Next Article in Journal
Impact of Silver Nanoparticles on Arbuscular Mycorrhizal Fungi and Glomalin-Related Soil Proteins in the Rhizosphere of Maize Seedlings
Previous Article in Journal
Age Readings and Assessment in Coastal Batoid Elasmobranchs from Small-Scale Size-Selective Fishery: The Importance of Data Comparability in Multi-Specific Assemblages
Previous Article in Special Issue
Redescription and First Nucleotide Sequences of Opecoeloides pedicathedrae (Digenea: Opecoelidae), a Parasite of Cynoscion leiarchus (Cuvier, 1830) (Eupercaria: Sciaenidae) from Brazil
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Diversity
Volume 16
Issue 5
10.3390/d16050272
diversity-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Low Genetic and Parasite Diversity of Invasive Pumpkinseed Lepomis gibbosus (Centrarchidae) Expanding in Türkiye

by
Yuriy Kvach
1,2,
Maria Yu. Tkachenko
1,
Daniela Giannetto
3,
Robert Míč
4,
Veronika Bartáková
1,
Sevan Ağdamar
5,
Gülşah Saç
6,
Müfit Özuluğ
6,
Ali Serhan Tarkan
7,8 and
Markéta Ondračková
1,*
1
Institute of Vertebrate Biology of the Czech Academy of Sciences, Květná 8, 603 00 Brno, Czech Republic
2
Institute of Marine Biology, National Academy of Sciences of Ukraine, 37 Pushkinska St., 65048 Odesa, Ukraine
3
Department of Biology, Faculty of Science, Muğla Sıtkı Koçman University, Muğla 48000, Türkiye
4
Department of Botany and Zoology, Faculty of Science, Masaryk University, Kotlářská 2, 611 37 Brno, Czech Republic
5
Department of Forestry, Bayramiç Vocational School, Çanakkale Onsekiz Mart University, Bayramiç, Çanakkale 17700, Türkiye
6
Department of Biology, Faculty of Science, Istanbul University, Istanbul 34134, Türkiye
7
Department of Ecology and Vertebrate Zoology, Faculty of Biology and Environmental Protection, University of Łodz, 90-237 Łodz, Poland
8
Department of Basic Sciences, Faculty of Fisheries, Muğla Sıtkı Koçman University, Muğla 48000, Türkiye
*
Author to whom correspondence should be addressed.
Diversity 2024, 16(5), 272; https://doi.org/10.3390/d16050272
Submission received: 8 April 2024 / Revised: 28 April 2024 / Accepted: 29 April 2024 / Published: 1 May 2024
(This article belongs to the Special Issue Diversity, Taxonomy and Systematics of Fish Parasites)
Browse Figures
Versions Notes

Abstract

:
Multiple factors can facilitate invasion success, with the absence of natural enemies, such as predators and parasites, recognised as conferring a significant advantage on invasive over native species. Pumpkinseed Lepomis gibbosus (Centrarchidae) represents one of the most successful freshwater fish invaders in Europe. Previous research has highlighted genetic differences between pumpkinseed populations in Türkiye and those in other European regions, attributed to rapid adaptation to new environmental conditions. This study aimed to investigate whether these highly adapted pumpkinseed populations in Türkiye benefit from a potential release from parasites, as proposed by the enemy-release hypothesis. Genetic characterisation of pumpkinseed populations from both European and Asian parts of Türkiye revealed that they share the same cytochrome c oxidase I haplotype as European populations. Microsatellite analysis indicated low genetic diversity, with STRUCTURE analysis confirming the clustering of all Turkish populations, suggesting a common source. Consistent with the low genetic diversity indicative of a small founding population, we observed a limited number of co-introduced parasite species, including the myxozoan Myxobolus dechtiari, the monogenean Onchocleidus dispar, and the digenean Posthodiplostomum centrarchi. Parasite infection by local parasites acquired in Türkiye was rare. Parasite diversity, species richness, and equitability were low, with only nine parasite taxa identified in all four pumpkinseed populations. The most diverse parasite community was found in Değirmenköy Reservoir, located in the European part of Türkiye, where seven parasite taxa were identified. While our study did not uncover genetically distinct pumpkinseed populations in Türkiye, the fish demonstrated resilience against most local parasite species, potentially providing them with an advantage over native species, aligning with the enemy-release hypothesis.

1. Introduction

Fish play a crucial role in the economies of many countries, yet risk management measures, such as quarantine controls, are often less stringent than for other animals [1]. The incidence of freshwater fish introductions has surged in recent decades due to the expansion of global trade, and this trend is expected to persist in the coming years [2,3]. The unintentional release or escape of introduced fish into natural habitats, resulting in invasive populations that disrupt native ecosystems, serves as a prime example of the socio-economic, ecological, and evolutionary impacts of globalisation on local biodiversity [4,5,6,7]. The adverse effects of non-native species on indigenous fauna encompass predation, competition for food and space, hybridisation, alteration of food webs and biogeochemical cycles, as well as the transmission of parasites and pathogens [4,8]. In particular, non-native fish parasites are a global problem affecting aquaculture and natural ecosystems worldwide [9,10].
Pumpkinseed (Lepomis gibbosus (L., 1758), Actinopterygii: Centrarchidae) is a species indigenous to freshwater habitats in eastern North America, ranging from New Brunswick, Canada, to north-eastern Georgia, USA [11]. Initially introduced to Europe as an ornamental fish in 1877, transported from Canada to Paris [12], the species was subsequently released into open waters, primarily in southwestern France, where stable populations were established around 1900 [13,14]. Over the following century, the pumpkinseed was introduced to nearly all European countries and has recently become an invasive species across much of the continent, spanning from the Iberian Peninsula in the west to coastal rivers of the Sea of Azov in the east [15,16]. In Türkiye, the fish was first documented in the Ipsala Canal (Meriç River drainage) in 1982 [17]. In the Asian part of Türkiye, it was initially observed in the Sarıçay and Dipsiz-Çine streams (Muğla, Anatolia) between 1999 and 2001 [18,19,20], subsequently spreading throughout the Aegean Region of Anatolia [21,22,23,24,25,26]. More recently, the fish has expanded into numerous new habitats in the Marmara and Aegean regions, encompassing both the European and Asian parts of Türkiye [27,28]. Currently, Anatolia represents the sole Asian region where the invasive pumpkinseed is established. However, other Asian countries, such as China, Iran, Japan, and South Korea, have experienced introductions of another invasive centrarchid fish, the bluegill (Lepomis macrochirus Rafinesque, 1819), in the past [29,30,31,32].
Molecular genetic studies of invasive species offer valuable insights into their characteristics, evolutionary processes, and genetic adaptations that contribute to their successful establishment in new environments [33]. Such analyses also aid in elucidating the origin and invasion history of these species [34]. European populations of pumpkinseed have been extensively investigated using both mitochondrial [21,35,36,37] and nuclear [38] gene markers, revealing generally low genetic variability. In contrast to other European populations, where all pumpkinseed populations are associated with a single haplotype of cytochrome c oxidase I (cox1) mitochondrial DNA [35,36], higher cox1 diversity has been observed in Türkiye [21,39]. The three cox1 haplotypes identified in Türkiye differ from, yet are derived from, the common haplotype found in other European and North American pumpkinseed populations, suggesting the species’ evolutionary adaptability under the influence of different selection pressures, such as environmental factors [21].
In addition to abiotic environmental factors like temperature or salinity, non-native species face pressure from biotic factors such as parasitism. The role of parasites in the success of invasive species has gained widespread recognition, with parasites significantly influencing interactions between non-native and native species [40]. Non-native species may introduce new parasite species into the invaded ecosystems, which could be specific to their original hosts, as well as the agents of diseases for the local fauna [41]. Release from pressure by natural parasites advantaging non-native species over natives is among the most commonly proposed hypotheses regarding the role of parasites in biological invasions [42]. There has been an increased interest in the investigation of pumpkinseed parasites in various non-native European populations in Europe during the recent decades, revealing considerable variation in parasite abundance and diversity across different geographical regions, time since introduction, and host genetic diversity [36,38,43,44]. Studies on parasite communities have identified a range of North American parasite species co-introduced to Europe with pumpkinseed, including myxozoans [45], centrarchid-specific monogeneans [38,46,47,48], cestodes [49], and trematodes [50,51]. However, these studies have predominantly focused on pumpkinseed populations of the common cox1 haplotype.
Therefore, the main objective of this study was to investigate parasite communities of pumpkinseed in Türkiye, where different haplotypes and high environmental tolerances of this fish species have recently been observed [21]. We expected that genetically reduced pumpkinseed populations derived from the common haplotype found in other European populations indicating the rapid evolutionary adaptability to new environmental conditions [21] would exhibit low parasite diversity and abundance, especially regarding co-introduced parasite species [38,52]. Reduced genetic diversity related to small founder populations may be associated with a decreased probability of parasite transmission to new areas due to their absence in the founding population or presence at such low densities that the parasite population cannot be sustained [52]. To confirm the genetic variability of fish collected in Türkiye, we conducted a molecular analysis using both mitochondrial (cox1) and nuclear (microsatellites) markers, comparing the obtained results with those of fish collected in various European localities as published by Ondračková et al. [36,38]. This study also presents the first data on parasite communities in pumpkinseed that were introduced to Asia.

