Preharvest UV-B Treatment Improves Strawberry Quality and Extends Shelf Life
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant and Fruit Materials
2.2. UV-B Treatments
2.3. Analysis of Color, Texture, Water Loss and Decacy Incidence
2.4. Determination of Quality Attributes
2.5. RNA Extraction and RT-qPCR
2.6. Statistical Analysis
3. Results
3.1. Effect on Fruit Appearance
3.2. Effect on Fruit Quality Traits
3.3. Expression of UV-B Responsive Genes in Fruits during Growth Stage in Response to UV-B Treatment
4. Discussion
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Peng, H.; Pang, Y.; Liao, Q.; Wang, F.; Qian, C. The Effect of Preharvest UV Light Irradiation on Berries Quality: A Review. Horticulturae 2022, 8, 1171. [Google Scholar] [CrossRef]
- Loconsole, D.; Santamaria, P. UV Lighting in Horticulture: A Sustainable Tool for Improving Production Quality and Food Safety. Horticulturae 2021, 7, 9. [Google Scholar] [CrossRef]
- Yao, Y.; Danna, C.H.; Zemp, F.J.; Titov, V.; Ciftci, O.N.; Przybylski, R.; Ausubel, F.M.; Kovalchuk, I. UV-C–irradiated Arabidopsis and tobacco emit volatiles that trigger genomic instability in neighboring plants. Plant Cell 2011, 23, 3842–3852. [Google Scholar] [CrossRef] [PubMed]
- Paul, N.D.; Gwynn-Jones, D. Ecological roles of solar UV radiation: Towards an integrated approach. Trends Ecol. Evol. 2003, 18, 48–55. [Google Scholar] [CrossRef]
- Tilbrook, K.; Arongaus, A.B.; Binkert, M.; Heijde, M.; Yin, R.; Ulm, R. The UVR8 UV-B Photoreceptor: Perception, Signaling and Response. Arab. Book 2013, 11, e0164. [Google Scholar] [CrossRef]
- Urban, L.; Charles, F.; de Miranda, M.R.A.; Aarrouf, J. Understanding the physiological effects of UV-C light and exploiting its agronomic potential before and after harvest. Plant Physiol. Biochem. 2016, 105, 1–11. [Google Scholar] [CrossRef]
- Ruiz, V.E.; Cerioni, L.; Zampini, I.C.; Cuello, S.; Isla, M.I.; Hilal, M.; Rapisarda, V.A. UV-B radiation on lemons enhances antifungal activity of flavedo extracts against Penicillium digitatum. Lwt-Food Sci. Technol. 2017, 85, 96–103. [Google Scholar] [CrossRef]
- Darre, M.; Valerga, L.; Araque, L.C.O.; Lemoine, M.L.; Demkura, P.V.; Vicente, A.R.; Concellon, A. Role of UV-B irradiation dose and intensity on color retention and antioxidant elicitation in broccoli florets (Brassica oleracea var. Italica). Postharvest Biol. Technol. 2017, 128, 76–82. [Google Scholar] [CrossRef]
- Li, X.D.; Wu, B.H.; Wang, L.J.; Zheng, X.B.; Yan, S.T.; Li, S.H. Changes in trans-resveratrol and other phenolic compounds in grape skin and seeds under low temperature storage after post-harvest UV-irradiation. J. Hortic. Sci. Biotech. 2009, 84, 113–118. [Google Scholar] [CrossRef]
- Nguyen, C.T.T.; Lim, S.; Lee, J.G.; Lee, E.J. VcBBX, VcMYB21, and VcR2R3MYB transcription factors are involved in UV B-induced anthocyanin biosynthesis in the peel of harvested blueberry fruit. J. Agric. Food Chem. 2017, 65, 2066–2073. [Google Scholar] [CrossRef]
- Liu, C.H.; Han, X.X.; Cai, L.Y.; Lu, X.Y.; Ying, T.J.; Jiang, Z.H. Postharvest UV-B irradiation maintains sensory qualities and enhances antioxidant capacity in tomato fruit during storage. Postharvest Biol. Technol. 2011, 59, 232–237. [Google Scholar] [CrossRef]
- Josuttis, M.; Dietrich, H.; Treutter, D.; Will, F.; Linnemannstons, L.; Kruger, E. Solar UVB response of bioactives in strawberry (Fragaria x ananassa Duch. L.): A comparison of protected and open-field cultivation. J. Agric. Food Chem. 2010, 58, 12692–12702. [Google Scholar] [CrossRef] [PubMed]
- Marais, E.; Jacobs, G.; Holcroft, D.M. Postharvest irradiation enhances anthocyanin synthesis in apples but not in pears. Hortscience 2001, 36, 738–740. [Google Scholar] [CrossRef]
