Antiphotoaging Effect of AGEs Blocker™ in UVB-Irradiated Cells and Skh:HR-1 Hairless Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Preparation of Extracts and High-Performance Liquid Chromatography (HPLC) Analysis
2.2. Cell Culture
2.3. Quantitation of Collagen and Matrix Metalloproteinase (MMP)-1 Production in Hs68 Cells
2.4. Measurement of Hyaluronic Acid Production in HaCaT Cells
2.5. Ethical Statement and Animal
2.6. Experiment Design and Treatment
2.7. Histological Examination (H&E Staining)
2.8. Assessment of the Indices Reflection the Skin Condition
2.9. Quantitation of Hyaluronic Acid, Collagen, and MMPs in the Skin Tissue
2.10. Measurement of Lipid Peroxidation and Antioxidative Enzyme Activity in the Skin Tissue
2.11. Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction (RT-PCR)
2.12. Western Blot Analysis
2.13. Statistical Analysis
3. Results
3.1. Phytochemical Content of AB
3.2. AB Is More Potent in Increasing the Content of Collagen and Hyaluronic Acid and Decreasing That of MMP-1 in UVB-Irradiated Cells
3.3. AB Alleviates Photoaging on the Dorsal Skin of UVB-Irradiated Hairless Mice
3.4. AB Increases Hyaluronic Acid and Collagen Expression on the Dorsal Skin of UVB-Irradiated Hairless Mice
3.5. AB Decreases the Expression of MMPs in Dorsal Skin Samples from UVB-Irradiated Hairless Mice
3.6. AB Suppresses UVB-Induced MAPK and AP-1 Activation in Dorsal Skin Samples from UVB-Irradiated Hairless Mice
3.7. AB Stimulates Antioxidative Enzymes Activities and Reduces Lipid Peroxidation in Dorsal Skin Samples from UVB-Irradiated Hairless Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Parrado, C.; Mercado-Saenz, S.; Perez-Davo, A.; Gilaberte, Y.; Gonzalez, S.; Juarranz, A. Environmental Stressors on Skin Aging. Mechanistic Insights. Front. Pharm. 2019, 10, 759. [Google Scholar] [CrossRef] [PubMed]
- Gilchrest, B.A.; Yaar, M. Ageing and Photoageing of the Skin: Observations at the Cellular and Molecular Level. Br. J. Dermatol. 1992, 127 (Suppl. S41), 25–30. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Fisher, G.J. Ultraviolet (UV) Light Irradiation Induced Signal Transduction in Skin Photoaging. J. Dermatol. Sci. Suppl. 2005, 1, S1–S8. [Google Scholar] [CrossRef]
- Cavinato, M.; Waltenberger, B.; Baraldo, G.; Grade, C.V.C.; Stuppner, H.; Jansen-Dürr, P. Plant Extracts and Natural Compounds Used against UVB-Induced Photoaging. Biogerontology 2017, 18, 499–516. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.H.; Lee, M.J.; Lee, S.R.; Kim, K.H.; Cho, K.H.; Eun, H.C.; Chung, J.H. Augmentation of UV-Induced Skin Wrinkling by Infrared Irradiation in Hairless Mice. Mech. Ageing Dev. 2005, 126, 1170–1177. [Google Scholar] [CrossRef]
- Poon, F.; Kang, S.; Chien, A.L. Mechanisms and Treatments of Photoaging. Photodermatol. Photoimmunol. Photomed. 2015, 31, 65–74. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.-H.; Sharrocks, A.D.; Whitmarsh, A.J. Transcriptional Regulation by the MAP Kinase Signaling Cascades. Gene 2003, 320, 3–21. [Google Scholar] [CrossRef]
- Cavinato, M.; Jansen-Dürr, P. Molecular Mechanisms of UVB-Induced Senescence of Dermal Fibroblasts and Its Relevance for Photoaging of the Human Skin. Exp. Gerontol. 2017, 94, 78–82. [Google Scholar] [CrossRef]