2. Materials and Methods

2.1. Fish Sampling

The fish were sampled from four locations in Türkiye in October 2021 (Figure 1). Two of these locations were situated in the Aegean region of Anatolia. These locations were Sarıçay River (37.316111, 27.706667) and Dipsiz-Çine Stream (37.763889, 27.833611). One location was in north-western Anatolia—Davuldere Reservoir (40.907186, 30.039250), and one was in the European part of the City of Istanbul—Değirmenköy Reservoir (41.166692, 28.017958). According to Ağdamar et al. [21], fish from Davuldere Reservoir corresponded to cox1 haplotype H_2 and those from Sarıçay River to H_3, while fish from Dipsiz-Çine Stream and Değirmenköy Reservoir had not been genotyped previously.
Electrofishing using backpack electrofishing gear (SAMUS 725G and SAMUS 1000) was the preferred method for fish sampling for parasitological investigation [53]. The fish were transported alive in aerated river water to the laboratory, where they were placed into aerated tanks with water from the sampling sites. All fish were dissected within three days of sampling to ensure maximum parasite recovery (see [54]). Before dissection, the standard length (SL, mm), total length (TL, mm), total weight (W, g), and eviscerated weight (Wb, g) were measured for each fish (Table 1), and a sample of the caudal fin was preserved in 96% ethanol for further molecular analysis.

2.2. Genetic Analysis of Fish

The DNA of the fish was extracted using the commercial GeneJETTM Genomic DNA Purification Kit (Thermo Scientific, Waltham, MA USA) following the enclosed instructions. For 31 fish, the partial mitochondrial cox1 gene was amplified using the primers Fish-F1 (5′TCAACCAACCACAAAGACATTGGCAC3′) and Fish-R1 (5′TAGACTTCTGGGTGGCCAAAGAATCA3′) [55] with the PCR Multiplex Kit (Qiagen, Hilden, Germany) under standard protocol and an annealing temperature of 58 °C. The PCR products were commercially sequenced at Eurofins Genomics Germany GmbH and analysed using Geneious v.9.0.5. software (http://www.geneious.com). Samples from 81 fish individuals from the four localities were genotyped for five polymorphic microsatellite loci (Lmar9, Lmar18, Lmar29, RB7, and RB20) with the PCR details described by Ondračková et al. [38]. The PCR products were electrophoresed on the ABI Prism®3130 Genetic Analyser (Applied Biosystems, Foster City, CA, USA) and analysed using Geneious.
Genetic divergence among populations was estimated by pairwise FST [56] using 1000 permutations in GENETIX 4.05 [57]. The Hardy–Weinberg equilibrium (HWE) test was performed for each locus in all populations using the Markov chain method (“Exact probability test”) in Genepop v.4.7 [58]. The number of different alleles (NA), the Shannon information index (I), expected heterozygosity (He), unbiased expected heterozygosity (UHe), observed heterozygosity (Ho), fixation index (F), and percentage of polymorphic loci (P) were all calculated in GenAlEx v. 6.51 [59,60]. Newly generated sequences of one specimen per locality were deposited in the GenBank database under accession numbers PP469740-PP469743.
The population genetic structure was analysed using the Bayesian clustering algorithm implemented in the program STRUCTURE v. 2.3.4 [61]. The program was run with 10 independent simulations for each K from 1 to 10, with 1 million iterations for each simulation (burn-in  =  100,000 iterations) using an admixture model and a correlated allele frequencies model (λ  =  1). The output of the STRUCTURE analysis was post-processed using CLUMPAK software v. 1.1 [62] to identify separate groups of runs based on similarity between Q-matrices for each K using the LargeKGreedy algorithm, random input order, and 2000 repeats. Different modes were identified for similarity scores from the 20 runs for each K value at a threshold of 0.9. The web-based software STRUCTURE HARVESTER v. 0.7 July 2022 [63] was used to summarise output data from STRUCTURE. The likelihood of K (Ln Pr(X|K)), the ΔK criterion using the method of Evanno et al. [64], and a proportion of similar runs that formed the major modes for each K were used to infer the best number of real populations in the datasets.

2.3. Parasite Collection, Processing and Analysis

A total of 81 individual fish were examined for parasites (Table 1). The fins, skin, gills, muscles, and internal organs were inspected for parasites. Myxozoans were examined live using light microscopy and photographed for further identification. Monogeneans were preserved in GAP (glycerine-ammonium-picrate) and prepared as semi-permanent slides [65] while digeneans and nematodes were preserved in hot 4% formaldehyde, with digeneans stained with iron acetic carmine, dehydrated in ethanol of increasing concentration, and mounted in Canada balsam as permanent slides [66,67]. Crustaceans were preserved in 4% formaldehyde and identified under light microscopy. All parasites were identified based on their morphological features at the species level where possible or at the highest taxonomic level when species-level identification was impossible. A subsample of larval digeneans and nematodes, where morphological identification is difficult, was preserved in 96% ethanol for further molecular analysis.
The DNA of parasites (larval digeneans and nematodes) was extracted using the Invisorb® Spin Forensic Kit (STRATEC Molecular, Berlin, Germany) following the standard protocol. We used forward primer BD1 (5′-GTCGTAACAAGGTTTCCGTA-3′) and the reverse primer 4S (5′-TCTAGATGCGTTCGAA(G/A)TGTCGATG-3′) [68] to obtain the ITS1 partial sequence for Posthodiplostomum, with an annealing temperature of 58 °C (PCR details in [43]). For obtaining the 18S partial sequence for nematodes, we employed the forward primer 18S-CL-F3 (5′-CTTGTCTCAAAGATTAAGCCATGCAT-3′) [69] and the reverse primer D2AR (5′-ACTTTCCCTCACGGTACTTGT-3′) (reverse of D2A from [70]). The reaction mix contained 4 μL of extracted DNA, 0.3 μL of each primer (10 μM), 2 μL of buffer A, 0.2 μL of dNTPs (10 mM), 0.2 μL of MgCl2 (25 mM), 0.5 U/μL of Taq polymerase, and ddH2O up to a total volume of 10 μL. For PCR analysis, we used the KAPA2G Robust HotStart PCR Kit (Kapabiosystems, Wilmington, MA, USA), with amplification conducted in a Mastercycler ep gradient S thermocycler (Eppendorf, Hamburg, Germany) following a temperature profile of the PCR reaction of 95 °C for 2 min, 5 cycles of (94 °C for 30 s, 45 °C for 40 s, 72 °C for 2 min), 40 cycles of (94 °C for 30 s, 58 °C for 40 s, 72 °C for 2 min), and a final extension at 72 °C for 5 min. All PCR products were purified using an ExoSAP-IT kit (Affymetrix Inc., Santa Clara, CA, USA) per the manufacturer’s protocol. Subsequently, the PCR products were commercially sequenced at Eurofins Genomics Germany GmbH. The sequences were checked and aligned using Geneious, and the newly generated sequences were compared with the NCBI database using BLASTn to assess sequence similarity.
Prevalence, intensity of infection, and abundance were calculated following Bush et al. [71]. Mean abundance was expressed as the mean number of parasites for all hosts in a sample, intensity of infection as the mean number of parasites for infected hosts, and prevalence as the percentage of infected hosts. The parasite community was analysed at both the infracommunity (IC, including all parasites on a single host) and component community (CC; all parasites in a host population) levels [71]. Similarity in parasite communities was evaluated based on qualitative and quantitative data on parasite species composition using the Sørensen and Bray–Curtis similarity indices, respectively. Diversity, describing the relationship of the ratios of all parasites in a host population or specimen, was calculated by the Shannon–Wiener index (H). Equitability (J) was used to measure the evenness with which individuals are distributed among the taxa present [72]. The trend for parasites to appear in the same IC was expressed by the infracommunity index (ICI). The ICI describes the frequency of double and multiple infections by a single parasite species in a distinct host [73]. Values > 0.4 indicate strongly interactive parasite species, >0.3 indicate a great tendency to join the community, while values > 0.2 suggest moderately interactive parasite species [73,74].