- Zhang, D.; Yu, B.; Bai, J.H.; Qian, M.J.; Shu, Q.; Su, J.; Teng, Y.W. Effects of high temperatures on UV-B/visible irradiation induced postharvest anthocyanin accumulation in ‘Yunhongli No. 1’ (Pyrus pyrifolia Nakai) pears. Sci. Hortic. 2012, 134, 53–59. [Google Scholar] [CrossRef]
- Wang, C.Y.; Chen, C.T.; Wang, S.Y. Changes of flavonoid content and antioxidant capacity in blueberries after illumination with UV-C. Food Chem. 2009, 117, 426–431. [Google Scholar] [CrossRef]
- Ubi, B.E.; Honda, C.; Bessho, H.; Kondo, S.; Wada, M.; Kobayashi, S.; Moriguchi, T. Expression analysis of anthocyanin biosynthetic genes in apple skin: Effect of UV-B and temperature. Plant Sci. 2006, 170, 571–578. [Google Scholar] [CrossRef]
- Zhou, X.; Wang, G.; Zhang, W. UV-B responsive microRNA genes in Arabidopsis thaliana. Mol. Syst. Biol. 2007, 3, 103. [Google Scholar] [CrossRef]
- Guo, J.; Han, W.; Wang, M.H. Ultraviolet and environmental stresses involved in the induction and regulation of anthocyanin biosynthesis: A review. Afr. J. Biotechnol. 2008, 7, 4966–4972. [Google Scholar]
- Catola, S.; Castagna, A.; Santin, M.; Calvenzani, V.; Petroni, K.; Mazzucato, A.; Ranieri, A. The dominant allele Aft induces a shift from flavonol to anthocyanin production in response to UV-B radiation in tomato fruit. Planta 2017, 246, 263–275. [Google Scholar] [CrossRef]
- Erkan, M.; Wang, S.Y.; Wang, C.Y. Effect of UV treatment on antioxidant capacity, antioxidant enzyme activity and decay in strawberry fruit. Postharvest Biol. Technol. 2008, 48, 163–171. [Google Scholar] [CrossRef]
- Ross, J.A.; Kasum, C.M. Dietary flavonoids: Bioavailability, metabolic effects, and safety. Annu. Rev. Nutr. 2002, 22, 19–34. [Google Scholar] [CrossRef] [PubMed]
- Samtani, J.B.; Rom, C.R.; Friedrich, H.; Fennimore, S.A.; Finn, C.E.; Petran, A.; Wallace, R.W.; Pritts, M.P.; Fernandez, G.; Chase, C.A.; et al. The Status and Future of the Strawberry Industry in the United States. Horttechnology 2019, 29, 11–24. [Google Scholar] [CrossRef]
- Dong, W.; Lu, Y.; Yang, T.; Trouth, F.; Lewers, K.S.; Daughtry, C.S.; Cheng, Z.M. Effect of genotype and plastic film type on strawberry fruit quality and post-harvest shelf life. Int. J. Fruit Sci. 2020, 20, 750–767. [Google Scholar] [CrossRef]
- Lester, G.E.; Lewers, K.S.; Medina, M.B.; Saftner, R.A. Comparative analysis of strawberry total phenolics via Fast Blue BB vs. Folin-Ciocalteu: Assay interference by ascorbic acid. J. Food Compos. Anal. 2012, 27, 102–107. [Google Scholar] [CrossRef]
- Sanchez-Moreno, C.; Cao, G.H.; Ou, B.X.; Prior, R.L. Anthocyanin and proanthocyanidin content in selected white and red wines. Oxygen radical absorbance capacity comparison with nontraditional wines obtained from highbush blueberry. J. Agric. Food Chem. 2003, 51, 4889–4896. [Google Scholar] [CrossRef]
- Xu, W.; Peng, H.; Yang, T.; Whitaker, B.; Huang, L.; Sun, J.; Chen, P. Effect of calcium on strawberry fruit flavonoid pathway gene expression and anthocyanin accumulation. Plant Physiol. Biochem. 2014, 82, 289–298. [Google Scholar] [CrossRef]
- Liu, L.L.; Gregan, S.; Winefield, C.; Jordan, B. From UVR8 to flavonol synthase: UV-B-induced gene expression in Sauvignon blanc grape berry. Plant Cell Environ. 2015, 38, 905–919. [Google Scholar] [CrossRef]
- An, J.P.; Qu, F.J.; Yao, J.F.; Wang, X.N.; You, C.X.; Wang, X.F.; Hao, Y.J. The bZIP transcription factor MdHY5 regulates anthocyanin accumulation and nitrate assimilation in apple. Hortic. Res. 2017, 4, 17056. [Google Scholar] [CrossRef]
- Carbonell-Bejerano, P.; Diago, M.P.; Martinez-Abaigar, J.; Martinez-Zapater, J.M.; Tardaguila, J.; Nunez-Olivera, E. Solar ultraviolet radiation is necessary to enhance grapevine fruit ripening transcriptional and phenolic responses. BMC Plant Biol. 2014, 14, 183. [Google Scholar] [CrossRef]