- Matsumura, Y.; Ananthaswamy, H.N. Toxic Effects of Ultraviolet Radiation on the Skin. Toxicol. Appl. Pharmacol. 2004, 195, 298–308. [Google Scholar] [CrossRef]
- Kim, N.Y.; Kwon, H.S.; Lee, H.Y. Effect of Inhibition on Tyrosinase and Melanogenesis of Agastache Rugosa Kuntze by Lactic Acid Bacteria Fermentation. J. Cosmet. Dermatol. 2017, 16, 407–415. [Google Scholar] [CrossRef]
- Lee, J.-J.; Lee, J.-H.; Gu, M.J.; Han, J.-H.; Cho, W.-K.; Ma, J.Y. Agastache Rugosa Kuntze Extract, Containing the Active Component Rosmarinic Acid, Prevents Atherosclerosis through up-Regulation of the Cyclin-Dependent Kinase Inhibitors P21WAF1/CIP1 and P27KIP1. J. Funct. Foods 2017, 30, 30–38. [Google Scholar] [CrossRef]
- Hong, S.-C.; Jeong, J.-B.; Park, G.-H.; Kim, J.-S.; Seo, E.-W.; Jeong, H.-J. Anti-Oxidant Effect of Agastache Rugosa on Oxidative Damage Induced by H2O2 in NIH 3T3 Cell. Korean J. Plant Resour. 2009, 22, 498–505. [Google Scholar]
- Oh, H.M.; Kang, Y.J.; Lee, Y.S.; Park, M.K.; Kim, S.H.; Kim, H.J.; Seo, H.G.; Lee, J.H.; Chang, K.C. Protein Kinase G-Dependent Heme Oxygenase-1 Induction by Agastache Rugosa Leaf Extract Protects RAW264.7 Cells from Hydrogen Peroxide-Induced Injury. J. Ethnopharmacol. 2006, 103, 229–235. [Google Scholar] [CrossRef] [PubMed]
- Hong, S.C.; Jeong, J.B.; Koo, J.S. Inhibitory Effect of Essential Oil from Agastache Rugosa against Nitric Oxide (NO) Production Induced by Inducible Nitric Oxide Synthase (INOS) over-Expression through NF-ΚB and Mitogen-Activated Protein Kinase (MAPK) Activation in Lipopolysaccharide (LPS)-Stimulated RAW264.7 Cells. J. Med. Plants Res. 2012, 6, 4494–4500. [Google Scholar] [CrossRef]
- Oh, Y.; Lim, H.-W.; Huang, Y.-H.; Kwon, H.-S.; Jin, C.D.; Kim, K.; Lim, C.-J. Attenuating Properties of Agastache Rugosa Leaf Extract against Ultraviolet-B-Induced Photoaging via up-Regulating Glutathione and Superoxide Dismutase in a Human Keratinocyte Cell Line. J. Photochem. Photobiol. B 2016, 163, 170–176. [Google Scholar] [CrossRef]
- Shin, D.; Lee, Y.; Huang, Y.-H.; Lim, H.-W.; Jang, K.; Kim, D.-D.; Lim, C.-J. Probiotic Fermentation Augments the Skin Anti-Photoaging Properties of Agastache Rugosa through up-Regulating Antioxidant Components in UV-B-Irradiated HaCaT Keratinocytes. BMC Complement. Altern. Med. 2018, 18, 196. [Google Scholar] [CrossRef]
- Yun, M.-S.; Kim, C.; Hwang, J.-K. Agastache Rugosa Kuntze Attenuates UVB-Induced Photoaging in Hairless Mice through the Regulation of MAPK/AP-1 and TGF-β/Smad Pathways. J. Microbiol. Biotechnol. 2019, 29, 1349–1360. [Google Scholar] [CrossRef]
- Lee, B.-C.; Paik, S.-W.; Kim, S.-D.; Yun, T.-S.; Park, J.-S.; Kwak, T.-S. Growth Characteristics and Yield of Collected Boxthon (Lycium chinense Mill.) Varieties. Korean J. Med. Crop Sci. 1999, 7, 147–154. [Google Scholar]
- Park, J.S.; Park, J.D.; Lee, B.C.; Choi, K.J.; Ra, S.W.; Chang, K.W. Effects of Extracts from Various Parts of Lycium chinense Mill. on the Proliferation of Mouse Spleen Cells. Korean J. Med. Crop Sci. 2000, 8, 291–296. [Google Scholar]