3. Results

3.1. Genetic Characterisation of Fish Host

All four pumpkinseed populations sampled in Türkiye exhibited a single cox1 haplotype. The partial cox1 sequences ranged between 630 and 636 bp in length and corresponded to those obtained from fish collected in other non-native European (GeneBank accession numbers KY231843, MW473462, HQ600737, KJ553720, MK439905) as well as native North American (KX145030, MF621725, KX145396, KX145175, KX145351, MF621724, MT667250, MF621726, JN026988) populations. A total of 19 alleles were observed for the five microsatellite loci, with four loci being polymorphic, while Lmar9 had a single allele in all four populations. All four populations were in Hardy–Weinberg equilibrium, and values of total and average allele richness, number of effective alleles, Shannon information index, and heterozygosity, as shown in Table 2, were similar among particular populations. Three private alleles were observed at each of the Davuldere and Değirmenköy Reservoirs.
STRUCTURE analysis conducted using fish from four populations in Türkiye and 11 other European localities [38] suggested that K = 2 and 6 are the most supported models of population structuring, based on a combination of the likelihood of K (Ln Pr(X|K)), the ΔK criterion [64], and the proportion of similar runs. For K = 2, the two clusters corresponded to (1) Türkiye (all four localities) + Kartal (Ukraine) + Jez (Czech Republic) + Gryfino Canal (Poland) and (2) localities in the basins of the rivers Danube (Austria, Bulgaria, Slovakia), Rhine (Germany), Elbe (Czech Republic), Girone (France), and Sado (Portugal) (Figure 1A). For K = 6, all populations from Türkiye formed a separate cluster, while Değirmenköy Reservoir was partially mixed with other European populations (Figure 1B).

3.2. Composition of Parasite Communities

Nine parasite taxa were found to infect pumpkinseed at four sites in western Türkiye, including one myxozoan, one monogenean, one digenean, five nematodes, and one crustacean (Table 3). Six parasite taxa were in larval stages, including the metacercariae of a digenean and all nematodes, which were all endoparasites located in internal organs, mesentery, and muscles. Ectoparasites were represented by myxozoans and monogeneans infecting gills and a parasitic copepod found on the fins or penetrating the body cavity. Three species, namely myxozoan Myxobolus dechtiari Cone and Anderson, 1977, monogenean Onchocleidus dispar (Mueller, 1936), and metacercariae of Posthodiplostomum centrarchi Hoffman, 1958, were introduced to Europe and are natural parasites of pumpkinseed in North America. These species had relatively high abundances and prevalence (Table 3). Identification of P. centrarchi was confirmed through both morphology and genetic analysis, with two sequences obtained from the Sarıçay River (Asia) and one from Değirmenköy Reservoir (Europe). One of the sequences from the Sarıçay River and the Değirmenköy Reservoir were identical and differed from the second sequence from the Sarıçay River with one substitution. All sequences showed 99.9–100% correspondence with P. centrarchi from pumpkinseed collected in the Hudson River in Canada (GeneBank Acc. No. MH521251), Hungary (MN080282), and in Portugal (MF171006; denoted as P. cf. minimum).
Out of all parasite taxa pumpkinseed acquired in Türkiye, only two nematodes were found in higher prevalence in Sarıçay River, namely larvae of Eustrongylides sp. (57% of fish infected) and larvae of Parquimperia tenerrima (von Linstow, 1878) Baylis, 1934 (48% of fish infected), with higher abundance (6.6) observed in the latter. Other taxa acquired in Türkiye (i.e., Aquariidae gen. sp., Contracaecum sp., Nematoda sp., Lernaea cyprinacea (Linnaeus, 1758)) occurred rarely. Larvae of Eustrongylides sp. Were found in all four localities. Both nematode species were subjected to genetic analysis. A sequence of 18S rDNA 775 bp long obtained from P. tenerrima (Sarıçay River) showed the highest similarity to P. africana (99.6%; difference by three substitutions) from Anguilla marmorata Quoy & Gaimard, 1824 in South Africa (JF803925). Larvae of Eustrongylides (18S rDNA, 849 bp) obtained from the Dipsiz-Çine Stream and Sarıçay River showed the highest similarity (with query cover > 80%) to Eustrongylides sp. (99.6 and 99.4%; difference caused by 1 substitution and one gap, and four unreadable bases, respectively) from Alligator sinensis Fauvel, 1879 in China (PP236907).
Maximum parasite prevalence (100%) was found in the Sarıçay River (Table 4). The IC species richness ranged from 0 to 4 per fish. All types of infracommunities were observed only in Değirmenköy Reservoir. Three species IC were found in the Sarıçay River, while two species IC were observed in the Dipsiz-Çine Stream and Davuldere Reservoir (Figure 2). Two parasite species occurred as strongly interactive in the parasite community, i.e., O. dispar in the Davuldere Reservoir and P. centrarchi in the Sarıçay River. Both species had a clear tendency to join the community in Değirmenköy Reservoir, together with larval nematodes Aquariidae gen. sp. In the Dipsiz-Çine Stream, all parasite taxa were moderately interactive (Table 5).

3.3. Parasite Diversity

The parasite species richness ranged from two (Davuldere Reservoir) to seven taxa (Değirmenköy Reservoir) (Table 3). High Shannon–Weiner diversity (H = 1.47) and equitability of the parasite community (J = 0.91) were found in the Dipsiz-Çine Stream; nevertheless, most of the fish (75%) at this locality were uninfected, and infected fish were parasitised with low intensities. Low diversity was observed in the Davuldere Reservoir and Sarıçay River (H < 0.25), with these 2 locations demonstrating the lowest equitability values (J = 0.14 and 0.23, respectively).

3.4. Similarity in Parasite Communities

Qualitative and quantitative similarities between parasite communities of pumpkinseed from particular localities are presented in Table 6. The highest qualitative similarity in parasite communities measured by the Sørensen index was observed between Dipsiz-Çine Stream and 2 other localities, Değirmenköy Reservoir (67%) and Sarıçay River (50%). Quantitative similarity measured by the Bray–Curtis index was generally very low, with the highest values found between Davuldere Reservoir and Değirmenköy Reservoir (17%) and the minimum similarity found between Davuldere Reservoir and Dipsiz-Çine Stream (29% for Sørensen) and Davuldere Reservoir and Sarıçay River (0.1% for Bray–Curtis; Table 6, Figure 3).

