Front. Bioeng. Biotechnol. 2023, 11, 1215466. [Google Scholar] [CrossRef] [PubMed]
- Procura, F.; Bueno, D.J.; Bruno, S.B.; Rogé, A.D. Prevalence, antimicrobial resistance profile and comparison of methods for the isolation of salmonella in chicken liver from Argentina. Food Res. Int. 2019, 119, 541–546. [Google Scholar] [CrossRef] [PubMed]
- John, J.; Bavdekar, A.; Rongsen-Chandola, T.; Dutta, S.; Gupta, M.; Kanungo, S.; Sinha, B.; Srinivasan, M.; Shrivastava, A.; Bansal, A.; et al. Burden of Typhoid and Paratyphoid Fever in India. N. Engl. J. Med. 2023, 388, 1491–1500. [Google Scholar] [CrossRef] [PubMed]
- Tessaro, L.; Aquino, A.; de Almeida Rodrigues, P.; Joshi, N.; Ferrari, R.G.; Conte-Junior, C.A. Nucleic Acid-Based Nanobiosensor (NAB) Used for Salmonella Detection in Foods: A Systematic Review. Nanomaterials 2023, 12, 821. [Google Scholar] [CrossRef] [PubMed]
- Gao, D.; Yu, J.; Dai, X.; Tian, Y.; Sun, J.; Xu, X.; Cai, X. Development and evaluation of an indirect enzyme-linked immunosorbent assay based on a recombinant SifA protein to detect Salmonella infection in poultry. Poult. Sci. 2023, 102, 102513. [Google Scholar] [CrossRef] [PubMed]
- Santos, P.D.M.; Widmer, K.W.; Rivera, W.L. PCR-based detection and serovar identification of Salmonella in retail meat collected from wet markets in Metro Manila, Philippines. PLoS ONE 2020, 15, e0239457. [Google Scholar] [CrossRef] [PubMed]
- Goto, Y.; Fukunari, K.; Tada, S.; Ichimura, S.; Chiba, Y.; Suzuki, T. A multiplex real-time RT-PCR system to simultaneously diagnose 16 pathogens associated with swine respiratory disease. J. Appl. Microbiol. 2023, 134, lxad263. [Google Scholar] [CrossRef]
- Ou, H.; Wang, Y.; Gao, J.; Bai, J.; Zhang, Q.; Shi, L.; Wang, X.; Wang, C. Rapid detection of Salmonella based on loop-mediated isothermal amplification. Ann. Palliat. Med. 2023, 10, 6850–6858. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.; Wang, J.; Li, Y.; Liao, D.; Zhang, W.; Han, X.; Man, S. A ratiometric fluorescent biosensing platform for ultrasensitive detection of Salmonella typhimurium via CRISPR/Cas12a and silver nanoclusters. J. Hazard. Mater. 2023, 443, 130234. [Google Scholar] [CrossRef] [PubMed]
- Arshad, F.; Abdillah, A.N.; Shivanand, P.; Ahmed, M.U. CeO2 nanozyme mediated RPA/CRISPR-Cas12a dual-mode biosensor for detection of invA gene in Salmonella. Biosens. Bioelectron. 2024, 247, 115940. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Li, X.; Li, L.; Cao, L.; Zhao, Z.; Huang, T.; Li, J.; Zhang, X.; Cao, S.; Zhang, N.; et al. Corrigendum to “Establishment of an ultrasensitive and visual detection platform for Neospora caninum based-on the RPA-CRISPR/Cas12a system” [Talanta vol. (2024) 269/125413]. Talanta 2024, 271, 125722. [Google Scholar]
- Hadi, J.; Rapp, D.; Dhawan, S.; Gupta, S.K.; Gupta, T.B.; Brightwell, G. Molecular detection and characterization of foodborne bacteria: Recent progresses and remaining challenges. Compr. Rev. Food Sci. Food Saf. 2023, 22, 2433–2464. [Google Scholar] [CrossRef] [PubMed]