- Ahn, M.; Park, J.S.; Chae, S.; Kim, S.; Moon, C.; Hyun, J.W.; Shin, T. Hepatoprotective Effects of Lycium chinense Miller Fruit and Its Constituent Betaine in CCl4-Induced Hepatic Damage in Rats. Acta Histochem. 2014, 116, 1104–1112. [Google Scholar] [CrossRef]
- Deng, H.-B.; Cui, D.-P.; Jiang, J.-M.; Feng, Y.-C.; Cai, N.-S.; Li, D.-D. Inhibiting Effects of Achyranthes Bidentata Polysaccharide and Lycium Barbarum Polysaccharide on Nonenzyme Glycation in D-Galactose Induced Mouse Aging Model. Biomed. Env. Sci 2003, 16, 267–275. [Google Scholar]
- Arvaniti, O.S.; Samaras, Y.; Gatidou, G.; Thomaidis, N.S.; Stasinakis, A.S. Review on Fresh and Dried Figs: Chemical Analysis and Occurrence of Phytochemical Compounds, Antioxidant Capacity and Health Effects. Food Res. Int. 2019, 119, 244–267. [Google Scholar] [CrossRef] [PubMed]
- Solomon, A.; Golubowicz, S.; Yablowicz, Z.; Grossman, S.; Bergman, M.; Gottlieb, H.E.; Altman, A.; Kerem, Z.; Flaishman, M.A. Antioxidant Activities and Anthocyanin Content of Fresh Fruits of Common Fig (Ficus carica L.). J. Agric. Food Chem. 2006, 54, 7717–7723. [Google Scholar] [CrossRef] [PubMed]
- Alamgeer; Iman, S.; Asif, H.; Saleem, M. Evaluation of Antihypertensive Potential of Ficus carica Fruit. Pharm. Biol. 2017, 55, 1047–1053. [Google Scholar] [CrossRef] [PubMed]
- Aghel, N.; Kalantari, H.; Rezazadeh, S. Hepatoprotective Effect of Ficus carica Leaf Extract on Mice Intoxicated with Carbon Tetrachloride. Iran. J. Pharm. Res. 2011, 10, 63–68. [Google Scholar] [PubMed]
- Deepa, P.; Sowndhararajan, K.; Kim, S.; Park, S.J. A Role of Ficus Species in the Management of Diabetes Mellitus: A Review. J. Ethnopharmacol. 2018, 215, 210–232. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Cho, Y.J.; Sung, N.H.; Park, Y.M.; Shim, J.S.; Baek, K.S.; Kim, H.J.; Lee, J.J.; Choi, S.Y.; Ahn, H.Y.; et al. A Composition Comprising Heat Water Extract of Gijiberry, Fig and Agastache Rugosa as Active Ingredients. KR Patent 10-2197883, 28 December 2020. [Google Scholar]
- Lee, H.S.; Lim, S.-M.; Jung, J.I.; Kim, S.M.; Lee, J.K.; Kim, Y.H.; Cha, K.M.; Oh, T.K.; Moon, J.M.; Kim, T.Y.; et al. Gynostemma Pentaphyllum Extract Ameliorates High-Fat Diet-Induced Obesity in C57BL/6N Mice by Upregulating SIRT1. Nutrients 2019, 11, 2475. [Google Scholar] [CrossRef]
- Cheong, Y.; Kim, C.; Kim, M.-B.; Hwang, J.-K. The Anti-Photoaging and Moisturizing Effects of Bouea macrophylla Extract in UVB-Irradiated Hairless Mice. Food Sci. Biotechnol. 2018, 27, 147–157. [Google Scholar] [CrossRef]
- Lim, J.-Y.; Kim, O.-K.; Lee, J.; Lee, M.-J.; Kang, N.; Hwang, J.-K. Protective Effect of the Standardized Green Tea Seed Extract on UVB-Induced Skin Photoaging in Hairless Mice. Nutr. Res. Pr. 2014, 8, 398–403. [Google Scholar] [CrossRef]
- Yun, J.; Kim, C.; Kim, M.-B.; Hwang, J.-K. Piper retrofractum Vahl. Extract, as a PPARδ and AMPK Activator, Suppresses UVB-Induced Photoaging through Mitochondrial Biogenesis and MMPs Inhibition in Human Dermal Fibroblasts and Hairless Mice. Evid. Based Complement. Altern. Med. 2018, 2018, 6172954. [Google Scholar] [CrossRef]
- Park, J.-E.; Pyun, H.-B.; Woo, S.W.; Jeong, J.-H.; Hwang, J.-K. The Protective Effect of Kaempferia parviflora Extract on UVB-Induced Skin Photoaging in Hairless Mice. Photodermatol. Photoimmunol. Photomed. 2014, 30, 237–245. [Google Scholar] [CrossRef]