4. Discussion

Pumpkinseed collected at four localities in Türkiye exhibited low genetic variance in both mitochondrial and nuclear markers. All fish analysed were associated with a single cox1 haplotype. The same haplotype was previously found in other non-native populations in Europe [21,35,36] and many native populations in North America [21]. Despite previous studies revealing two different haplotypes at Sarıçay River and Davuldere Reservoir [21,39], our study failed to find these at the same localities ten years later. Pumpkinseed dispersal through Türkiye since its first record in the Turkish Thrace Region [17] followed the pathways of carp stocking, with extensive fish production facilities in the western part of Türkiye being the most probable source [21], and subsequent spread facilitated by local fishermen [75]. However, the reason for our failure to collect fish with the previously detected haplotypes remains a question. One possible explanation might be associated with multiple introductions to the same water bodies with ongoing stockings in Türkiye. According to Ağdamar et al. [21], common carp-rearing ponds in Türkiye are often affected by seasonal floods from the Meriç River, which can lead to the invasion of non-native fish in nearby large fish production units. Similar unintentional introduction through transboundary river systems was reported for Heteropneustes fossilis (Bloch, 1794) in the Dicle–Fırat (Tigris–Euphrates) River system [76,77]. As pumpkinseed in Greece belongs to the common European cox1 haplotype [35], it is possible that subsequent carp stockings unintentionally co-introduced pumpkinseed of this haplotype over ten years, leading to its dominance at the localities. Additionally, there may be natural changes in the occurrence and detection of haplotypes over time due to sampling efforts or stochastic processes [78]. Although new haplotypes were detected in 2015, they may have been present but not detected in 2021 owing to the smaller sampling size.
Results obtained from microsatellite data further supported the common origin of pumpkinseed populations in Türkiye and the rest of Europe. All four pumpkinseed populations collected in Türkiye clustered together, and their allelic composition appears to be most similar to fish from the lower Danube basin in Ukraine, i.e., a country located near Türkiye, and two populations in central Europe in the Czech Republic and Poland (Figure 1A). Unfortunately, our dataset did not include fish from Greece, which data might help confirm the primary source of pumpkinseed in Türkiye. Further successive separation of populations in the STRUCTURE analysis showed that Turkish populations grouped together and formed a separate cluster, indicating their strong genetic interrelationship (Figure 1B), which is in agreement with the suggestion of a single source for different localities in western Türkiye and Anatolia by Ağdamar et al. [21]. Interestingly, the population from Değirmenköy Reservoir, located in the European part of Istanbul, included specimens with different genetic origins, likely due to multiple introductions from various sources.
Based on the obtained results, the prediction that pumpkinseed populations with different haplotypes derived from a common European haplotype that is tolerant to a range of environmental conditions [21] would show low parasite diversity and abundance cannot be fully assessed. However, despite collecting fish of the common European haplotype, their parasite diversity appeared to be low in terms of parasites co-introduced along with the fish host and those acquired in the new environment. Similar results were found in pumpkinseed populations from Portugal and the Czech Republic, which exhibited low microsatellite allelic richness and heterozygosity [38], comparable to those in Türkiye. According to Luikart et al. [79], reduced heterozygosity may lead to increased parasite load in wild populations. However, this was not a general trend observed in our study, as most localities were inhabited by pumpkinseed with extremely low parasite abundance. Despite low heterozygosity and allelic richness, pumpkinseeds were rarely infected with local parasites. Moreover, except for the Sarıçay River, the infection by North American parasites was not high, reflecting their low availability in the environment, possibly due to the small founder population size with a limited number of North American parasites [52]. In addition to high environmental tolerance [21], low parasite load may thus be another trait of non-native pumpkinseed populations in Türkiye associated with rapid adaptation to new environmental conditions and establishment success, as was the case with pumpkinseed in the Sarıçay River [80].
Investigation of parasites in pumpkinseed in Türkiye has mainly focused on the European part of the country [81,82], with a single study from Asia focused on the rosette agent Sphaerothecum destruens Arkush, Mendoza, Adkison and Hedrick, 2003 in the Sarıçay River [83]. The previous studies [81,82] reported only 11 parasite taxa in pumpkinseed from Lake Sığırcı and Lake Gala, both located in the Meriç River basin. These taxa included monogeneans Gyrodactylus spp. and Onchocleidus similis (Mueller, 1936), metacercariae of Clinostomum complanatum (Rudolphi, 1814) Braun, 1899, Diplostomum sp., Tetracotyle sp., Tylodelphys clavata (von Nordmann, 1832) Diesing, 1850, acanthocephalan Acanthocephalus sp., nematodes Eustrongylides excisus Jägerskiöld, 1909 and Nematoda gen. sp., copepod L. cyprinacaea, and unidentified glochidia (summarised by [84]). Out of the parasite taxa previously found on pumpkinseed in Türkiye, just a single species, crustacean L. cyprinacea, was also found in this study. Our study identified at least seven additional parasite species infecting pumpkinseed in Türkiye, increasing the number of known parasite taxa associated with this fish species in the country. This finding suggests a richer parasite fauna in pumpkinseed populations than previously documented.
The co-introduction of parasites to new areas along with their hosts may be limited due to bottlenecks resulting from small founder populations [85]. Additionally, the probability of parasite co-introduction may depend on factors such as the host’s origin (from low or high parasitised sources) or developmental stage (e.g., eggs, larvae, vs. adults; [52]). Our study confirms the presence of three North American parasite species in Türkiye: the myxozoan M. dechtiari, the monogenean O. dispar, and the digenean P. centrarchi. These species were previously found in other European pumpkinseed populations (e.g., [38,45]). Notably, this study represents the first record of these North American parasite species in Türkiye; two (O. dispar and P. centrarchi) were observed in the Asian part of the country, while all three species were found in the European part. Interestingly, our study did not detect O. similis, previously found by Çolak [81] and Soylu [82] in lakes in the western part of the country. Dactylogyrid monogeneans are often host specific [86], and both O. similis and O. dispar primarily infect centrarchid fish [87]. The presence of different Onchocleidus species in both previous and current studies suggests potentially different sources of pumpkinseed for the localities in Gala and Sığırcı Lakes [81,82] and our sampling localities.
Onchocleidus dispar represents the most widespread and well-established co-introduced parasite in European pumpkinseed populations among the three species mentioned. Its presence in Europe dates back to the 1950s [88], making it one of the longest-known co-introduced parasites in pumpkinseed. Among the eight American monogeneans co-introduced to Europe [46,47], O. dispar represents the majority of single-species infections in many distant European populations. Records of single-species monogenean infection of pumpkinseed by O. dispar have been reported in various European regions, including southwest England [44], the basins of the Oder in Poland [36], the Dnieper in Ukraine [89,90], the Danube in the Czech Republic [38], and, in fact, the reservoirs on the Sado and Tejo rivers in Portugal [38]. Despite the high microsatellite similarity observed between pumpkinseed populations in Türkiye, indicating a common source of introduction, O. dispar was not observed in the Aegean region of Anatolia, specifically in the Sarıçay River and Dipsiz-Çine Stream. The absence of this parasite, which is specific for pumpkinseed and does not require other hosts in its life cycle, suggests either unfavourable environmental conditions for the parasite during or after pumpkinseed translocation or the introduction of very young or treated fish.
Posthodiplostomum centrarchi has recently been reported from various countries in Europe infecting both pumpkinseed and largemouth bass Micropterus salmoides (Lacepède, 1802) (e.g., [36,38,50,51,91], being distributed by its definitive hosts, herons (Ardeidae) [51]. Parasites collected in Sarıçay River and Değirmenköy Reservoir genetically corresponded to specimens obtained in Hungary and Portugal [50,92], as well as Posthodiplostomum sp. 3 sensu Locke et al., 2010, recovered from pumpkinseed in North America [93]. This study expands the distributional range of this non-native parasite to the Asian continent. Among the three North American parasites found, myxozoan M. dechtiari is the most recently observed, with only two reports from Europe. It was first observed in Hungary by Goswami et al. [45], and later, Kvach et al. [89] found it in the basin of the lower reach of the Danube River in Ukraine. This study marks the third report of this parasite in Europe.
The pumpkinseed in Türkiye harboured six parasite taxa, including one crustacean species, L. cyprinacea, and five taxa of larval nematodes. Most of these species occurred only occasionally, except for two relatively prevalent nematodes. Paraquimperia tenerrima, recorded solely in the Sarıçay River, was the most abundant parasite species, with a mean abundance of 6.6). In contrast, the mean abundance of other acquired parasites did not exceed one (see Table 4). This finding is also the first report of this parasite species in pumpkinseed. Paraquimperia tenerrima is a stenoxenous parasite known to infect the European eel (Anguilla anguilla L., 1758) as the definitive host, and it uses various fish species as paratenic hosts [94]. It is an indicator parasite of the eel populations, found mainly in old-age fish individuals [95]. Pumpkinseed, apparently susceptible paratenic hosts, had nearly 50% of individuals infected, with a maximum intensity of 70 larvae per fish. Further translocation of pumpkinseed infected with this parasite may spread P. tenerrima to other localities and subsequently infect local eel populations.
The second nematode parasite found in pumpkinseed with high prevalence (57%) were larvae of Eustrongylides sp. Despite primarily infecting fish-eating birds, larvae of Eustrongylides have zoonotic potential, being agents of human diseases [94]. Although rare, representatives of Eustrongylides have caused eustrongylidosis in humans in North America, the Middle East, and Africa [96], potentially having socio-economic implications. Therefore, the continued expansion of non-native pumpkinseed populations in Türkiye poses a threat not only to natural conservation efforts and fisheries but also potentially to human health.

Author Contributions

Conceptualization, M.O., Y.K. and D.G.; formal analysis, Y.K. and M.O.; investigation—field data collection, Y.K., M.Y.T., D.G., R.M., S.A., G.S., M.Ö. and A.S.T.; investigation—molecular analyses, M.Y.T. and V.B.; writing—original draft preparation, Y.K. and M.O.; writing—review and editing, all authors.; visualisation—M.O.; project administration—D.G., S.A., G.S., A.S.T. and M.O.; funding acquisition, M.O. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Inter-Action Project grant No. LTAUSA19092 under the Ministry of Education, Youth and Sports of the Czech Republic.

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Review Board (or Ethics Committee) of the Institute of Vertebrate Biology CAS (protocol code UBO-MO-17/1, Parasite infections of non-native fishes, approved 20 November 2017, valid 11/2017–12/2021).

Data Availability Statement

The data that support the findings of this study are available from the corresponding author, [M.O.], upon reasonable request.