- Hyeon, S.H.; Lim, W.K.; Shin, H.J. Novel surface plasmon resonance biosensor that uses full-length Det7 phage tail protein for rapid and selective detection of Salmonella enterica serovar Typhimurium. Biotechnol. Appl. Biochem. 2021, 68, 5–12. [Google Scholar] [CrossRef] [PubMed]
- Gu, K.; Song, Z.; Zhou, C.; Ma, P.; Li, C.; Lu, Q.; Liao, Z.; Huang, Z.; Tang, Y.; Li, H.; et al. Development of nanobody-horseradish peroxidase-based sandwich ELISA to detect Salmonella Enteritidis in milk and in vivo colonization in chicken. J. Nanobiotechnology 2022, 20, 167. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.; Zhang, Y.; Huang, C.; Wang, J.; Li, H.; Wang, X. An electrochemical biosensor based on phage-encoded protein RBP 41 for rapid and sensitive detection of Salmonella. Talanta 2024, 270, 125561. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.; Ge, Y.; Xie, J.; Li, Y.; Zhang, H.; Du, S. A gas-driven capillary based on the synergy of the catalytic and photothermal effect of PB@Au for Salmonella typhimurium detection. Talanta 2024, 269, 125455. [Google Scholar] [CrossRef] [PubMed]
Name | Sequences (5′–3′) |
---|---|
RAA-F1 | AGGATATTCTTGAGCTCATGGATCAATTACG |
RAA-R1 | CAATTTTGTTTTGCAAGAGAGAAGCGGGTT |
RAA-F2 | AGCTCATGGATCAATTACGCCCCGATTATT |
RAA-R2 | CAAAAGATTCGCAATTTTGTTTTGCAAGAG |
RAA-F3 | ATTATTATATCTCCGGGCAGATGATACCCGAT |
RAA-R3 | TTTGTGTCCCAGCGAAGTCCGGGAATACAT |
RAA-F4 | ATTATTATATCTCCGGGCAGATGATACCCGAT |
RAA-R4 | CAAAAGATTCGCAATTTTGTTTTGCAAGAG |
RAA-F5 | GCAGATGATACCCGATGGTAATGATAATATTGT |
RAA-R5 | CGGGAATACATCTGAGCAAAAGATTCGCAA |
RAA-F6 | CCGGGCAGATGATACCCGATGGTAATGATA |
RAA-R6 | TTTGTGTCCCAGCGAAGTCCGGGAATACAT |
RAA-F7 | ATGGATCAATTACGCCCCGATTATTATATCTCC |
RAA-R7 | CGGGAATACATCTGAGCAAAAGATTCGCAA |
RAA-F8 | AGGATATTCTTGAGCTCATGGATCAATTACG |
RAA-R8 | TTTGTGTCCCAGCGAAGTCCGGGAATACAT |
RAA-F9 | AGCTCATGGATCAATTACGCCCCGATTATT |
RAA-R9 | GAAGTCCGGGAATACATCTGAGCAAAAGAT |
PCR-F | GTGACCATTACGAAGAACTG |
PCR-R | TGTTTGGCGACATGTTAAC |
Probe-1 | FAM-GTTAAAGGTTATCACC-BHQ1 |
Probe-2 | FAM-GAAAGCATTAAGTTGA-BHQ1 |
Probe-2.1 | FAM-GAAAGCATTAAGTTGA-Bio |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, C.; Zhao, Y.; Guo, B.; Yang, M.; Xu, Q.; Lei, C.; Wang, H. Establishment of a Simple, Sensitive, and Specific Salmonella Detection Method Based on Recombinase-Aided Amplification Combined with dsDNA-Specific Nucleases. Foods 2024, 13, 1380. https://doi.org/10.3390/foods13091380
Zhou C, Zhao Y, Guo B, Yang M, Xu Q, Lei C, Wang H. Establishment of a Simple, Sensitive, and Specific Salmonella Detection Method Based on Recombinase-Aided Amplification Combined with dsDNA-Specific Nucleases. Foods. 2024; 13(9):1380. https://doi.org/10.3390/foods13091380
Chicago/Turabian StyleZhou, Changyu, Yu Zhao, Boyan Guo, Ming Yang, Qiang Xu, Changwei Lei, and Hongning Wang. 2024. "Establishment of a Simple, Sensitive, and Specific Salmonella Detection Method Based on Recombinase-Aided Amplification Combined with dsDNA-Specific Nucleases" Foods 13, no. 9: 1380. https://doi.org/10.3390/foods13091380