- Wang, L.; Yang, K.; Jing, R.; Zhao, W.; Guo, K.; Hu, Z.; Liu, G.; Xu, N.; Zhao, J.; Lin, L.; et al. Protective Effect of Saussurea Involucrata Polysaccharide against Skin Dryness Induced by Ultraviolet Radiation. Front. Pharm. 2023, 14, 1089537. [Google Scholar] [CrossRef] [PubMed]
- Misawa, E.; Tanaka, M.; Saito, M.; Nabeshima, K.; Yao, R.; Yamauchi, K.; Abe, F.; Yamamoto, Y.; Furukawa, F. Protective Effects of Aloe Sterols against UVB-Induced Photoaging in Hairless Mice. Photodermatol. Photoimmunol. Photomed. 2017, 33, 101–111. [Google Scholar] [CrossRef]
- Nanashima, N.; Horie, K.; Maeda, H.; Tomisawa, T.; Kitajima, M.; Nakamura, T. Blackcurrant Anthocyanins Increase the Levels of Collagen, Elastin, and Hyaluronic Acid in Human Skin Fibroblasts and Ovariectomized Rats. Nutrients 2018, 10, 495. [Google Scholar] [CrossRef] [PubMed]
- Tohgasaki, T.; Nishizawa, S.; Kondo, S.; Ishiwatari, S.; Sakurai, T. Long Hanging Structure of Collagen VII Connects the Elastic Fibers and the Basement Membrane in Young Skin Tissue. J. Histochem. Cytochem. 2022, 70, 751–757. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.Y.; Choi, Y.J.; Son, S.-R.; Yoon, Y.-S.; Lee, S.-H.; Lee, K.-T.; Lee, S.; Jang, D.S. Potentilloside A, a New Flavonol-Bis-Glucuronide from the Leaves of Potentilla chinensis, Inhibits TNF-α-Induced ROS Generation and MMP-1 Secretion. Plants 2022, 11, 3318. [Google Scholar] [CrossRef]
- Ha, A.T.; Rahmawati, L.; You, L.; Hossain, M.A.; Kim, J.-H.; Cho, J.Y. Anti-Inflammatory, Antioxidant, Moisturizing, and Antimelanogenesis Effects of Quercetin 3-O-β-D-Glucuronide in Human Keratinocytes and Melanoma Cells via Activation of NF-ΚB and AP-1 Pathways. Int. J. Mol. Sci. 2021, 23, 433. [Google Scholar] [CrossRef]
- Han, S.H.; Ballinger, E.; Choung, S.-Y.; Kwon, J.Y. Anti-Photoaging Effect of Hydrolysates from Pacific Whiting Skin via MAPK/AP-1, NF-ΚB, TGF-β/Smad, and Nrf-2/HO-1 Signaling Pathway in UVB-Induced Human Dermal Fibroblasts. Mar. Drugs 2022, 20, 308. [Google Scholar] [CrossRef]
- He, Y.-L.; Xiao, Z.; Yang, S.; Zhou, C.; Sun, S.; Hong, P.; Qian, Z.-J. A Phlorotanin, 6,6’-Bieckol from Ecklonia Cava, Against Photoaging by Inhibiting MMP-1, -3 and -9 Expression on UVB-Induced HaCaT Keratinocytes. Photochem. Photobiol. 2022, 98, 1131–1139. [Google Scholar] [CrossRef]
- Jung, Y.Y.; Ha, I.J.; Lee, M.; Ahn, K.S. Skin Improvement with Antioxidant Effect of Yuja (Citrus junos) Peel Fractions: Wrinkles, Moisturizing, and Whitening. Antioxidants 2022, 12, 51. [Google Scholar] [CrossRef]
- da Silva, B.T.A.; Peloi, K.E.; Ximenes, V.F.; Nakamura, C.V.; de Oliveira Silva Lautenschlager, S. 2-Acetylphenothiazine Protects L929 Fibroblasts against UVB-Induced oxidant Damage. J. Photochem. Photobiol. B 2021, 216, 112130. [Google Scholar] [CrossRef]
- Qu, C.; Li, N.; Liu, T.; He, Y.; Miao, J. Preparation of CPD Photolyase Nanoliposomes Derived from Antarctic Microalgae and Their Effect on UVB-Induced Skin Damage in Mice. Int. J. Mol. Sci. 2022, 23, 15148. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Zhou, G.; Meng, X.-S.; Fu, H.-Y.; Mo, Q.-G.; Wang, Y.-W. Photoprotection of Maqui Berry against Ultraviolet B-Induced Photodamage In Vitro and In Vivo. Food Funct. 2020, 11, 2749–2762. [Google Scholar] [CrossRef] [PubMed]