Acknowledgments

We thank Oya Özuluğ and Harun İnci for their support during fish sampling. We would also like to thank Kevin Roche for help with fish dissection, František Moravec for help with nematode identification and Carl Smith for proofreading the English text.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Copp, G.H.; Bianco, P.G.; Bogutskaya, N.G.; Erős, T.; Falka, I.; Ferreira, M.T.; Fox, M.G.; Freyhof, J.; Gozlan, R.E.; Grabowska, J.; et al. To be, or not to be, a non-native freshwater fish? J. Appl. Ichthyol. 2005, 21, 242–262. [Google Scholar] [CrossRef]
  2. Seebens, H.; Bacher, S.; Blackburn, T.M.; Capinha, C.; Dawson, W.; Dullinger, S.; Genovesi, P.; Hulme, P.E.; van Kleunen, M.; Kühn, I.; et al. Projecting the continental accumulation of alien species through to 2050. Glob. Chang. Biol. 2021, 27, 5970–5982. [Google Scholar] [CrossRef]
  3. Seebens, H.; Blackburn, T.M.; Dyer, E.E.; Genovesi, P.; Hulme, P.E.; Jeschke, J.M.; Pagad, S.; Pyšek, P.; Winter, M.; Arianoutsou, M.; et al. No saturation in the accumulation of alien species worldwide. Nat. Commun. 2017, 8, 114435. [Google Scholar] [CrossRef] [PubMed]
  4. Cucherousset, J.; Olden, J.D. Ecological impacts of non-native freshwater fishes. Fisheries 2011, 36, 215–230. [Google Scholar] [CrossRef]
  5. Gozlan, R.E.; Britton, J.R.; Cowx, I.; Copp, G.H. Current knowledge on non-native freshwater fish introductions. J. Fish Biol. 2010, 76, 751–786. [Google Scholar] [CrossRef]
  6. Hulme, P.E. Trade, transport and trouble: Managing invasive species pathways in an era of globalisation. J. Appl. Ecol. 2009, 46, 10–18. [Google Scholar] [CrossRef]
  7. Vitule, J.R.S.; Freire, C.A.; Simberloff, D. Introduction of nonnative freshwater fish can certainly be bad. Fish Fish. 2009, 10, 98–108. [Google Scholar] [CrossRef]
  8. Leunda, P.M. Impacts of non-native fishes on Iberian freshwater ichthyofauna: Current knowledge and gaps. Aquat. Invasions 2010, 5, 239–262. [Google Scholar] [CrossRef]
  9. Kuchta, R.; Choudhury, A.; Scholz, T. Asian fish tapeworm: The most successful invasive parasite in freshwaters. Trends Parasitol. 2018, 34, 511–523. [Google Scholar] [CrossRef]
  10. Shinn, A.P.; Avenant-Oldewage, A.; Bondad-Reantaso, M.G.; Cruz-Laufer, A.J.; García-Vásquez, A.; Hernández-Orts, J.S.; Kuchta, R.; Longshaw, M.; Metselaar, M.; Pariselle, A.; et al. A global review of problematic and pathogenic parasites of farmed tilapia. Rev. Aquacult. 2023, 15, 92–153. [Google Scholar] [CrossRef]
  11. Scott, W.B.; Crossman, E.J. Freshwater Fishes of Canada; Fisheries Research Board of Canada: Ottawa, ON, Canada, 1973; pp. 1–184. [Google Scholar]
  12. Stansch, K. Die Exotischen Zierfische in Wort und Bild; G. Wenzel & Sohn: Braunschweig, Germany, 1914; pp. 1–349. [Google Scholar]
  13. Kunstler, J. Amiurus nebulosus et Eupomotis gibbosus. Bull. Soc. Acclimat. 1908, 55, 238–244. [Google Scholar]
  14. Vivier, P. Poissons et crustacés d’eau douce acclimatés en France en eaux libres depuis le début du siècle. Terre Et Vie 1951, 98, 57–82. [Google Scholar]
  15. Diripasko, O.A.; Demchenko, N.A.; Kulik, P.V.; Zabroda, T.A. An expansion of the pumpkinseed, Lepomis gibbosus (Centrarchidae, Perciformes), area of distribution into the east of Ukraine. Vestnik Zoologii 2008, 42, 269–273, (In Russian with English Summary). [Google Scholar]
  16. Ribeiro, F.; Leunda, P.M. Non-native fish impacts on Mediterranean freshwater ecosystems: Current knowledge and research needs. Fish. Manag. Ecol. 2012, 19, 142–156. [Google Scholar] [CrossRef]
  17. Erk’akan, F. The fishes of the Thrace region. Hacettepe Bull. Nat. Sci. Eng. 1983, 12, 39–48. [Google Scholar]
  18. Barlas, M.; Dirican, S. The fish fauna of the Dipsiz-Çine (Muğla-Aydın) Stream. Gazi Univ. J. Sci. 2004, 17, 35–48. [Google Scholar]
  19. Barlas, M.; Yilmaz, F.; Dirican, S. New exotic species in the Sarıçay (Milas) and Dipsiz-Çine stream: Lepomis gibbosus (Perciformes: Centrarchidae). In IV. National Ecological and Environmental Congress Book; 5-8 Ekim, Bodrum: Bodrum, Turkey, 2001; pp. 307–312. [Google Scholar]
  20. Dirican, S.; Barlas, M. Physico-chemical characteristics and fish of Dipsiz and Çine (Mugla-Aydın) Stream. Ekoloji 2005, 14, 25–30. [Google Scholar]
  21. Ağdamar, S.; Tarkan, A.S.; Keskin, E.; Top Karakuş, N.; Doğaç, E.; Baysal, Ö.; Emiroğlu, Ö. The role of environmental factors and genetic diversity on colonisation success of a non-native fish, Lepomis gibbosus from western part of Türkiye. Biochem. Syst. Ecol. 2015, 58, 195–203. [Google Scholar] [CrossRef]
  22. Baran, I.; Ongan, T. Gala Gölü’nün limnolojik özellikleri Balıkçılık Sorunları ve Öneriler. In Gala Gölü ve Sorunları Sempozyumu; Doğal Hayatı Koruma Derneği Bilimsel Yayınlar Serisi: İstanbul, Turkey, 1988; pp. 46–54. [Google Scholar]
  23. Bay, H. Studies on Exotic Pumpkinseed (Lepomis gibbosus L., 1758) Population Living in KEMER Dam and Akçay Stream (Büyük Menderes River, Türkiye). Master’s Thesis, Süleyman Demirel University, Science Institute, Isparta, Turkey, 2010. [Google Scholar]
  24. İlhan, A.; Sarı, H.M.; Kurtul, I.; Akçalı, M. Actual situation of Meriç River’s fish fauna and assessment of possible impacts of alien species on native species. LimnoFish 2020, 6, 75–87. [Google Scholar] [CrossRef]
  25. Koca, Y.B.; Koca, S.; Yıldız, Ş.; Gürcü, B.; Osanç, E.; Tunçbaş, O.; Aksoy, G. Investigation of histopathological and cytogenetic effects on Lepomis gibbosus (Pisces: Perciformes) in the Çine stream (Aydın/Türkiye) with determination of water pollution. Environ. Toxicol. 2005, 20, 560–571. [Google Scholar] [CrossRef]
  26. Özcan, G. Distribution of the non-native fish species, pumpkinseed Lepomis gibbosus (Linnaeus, 1758), in Türkiye. Aquat. Invasions 2007, 2, 146–148. [Google Scholar] [CrossRef]
  27. Özuluğ, M.; Gaygusuz, O.; Gaygusuz, C.G.; Sac, G. New distribution areas of four invasive freshwater fish species from Turkish Thrace. Turk. J. Fish. Aquat. Sci. 2019, 19, 837–845. [Google Scholar] [CrossRef]
  28. Türker, D.; Ünal, A.; Öktener, A. New locality for the pumpkinseed, Lepomis gibbosus (Linnaeus, 1758) in the Marmara Region, Türkiye. Acta Biol. Turc. 2022, 35, 29–35. [Google Scholar]
  29. Esmaeili, H.R.; Sayyadzadeh, G.; Eagderi, S.; Abbasi, K. Checklist of freshwater fishes of Iran. FishTaxa 2018, 3, 1–95. [Google Scholar]
  30. Jang, M.-H.; Kim, J.-G.; Park, S.-B.; Jeong, K.-S.; Cho, G.-I.; Joo, G.-J. The Current Status of the Distribution of Introduced Fish in Large River Systems of South Korea. Int. Rev. Hydrobiol. 2002, 87, 319–328. [Google Scholar] [CrossRef]
  31. Kizuka, T.; Akasaka, M.; Kadoya, T.; Takamura, N. Visibility from roads predict the distribution of invasive fishes in agricultural ponds. PLoS ONE 2014, 9, e0099709. [Google Scholar] [CrossRef]
  32. Wang, H.P.; Gao, Z.X.; Rapp, D.; O’Bryant, P.; Yao, H.; Cao, X.J. Effects of temperature and genotype on sex determination and sexual size dimorphism of bluegill sunfish Lepomis macrochirus. Aquaculture 2014, 64–71, 420–421. [Google Scholar] [CrossRef]
  33. Bock, D.; Caseys, C.; Cousens, R.; Hahn, M.A.; Heredia, S.M.; Hübner, S.; Turner, K.G.; Whitney, K.D.; Rieseberg, L.H. What we still don’t know about invasion genetics. Molec. Ecol. 2015, 24, 2277–2298. [Google Scholar] [CrossRef] [PubMed]