- Loyola, R.; Herrera, D.; Mas, A.; Wong, D.C.J.; Holl, J.; Cavallini, E.; Amato, A.; Azuma, A.; Ziegler, T.; Aquea, F.; et al. The photomorphogenic factors UV-B RECEPTOR 1, ELONGATED HYPOCOTYL 5, and HY5 HOMOLOGUE are part of the UV-B signalling pathway in grapevine and mediate flavonol accumulation in response to the environment. J. Exp. Bot. 2016, 67, 5429–5445. [Google Scholar] [CrossRef]
- Li, T.S.; Yamane, H.; Tao, R. Preharvest long-term exposure to UV-B radiation promotes fruit ripening and modifies stage-specific anthocyanin metabolism in highbush blueberry. Hortic. Res. 2021, 8, 67. [Google Scholar] [CrossRef] [PubMed]
- Tossi, V.; Lamattina, L.; Cassia, R. An increase in the concentration of abscisic acid is critical for nitric oxide-mediated plant adaptive responses to UV-B irradiation. New Phytol. 2009, 181, 871–879. [Google Scholar] [CrossRef] [PubMed]
- Kadomura-Ishikawa, Y.; Miyawaki, K.; Takahashi, A.; Masuda, T.; Noji, S. Light and abscisic acid independently regulated FaMYB10 in Fragaria x ananassa fruit. Planta 2015, 241, 953–965. [Google Scholar] [CrossRef]
- Li, D.D.; Luo, Z.S.; Mou, W.S.; Wang, Y.S.; Ying, T.J.; Mao, L.C. ABA and UV-C effects on quality, antioxidant capacity and anthocyanin contents of strawberry fruit (Fragaria ananassa Duch.). Postharvest Biol. Technol. 2014, 90, 56–62. [Google Scholar] [CrossRef]
- Wang, X.; Fu, X.; Chen, M.; Huan, L.; Liu, W.; Qi, Y.; Gao, Y.; Xiao, W.; Chen, X.; Li, L.; et al. Ultraviolet B irradiation influences the fruit quality and sucrose metabolism of peach (Prunus persica L.). Environ. Exp. Bot. 2018, 153, 286–301. [Google Scholar] [CrossRef]
- Liu, L.; Gregan, S.M.; Winefield, C.; Jordan, B. Comparisons of controlled environment and vineyard experiments in Sauvignon blanc grapes reveal similar UV-B signal transduction pathways for flavonol biosynthesis. Plant Sci. 2018, 276, 44–53. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Gene ID | Forward Sequence (5′-3′) | Reverse Sequence (3′-5′) |
---|---|---|---|
FaACTIN | JN616288 | TCACCACCACTGCTGAACGGGA | TGCAAGCTTCTCCTTCATGTCACGG |
FaHY5 | KP984791 | TGTTGCAAGACCAAGCCACGAGC | AGACCTCTCACTGCTGGAAGGCA |
FaUVR8 | KU647690 | AGGGAAGATTTGGGTGTCACCGTCA | GCCGTATGCGTTTCCCGTCGGTTT |
FaMYB10 | EU155162.1 | GACGGCTTCATACGCAAAGA | TCTGTGGTGGTTCTGTTGGT |
FaPAL1 | KX450226 | GCCAAGGAGGAGGACTACTACATGACC | TCCGCCGCCAAGTTCCAGTTCA |
FaCHS1 | AY997297 | ACGGCCCAAACTATCCTTCCCGA | GCCCAACTTCACGAAGATGCCCGT |
FaF3H1 | AY691919 | CGGTGCAGGATTGGCGCGAGA | CTGCTGTGGTTTGAGTTCACCAC |
FaDFR1 | KC894047 | GCCGGAAAGTAAAGATGACTGG | GCTTCATTTCCAGTGAGTGGTG |
FaANS | AY695817 | TCGAGAGTTTGGCCAGCAGCGGGAT | TGAGGCCCTTCGGTGCTCTTCTCGT |
FaUGT1 | LC312710 | GGAATCATCTTCGGAAACTTGG | TGCACTTGCTGGTGGTTCTAGT |
FaFLS | DQ087252 | CCCGGCGGAGTACATTAGGTCGGA | ACGGTGGTGATTCCCGGCTGCT |
FaLAR | DQ087253.1 | GCAATATCACGGCTACTTGTGC | GAAAATGCAGCTTCCTTGCTTT |
FaANR | DQ664192.1 | CCGATGAAAATGATTGGTCTGA | GTCTGGAGTGAGAGAAGCACCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, X.; Trouth, F.; Yang, T. Preharvest UV-B Treatment Improves Strawberry Quality and Extends Shelf Life. Horticulturae 2023, 9, 211. https://doi.org/10.3390/horticulturae9020211
Zhu X, Trouth F, Yang T. Preharvest UV-B Treatment Improves Strawberry Quality and Extends Shelf Life. Horticulturae. 2023; 9(2):211. https://doi.org/10.3390/horticulturae9020211
Chicago/Turabian StyleZhu, Xudong, Frances Trouth, and Tianbao Yang. 2023. "Preharvest UV-B Treatment Improves Strawberry Quality and Extends Shelf Life" Horticulturae 9, no. 2: 211. https://doi.org/10.3390/horticulturae9020211