- Han, H.-S.; Shin, J.-S.; Myung, D.-B.; Ahn, H.S.; Lee, S.H.; Kim, H.J.; Lee, K.-T. Hydrangea serrata (Thunb.) Ser. Extract Attenuate UVB-Induced Photoaging through MAPK/AP-1 Inactivation in Human Skin Fibroblasts and Hairless Mice. Nutrients 2019, 11, 533. [Google Scholar] [CrossRef] [PubMed]
- Hong, J.-A.; Bae, D.; Oh, K.-N.; Oh, D.-R.; Kim, Y.; Kim, Y.; Jeong Im, S.; Choi, E.-J.; Lee, S.-G.; Kim, M.; et al. Protective Effects of Quercus acuta Thunb. Fruit Extract against UVB-Induced Photoaging through ERK/AP-1 Signaling Modulation in Human Keratinocytes. BMC Complement. Med. Ther. 2022, 22, 6. [Google Scholar] [CrossRef]
- Kim, J.-M.; Chung, K.-S.; Yoon, Y.-S.; Jang, S.-Y.; Heo, S.-W.; Park, G.; Jang, Y.-P.; Ahn, H.-S.; Shin, Y.-K.; Lee, S.-H.; et al. Dieckol Isolated from Eisenia bicyclis Ameliorates Wrinkling and Improves Skin Hydration via MAPK/AP-1 and TGF-β/Smad Signaling Pathways in UVB-Irradiated Hairless Mice. Mar. Drugs 2022, 20, 779. [Google Scholar] [CrossRef]
- Park, B.; Hwang, E.; Seo, S.A.; Cho, J.-G.; Yang, J.-E.; Yi, T.-H. Eucalyptus globulus Extract Protects against UVB-Induced Photoaging by Enhancing Collagen Synthesis via Regulation of TGF-β/Smad Signals and Attenuation of AP-1. Arch. Biochem. Biophys. 2018, 637, 31–39. [Google Scholar] [CrossRef]
- Sotiropoulou, G.; Zingkou, E.; Pampalakis, G. Redirecting drug repositioning to discover innovative cosmeceuticals. Exp. Dermatol. 2021, 30, 628–644. [Google Scholar] [CrossRef]
Target Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
Catalase | GAACGAGGAGGAGAGGAAAC | TGAAATTCTTGACCGCTTTC |
Col1a1 | GCACGAGTCACACCGGAACT | AAGGGAGCCACATCGATGAT |
Col3a1 | CTAAAATTCTGCCACCCCGAA | AGGATCAACCCAGTATTCTCCACTC |
Col4a1 | CTACGTGCAAGGCAATGAACG | GCAGAACAGGAAGGGCATTGT |
Glutathione peroxidase | CGGTTTCCCGTGCAATCAGT | CACCGGGGACCAAATGATG |
Has1 | GTGCGAGTGTTGGATGAAGACC | CACATTGAAGGCTACCCAGTATC |
Has2 | GCCATTTTCCGAATCCAAACAGAC | CCTGCCACACTTATTGATGAGAACC |
Has3 | CTTCAGTCCAGAAACCAAAGTAGG | CTCGTTCCTCAAGAGAAACAAGG |
Mmp-1 | TTGCCCAGAGAAAAGCTTCAG | TAGCAGCCCAGAGAAGCAACA |
Mmp-9 | AGTGGGACCATCATAACATCACAT | TCTCGCGGCAAGTCTTCAG |
Gapdh | TGGGTGTGAACCATGAGAAG | GCTAAGCAGTTGGTGGTGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jung, J.; Choi, Y.-J.; Yoo, J.; Choi, S.-Y.; Kim, E. Antiphotoaging Effect of AGEs Blocker™ in UVB-Irradiated Cells and Skh:HR-1 Hairless Mice. Curr. Issues Mol. Biol. 2023, 45, 4181-4199. https://doi.org/10.3390/cimb45050266
Jung J, Choi Y-J, Yoo J, Choi S-Y, Kim E. Antiphotoaging Effect of AGEs Blocker™ in UVB-Irradiated Cells and Skh:HR-1 Hairless Mice. Current Issues in Molecular Biology. 2023; 45(5):4181-4199. https://doi.org/10.3390/cimb45050266
Chicago/Turabian StyleJung, JaeIn, Yean-Jung Choi, JinHee Yoo, Su-Young Choi, and EunJi Kim. 2023. "Antiphotoaging Effect of AGEs Blocker™ in UVB-Irradiated Cells and Skh:HR-1 Hairless Mice" Current Issues in Molecular Biology 45, no. 5: 4181-4199. https://doi.org/10.3390/cimb45050266