  34. Cristescu, M.E. Genetic reconstructions of invasion history. Mol. Ecol. 2015, 24, 2212–2225. [Google Scholar] [CrossRef]
  35. Lambea-Camblor, A.; Morcillo, F.; Muñoz, J.; Perdices, A. Genetic and ecological approaches to introduced populations of pumpkinseed sunfish (Lepomis gibbosus) in Southwestern Europe. Diversity 2023, 15, 1059. [Google Scholar] [CrossRef]
  36. Ondračková, M.; Tkachenko, M.; Bartáková, V.; Bryjová, A.; Janáč, M.; Zięba, G.; Pyrzanowski, K.; Kvach, Y. Population genetic structure, parasite infection and somatic condition of pumpkinseed Lepomis gibbosus (Actinopterygii: Centrarchidae) in the Oder river basin. J. Fish Biol. 2023, 102, 426–442. [Google Scholar] [CrossRef] [PubMed]
  37. Yavno, S.; Gobin, J.; Wilson, C.C.; Vila-Gispert, A.; Copp, G.H.; Fox, M. New and Old World phylogeography of pumpkinseed Lepomis gibbosus (Linnaeus, 1758): The North American origin of introduced populations in Europe. Hydrobiologia 2020, 847, 345–364. [Google Scholar] [CrossRef]
  38. Ondračková, M.; Bartáková, V.; Kvach, Y.; Bryjová, A.; Trichkova, T.; Ribeiro, F.; Carassou, L.; Martens, A.; Masson, G.; Zechmeister, T.; et al. Parasite infection reflects host genetic diversity in the pumpkinseeds non-native range. Hydrobiologia 2021, 848, 2169–2187. [Google Scholar] [CrossRef]
  39. Keskin, E.; Ağdamar, S.; Tarkan, A.S. DNA barcoding common non-native freshwater fish species in Türkiye: Low genetic diversity but high population structuring. Mitochondrial DNA 2013, 24, 276–287. [Google Scholar] [CrossRef] [PubMed]
  40. Goedknegt, M.A.; Feis, M.E.; Wegner, K.M.; Luttikhuizen, P.C.; Buschbaum, C.; Camphuysen, K.C.; van der Meer, J.; Thieltges, D.W. Parasites and marine invasions: Ecological and evolutionary perspectives. J. Sea Res. 2016, 113, 11–27. [Google Scholar] [CrossRef]
  41. Taraschewski, H. Hosts and parasites as aliens. J. Helminthol. 2006, 80, 99–128. [Google Scholar] [CrossRef]
  42. Torchin, M.E.; Lafferty, K.D.; Dobson, A.P.; McKenzie, V.J.; Kuris, A.M. Introduced species and their missing parasites. Nature 2003, 421, 628–630. [Google Scholar] [CrossRef]
  43. Dudliv, I.; Kvach, Y.; Tkachenko, M.Y.; Nazaruk, K.; Ondračková, M. Comparative analysis of parasite load on recently established invasive pumpkinseed Lepomis gibbosus (Actinopterygii: Centrarchidae) in Europe. Acta Parasitol. 2024, 69, 819–830. [Google Scholar] [CrossRef]
  44. Hockley, F.A.; Williams, C.F.; Reading, A.J.; Taylor, N.G.H.; Cable, J. Parasite fauna of introduced pumpkinseed fish Lepomis gibbosus: First British record of Onchocleidus dispar (Monogenea). Dis. Aquat. Org. 2011, 97, 65–73. [Google Scholar] [CrossRef]
  45. Goswami, U.; Molnár, K.; Cech, G.; Eiras, J.C.; Bandyopadhyay, P.K.; Ghosh, S.; Czeglédi, I.; Székely, C. Evidence of the American Myxobolus dechtiari was introduced along with its host in Europe: Molecular and histological data. Int. J. Parasit. Parasites Wildlife 2021, 15, 51–57. [Google Scholar] [CrossRef]
  46. Havlátová, L.; Ondračková, M.; Přikrylová, I. Monogenean parasites of Lepomis gibbosus Linnaeus introduced into the River Durance, France. Helminthologia 2015, 52, 323–330. [Google Scholar] [CrossRef]
  47. Kvach, Y.; Ondračková, M.; Kutsokon, Y.; Dzyziuk, N. New record of monogenean parasites on non-indigenous fishes in the Ukrainian Danube delta. BioInvasions Rec. 2018, 7, 65–72. [Google Scholar] [CrossRef]
  48. Ondračková, M.; Dávidová, M.; Přikrylová, I.; Pečínková, M. Monogenean parasites of introduced pumpkinseed Lepomis gibbosus (Centrarchidae) in the Danube River basin. J. Helminthol. 2011, 85, 435–441. [Google Scholar] [CrossRef]
  49. Kvach, Y.; Seifertová, M.; Carassou, L.; Ondračková, M. First record of the American cestode Proteocephalus ambloplitis (Leidy, 1887) (Proteocephalidae) in Europe. J. Helminthol. 2020, 94, e144. [Google Scholar] [CrossRef]
  50. Kvach, Y.; Jurajda, P.; Bryjová, A.; Trichkova, T.; Ribeiro, F.; Přikrylová, I.; Ondračková, M. European distribution for metacercariae of the North American digenean Posthodiplostomum cf. minimum centrarchi (Strigeiformes: Diplostomidae). Parasitol. Int. 2017, 66, 635–642. [Google Scholar] [CrossRef]
  51. Stoyanov, B.; Georgieva, S.; Pankov, P.; Kudlai, O.; Kostadinova, A.; Georgiev, B.B. Morphology and molecules reveal the alien Posthodiplostomum centrarchi Hoffman, 1958 as the third species of Posthodiplostomum Dubois, 1936 (Digenea: Diplostomidae) in Europe. Syst. Parasitol. 2017, 94, 1–20. [Google Scholar] [CrossRef]
  52. MacLeod, C.J.; Paterson, A.M.; Tompkins, D.M.; Duncan, R.P. Parasites lost—Do invaders miss the boat or drown on arrival? Ecol. Lett. 2010, 13, 516–527. [Google Scholar] [CrossRef] [PubMed]
  53. Kvach, Y.; Ondračková, M.; Janáč, M.; Jurajda, P. Methodological issues affecting the study of fish parasites. II. Sampling method affects ectoparasite studies. Dis. Aquat. Org. 2016, 121, 59–66. [Google Scholar] [CrossRef]
  54. Kvach, Y.; Ondračková, M.; Janáč, M.; Jurajda, P. Methodological issues affecting the study of fish parasites. I. Duration of live fish storage prior to dissection. Dis. Aquat. Org. 2016, 119, 107–115. [Google Scholar] [CrossRef]
  55. Ward, R.D.; Zemlak, T.S.; Innes, B.H.; Last, P.; Hebert, P.D.N. DNA barcoding Australia’s fish species. Philos. Trans. R. Soc. B 2005, 360, 1847–1857. [Google Scholar] [CrossRef]
  56. Weir, B.S.; Cockerham, C.C. Estimating F-statistics for the analysis of population structure. Evolution 1984, 38, 1358–1370. [Google Scholar]
  57. Belkhir, K.; Borsa, P.; Chikhi, L.; Raufaste, N.; Bonhomme, F. GENETIX 4.05, logiciel sous Windows TM Pour la Génétique des Populations. Laboratoire Génome, Populations, Interactions; CNRS UMR 5000; Université de Montpellier II: Montpellier, France, 1996–2004; Available online: http://www.genetix.univ-montp2.fr/genetix/genetix.htm (accessed on 28 April 2024).
  58. Raymond, M.; Rousset, F. An exact test for population differentiation. Evolution 1995, 49, 1280–1283. [Google Scholar] [CrossRef]
  59. Peakall, R.; Smouse, P. Genalex 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
  60. Peakall, R.; Smouse, P. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
  61. Hubisz, M.J.; Falush, D.; Stephens, M.; Pritchard, J.K. Inferring weak population structure with the assistance of sample group information. Mol. Ecol. Resour. 2009, 9, 1322–1332. [Google Scholar] [CrossRef] [PubMed]
  62. Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. Clumpak: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef] [PubMed]
  63. Earl, D.A.; vonHoldt, B.M. Structure Harvester: A website and program for visualizing structure output and implementing the Evanno method. Conservation Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
  64. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software structure: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [PubMed]
  65. Malmberg, G. The excretory systems and the marginal hooks as a basis for the systematics of Gyrodactylus (Trematoda, Monogenea). Arkiv för Zoologi 1970, 23, 1–235. [Google Scholar]
  66. Cribb, T.H.; Bray, R.A. Gut wash, body soak, blender and heat-fixation: Approaches to the effective collection, fixation and preservation of trematodes of fishes. Syst. Parasitol. 2010, 76, 1–7. [Google Scholar] [CrossRef]
  67. Georgiev, B.; Biserkov, V.; Genov, T. In toto staining method for cestodes with iron acetocarmine. Helminthologia 1986, 23, 279–281. [Google Scholar]
  68. Bowles, J.; McManus, D.P. Rapid discrimination of Echinococcus species and strains using a PCR-based RFLP method. Mol. Biochem. Parasitol. 1993, 57, 231–240. [Google Scholar] [CrossRef] [PubMed]
  69. Carta, L.K.; Li, S. Improved 18S small subunit rDNA primers for problematic nematode amplification. J. Nematol. 2018, 50, 533–542. [Google Scholar] [CrossRef] [PubMed]
  70. Nunn, G.B. Nematode molecular evolution. Ph.D. Thesis, University of Nottingham, Nottingham, UK, 1992. [Google Scholar]
  71. Bush, A.O.; Lafferty, K.D.; Lotz, J.M.; Shostak, A.W. Parasitology meets ecology on its own terms: Margolis et al. revisited. J. Parasitol. 1997, 83, 575–583. [Google Scholar] [CrossRef] [PubMed]
  72. Magurran, A.E. Measuring Biological Diversity; Blackwell Publishing Ltd.: Oxford, UK, 2004; pp. 1–256. [Google Scholar]
  73. Zander, C.D. Four-year monitoring of parasite communities in gobiid fishes of the south-western Baltic. II. Infracommunity. Parasitol. Res. 2004, 93, 17–29. [Google Scholar] [CrossRef]
  74. Zander, C.D. Parasite diversity of sticklebacks from the Baltic Sea. Parasitol. Res. 2007, 100, 287–297. [Google Scholar] [CrossRef]
  75. Aydin, H.; Dilek, M.K.; Aydin, K. Trends in fish and fishery products consumption in Turkey. Turk. J. Fish. Aquat. Sci. 2011, 11, 499–506. [Google Scholar] [CrossRef]
  76. Al-Hassan, L.A.; Muhsin, K. The presence of Barbus luteus and Heteropneustes fossilis in the Khor al Zubair, in the North-West of the Arabian Gulf. Zool. Middle East 1986, 1, 116–118. [Google Scholar] [CrossRef]
  77. Ünlü, E.; Çiçek, T.; Değer, D.; Coad, B.W. Range extension of the exotic Indian stinging catfish, Heteropneustes fossilis (Bloch, 1794) (Heteropneustidae) into the Turkish part of the Tigris River watershed. J. Appl. Ichthyol. 2011, 27, 141–143. [Google Scholar] [CrossRef]
  78. Frankham, R. Inbreeding and extinction: A threshold effect. Conserv. Biol. 1995, 9, 792–799. [Google Scholar] [CrossRef]
  79. Luikart, G.; Zundel, S.; Rioux, D.; Miquel, C.; Keating, K.A.; Hogg, J.T.; Steele, B.; Foresman, K.; Taberlet, P. Low genotyping error rates and noninvasive sampling in bighorn sheep. J. Wildl. Manag. 2008, 72, 299–304. [Google Scholar] [CrossRef]
  80. Tarkan, A.S.; Karakus, U.; Top, N.; Keskin, E.; Ünal, E.M.; Britton, J.R. Invasion of pumpkinseed Lepomis gibbosus is facilitated by phenotypic plasticity across its invasion gradient. Biol. Invasions 2021, 23, 3201–3214. [Google Scholar] [CrossRef]
  81. Çolak, H.S. Metazoan parasites of fish species from Lake Sığırcı (Edirne, Türkiye). Turk. J. Vet. Anim. Sci. 2013, 37, 200–205. [Google Scholar]
  82. Soylu, E. Metazoan parasites of fish species from Lake Gala (Edirne, Türkiye). Ege J. Fish Aqua. Sci. 2014, 31, 187–193. [Google Scholar]
  83. Ercan, D.; Andreou, D.; Sana, S.; Öntaş, C.; Baba, E.; Top, N.; Karakuş, U.; Tarkan, A.S.; Gozlan, R.E. Evidence of threat to European economy and biodiversity following introduction of an alien pathogen on the fungal-animal boundary. Emerg. Microbes. Infect. 2015, 4, e52. [Google Scholar] [CrossRef]
  84. Innal, D.; Stavrescu-Bedivan, M.M. A review of current knowledge on parasites of non-indigenous fish species in the inland waters of Türkiye. Transylv. Rev. Syst. Ecol. Res. 2022, 24, 55–74. [Google Scholar]
  85. Blackburn, T.M.; Ewen, J.G. Parasites as drivers and passengers of human-mediated biological invasions. EcoHealth 2017, 14, 61–73. [Google Scholar] [CrossRef] [PubMed]
  86. Šimková, A.; Morand, S.; Jobet, E.; Gelnar, M.; Verneau, O. Molecular phylogeny of congeneric monogenean parasites (Dactylogyrus): A case of intrahost speciation. Evolution 2004, 58, 1001–1018. [Google Scholar]
  87. Beverley-Burton, M. Monogenea and Turbellaria. In Guide to the Parasites of Fishes of Canada, Part I; Margolis, L., Kabata, Z., Eds.; Canadian Special Publication of Fisheries and Aquatic Sciences: Ottawa, ON, Canada, 1984; Volume 74, pp. 5–209. [Google Scholar]
  88. Roman, E. Parasite fauna of sunfish Lepomis gibbosus (L.), acclimatised in Danube. Doklady Akademii Nauk SSSR 1953, 89, 765–768, (In Russian with English Summary). [Google Scholar]
  89. Kvach, Y.; Tkachenko, M.; Bartáková, V.; Kutsokon, Y.; Janáč, M.; Demchenko, V.; Ondračková, M. Parasite communities and genetic structure of non-native pumpkinseed, Lepomis gibbosus, in different Black Sea drainages of Ukraine. Knowl. Manag. Aquat. Ecosyst. 2023, 424, 1. [Google Scholar] [CrossRef]
  90. Rubtsova, N.Y. First Record of Onchocleidus dispar, an alien monogenean from introduced pumpkinseed fish Lepomis gibbosus (Pisces, Centrarchidae) in Ukraine. Sci. Parasitol. 2015, 16, 83–88. [Google Scholar]
  91. Ondračková, M.; Kvach, Y.; Martens, A.; Jurajda, P. Limited parasite acquisition by non-native Lepomis gibbosus (Actinopterygii: Centrarchidae) at two ponds in the Upper Rhine basin, Germany. J. Helminthol. 2019, 4, 453–460. [Google Scholar] [CrossRef] [PubMed]
  92. Cech, G.; Sandor, D.; Molnar, K.; Paulus, P.; Papp, M.; Preiszner, B.; Vital, Z.; Varga, A.; Szekely, C. New record of metacercariae of the North American Posthodiplostomum centrarchi (Digenea, Diplostomidae) in pumpkinseed (Lepomis gibbosus) in Hungary. Acta Vet. Hung. 2020, 68, 20–29. [Google Scholar] [CrossRef]
  93. Locke, S.A.; McLaughlin, D.J.; Marcogliese, D.J. DNA barcodes show cryptic diversity and a potential physiological basis for host specificity among Diplostomoidea (Platyhelminthes: Digenea) parasitizing freshwater fishes in the St. Lawrence River. Canada. Mol. Ecol. 2010, 19, 2813–2827. [Google Scholar] [CrossRef]
  94. Moravec, F. Parasitic Nematodes of Freshwater Fishes of Europe; Academia: Prague, Czech Republic, 2013; pp. 1–601. [Google Scholar]
  95. Esposito, A.; Filippi, J.-J.; Gerbaud, C.; Godeaux, Q.; Millot, R.; Agostini, P.-J.; Albertini, C.; Durieux, E.; Foata, J.; Quilichini, Y. Macroparasite Communities with special attention to invasive helminths in European eels Anguilla anguilla from freshwaters and brackish lagoons of a Mediterranean island. Fishes 2023, 8, 375. [Google Scholar] [CrossRef]
  96. Honcharov, S.L.; Soroka, N.M.; Halat, M.V.; Dubovyi, A.I.; Zhurenko, V.V.; Halushko, I.A. Distribution of the nematodes of the genus Eustrongylides (Nematoda, Dioctophymatidae) in the World. Regul. Mech. Biosyst. 2022, 13, 73–79. [Google Scholar] [CrossRef]
Diversity 16 00272 g001aDiversity 16 00272 g001b
Figure 1. Map indicating the populations of pumpkinseed Lepomis gibbosus compared in this study. Populations from Türkiye are marked by black frames. Based on the STRUCTURE analysis, dividing into two (A) and six (B) clusters (marked by different colours) was identified as the best-supported model of population structuring.
Figure 1. Map indicating the populations of pumpkinseed Lepomis gibbosus compared in this study. Populations from Türkiye are marked by black frames. Based on the STRUCTURE analysis, dividing into two (A) and six (B) clusters (marked by different colours) was identified as the best-supported model of population structuring.
Diversity 16 00272 g001aDiversity 16 00272 g001b
Diversity 16 00272 g002
Figure 2. The representation of infracommunities (ranging from zero to four parasite taxa per fish individual) of the invasive pumpkinseed in different localities in Türkiye.
Figure 2. The representation of infracommunities (ranging from zero to four parasite taxa per fish individual) of the invasive pumpkinseed in different localities in Türkiye.
Diversity 16 00272 g002
Diversity 16 00272 g003
Figure 3. Dendrogram on Bray–Curtis similarity between parasite communities of Lepomis gibbosus at four localities in Turkey. DEG—Değirmenköy Reservoir, DAV—Davuldere Reservoir, DIP—Dipsiz-Çine Stream, SAR—Sarıçay River.
Figure 3. Dendrogram on Bray–Curtis similarity between parasite communities of Lepomis gibbosus at four localities in Turkey. DEG—Değirmenköy Reservoir, DAV—Davuldere Reservoir, DIP—Dipsiz-Çine Stream, SAR—Sarıçay River.
Diversity 16 00272 g003
Table 1. Size and weight of the sampled fish in Türkiye. SL—standard length, TL—total length (in mm), W—total weight, We—eviscerated weight (in g).
Table 1. Size and weight of the sampled fish in Türkiye. SL—standard length, TL—total length (in mm), W—total weight, We—eviscerated weight (in g).
Locality SL, mmTL, mmW, gWe, g
Sarıçay River (n = 21)M ± sd70.4 ± 4.886.2 ± 5.911.4 ± 2.611.0 ± 2.6
Min–max61.4–77.477.3–97.87.5–16.77.3–16.3
Dipsiz-Çine Stream (n = 20)M ± sd48.3 ± 21.859.0 ± 26.35.9 ± 11.55.7 ± 11.2
Min–max28.6–110.335.8–133.90.7–41.10.6–39.9
Davuldere Reservoir (n = 20)M ± sd48.1 ± 6.859.4 ± 8.12.9 ± 2.02.8 ± 2.0
Min–max42.7–74.352.1–90.41.8–11.31.6–11.2
Değirmenköy Reservoir (n = 20)M ± sd57.4 ± 19.470.4 ± 24.27.6 ± 9.47.3 ± 8.9
Min–max40.6–98.450.1–119.71.6–29.21.6–28.0
Table 2. Results of testing of genetic variability for five microsatellite loci. N = No. of individuals; NA = number of different alleles, I = Shannon’s Information Index; Ho = Observed Heterozygosity; He = Expected Heterozygosity; uHe = Unbiased Expected Heterozygosity; F = Fixation Index; HWE = P-values of Hardy–Weinberg Equilibrium; P = Percentage of Polymorphic Loci.
Table 2. Results of testing of genetic variability for five microsatellite loci. N = No. of individuals; NA = number of different alleles, I = Shannon’s Information Index; Ho = Observed Heterozygosity; He = Expected Heterozygosity; uHe = Unbiased Expected Heterozygosity; F = Fixation Index; HWE = P-values of Hardy–Weinberg Equilibrium; P = Percentage of Polymorphic Loci.
PopulationNNAIHoHeUheFHWE%P
Sarıçay River212.4000.5790.3330.3620.3700.0740.94080
Dipsiz-Çine Stream202.0000.4340.2800.2810.288−0.0210.99380
Davuldere Reservoir202.6000.5720.3300.3100.318−0.0660.42960
Değirmenköy Reservoir202.4000.6580.4500.4270.438−0.0800.52080
Table 3. Prevalence, mean abundance, species richness, mean infracommunity (IC) richness, Shannon and Equitability indices of parasite communities of the invasive pumpkinseed in four localities in Türkiye. Bold: greater part of homogeneity.
Table 3. Prevalence, mean abundance, species richness, mean infracommunity (IC) richness, Shannon and Equitability indices of parasite communities of the invasive pumpkinseed in four localities in Türkiye. Bold: greater part of homogeneity.
LocalityNPrevalence (in %)Mean AbundanceSpecies RichnessMean IC
(MI ± sd)		ShannonEquitability
Sarıçay River21100124.532.05 ± 0.650.250.23
Dipsiz-Çine Stream20250.550.30 ± 0.561.470.91
Davuldere Reservoir20702.520.75 ± 0.540.100.14
Değirmenköy Reservoir20908.871.70 ± 1.101.240.64
Table 4. Infection parameters of pumpkinseed Lepomis gibbosus from four localities in Türkiye: P—prevalence, in %; MI—mean intensity ± standard deviation and minimum—maximum range; and A- mean abundance.
Table 4. Infection parameters of pumpkinseed Lepomis gibbosus from four localities in Türkiye: P—prevalence, in %; MI—mean intensity ± standard deviation and minimum—maximum range; and A- mean abundance.
Parasite SpeciesSiteIndicesSarıçay RiverDipsiz-Çine StreamDavuldere ReservoirDeğirmenköy Reservoir
MYXOZOA
Myxobolus dechtiariGillsP, % 15.0
MI ± sd 15.3 ± 8.1
(min–max)(6–20)
A 2.30
MONOGENEA
Onchocleidus disparGillsP, % 70.055.0
MI ± sd 3.4 ± 2.31.6 ± 0.8
(min–max)(1–8)(1–3)
A 2.400.90
DIGENEA
Posthodiplostomum centrarchiMesentery, liver, spleen, heart, gonads, muscles, head, eyes, coelomP, %100.05.0 60.0
MI ± sd117.5 ± 48.03.0 7.7 ± 11.4
(min–max)(48–223)(3)(1–41)
A117.50.15 4.60
NEMATODA
Eustrongylides sp.MesenteryP, %57.15.05.05.0
MI ± sd1.6 ± 0.71.01.01.0
(min–max)(1–3)(1)(1)(1)
A0.90.050.050.05
Contracaecum sp. MesenteryP, % 10.0 10.0
MI ± sd 2.0 ± 1.4 1.0
(min–max)(1–3)(1)
A 0.2 0.1
Paraquimperia tenerrimaMesenteryP, %47.6
MI ± sd13.9 ± 21.8
(min–max)(1–70)
A6.6
Aquariidae gen. sp.Intestine wall, mesenteryP, % 20.0
MI ± sd 3.8 ± 2.4
(min–max)(1–7)
A 0.75
Nematoda gen. sp.LiverP, % 5.0
MI ± sd 1.0
(min–max)(1)
A 0.05
COPEPODA
Lernaea cyprinacea		Fins, mesenteryP, % 5.0 5.0
MI ± sd 1.0 1.0
(min–max)(1)(1)
A 0.05 0.05
Table 5. Infracommunity index of parasite species infecting the invasive pumpkinseed in four localities in Türkiye. Bold: parasite species with great tendency to join the infracommunity.
Table 5. Infracommunity index of parasite species infecting the invasive pumpkinseed in four localities in Türkiye. Bold: parasite species with great tendency to join the infracommunity.
Parasite SpeciesSarıçay RiverDipsiz-Çine StreamDavuldere ReservoirDeğirmenköy Reservoir
Myxobolus dechtiari 0.09
Onchocleidus dispar 0.930.32
Posthodiplostomum centrarchi0.490.17 0.35
Eustrongylides sp.0.280.170.070.03
Contracaecum sp. 0.33 0.09
Paraquimperia tenerrima0.23
Aquariidae gen. sp. 0.31
Nematoda gen. sp. 0.17
Lernaea cyprinacea 0.17 0.03
Table 6. Matrix of qualitative (Sørensen index, below diagonal) and quantitative Bray–Curtis index (above diagonal) similarities between parasite communities of pumpkinseed Lepomis gibbous sampled in four localities in Türkiye.
Table 6. Matrix of qualitative (Sørensen index, below diagonal) and quantitative Bray–Curtis index (above diagonal) similarities between parasite communities of pumpkinseed Lepomis gibbous sampled in four localities in Türkiye.
Sarıçay RiverDipsiz-Çine StreamDavuldere ReservoirDeğirmenköy Reservoir
Sarıçay River 0.0030.0010.067
Dipsiz-Çine0.500 0.0340.076
Davuldere Reservoir0.4000.286 0.170
Değirmenköy Reservoir0.4000.6670.444
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kvach, Y.; Tkachenko, M.Y.; Giannetto, D.; Míč, R.; Bartáková, V.; Ağdamar, S.; Saç, G.; Özuluğ, M.; Tarkan, A.S.; Ondračková, M. Low Genetic and Parasite Diversity of Invasive Pumpkinseed Lepomis gibbosus (Centrarchidae) Expanding in Türkiye. Diversity 2024, 16, 272. https://doi.org/10.3390/d16050272

AMA Style

Kvach Y, Tkachenko MY, Giannetto D, Míč R, Bartáková V, Ağdamar S, Saç G, Özuluğ M, Tarkan AS, Ondračková M. Low Genetic and Parasite Diversity of Invasive Pumpkinseed Lepomis gibbosus (Centrarchidae) Expanding in Türkiye. Diversity. 2024; 16(5):272. https://doi.org/10.3390/d16050272

Chicago/Turabian Style

Kvach, Yuriy, Maria Yu. Tkachenko, Daniela Giannetto, Robert Míč, Veronika Bartáková, Sevan Ağdamar, Gülşah Saç, Müfit Özuluğ, Ali Serhan Tarkan, and Markéta Ondračková. 2024. "Low Genetic and Parasite Diversity of Invasive Pumpkinseed Lepomis gibbosus (Centrarchidae) Expanding in Türkiye" Diversity 16, no. 5: 272. https://doi.org/10.3390/d16050272

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop