Next Article in Journal
Blood Group Variations in COVID-19 Convalescent Plasma and Regular Blood Donors: A Comparative Analysis in the Serbian Population
Previous Article in Journal
Metagenomic and Culturomics Analysis of Microbial Communities within Surface Sediments and the Prevalence of Antibiotic Resistance Genes in a Pristine River: The Zaqu River in the Lancang River Source Region, China
Previous Article in Special Issue
What do We Know about Cryptic Aspergillosis?
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microorganisms
Volume 12
Issue 5
10.3390/microorganisms12050912
microorganisms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

Molecular Detection and Characterization of Rickettsia Species in Ixodid Ticks from Selected Regions of Namibia

by
Pricilla Mbiri
1,
Ophelia Chuma Matomola
2,
Walter Muleya
3,
Lusia Mhuulu
4,
Azaria Diegaardt
4,
Bruce Howard Noden
5,
Katendi Changula
6,
Percy Chimwamurombe
7,
Carolina Matos
8,
Sabrina Weiss
8,
Emmanuel Nepolo
4 and
Simbarashe Chitanga
2,9,*
1
Department of Production Animal Studies, School of Veterinary Medicine, Faculty of Health Sciences and Veterinary Medicine, University of Namibia, Private Bag 13301, Windhoek 10005, Namibia
2
Department of Preclinical Studies, School of Veterinary Medicine, Faculty of Health Sciences and Veterinary Medicine, University of Namibia, Private Bag 13301, Windhoek 10005, Namibia
3
Department of Preclinical Studies, School of Veterinary Medicine, University of Zambia, P.O. Box 32379, Lusaka 10101, Zambia
4
Department of Human Biology and Translational Medicine, School of Medicine, Faculty of Health Sciences and Veterinary Medicine, University of Namibia, Private Bag 13301, Windhoek 10005, Namibia
5
Department of Entomology and Plant Pathology, Oklahoma State University, Stillwater, OK 74078, USA
6
Department of Paraclinical Studies, School of Veterinary Medicine, University of Zambia, P.O. Box 32379, Lusaka 10101, Zambia
7
Department of Natural and Applied Sciences, Namibia University of Science & Technology, Windhoek 10005, Namibia
8
Centre for International Health Protection, Robert Koch Institute, 13353 Berlin, Germany
9
Department of Biomedical Sciences, School of Health Sciences, University of Zambia, P.O. Box 50110, Lusaka 10101, Zambia
*
Author to whom correspondence should be addressed.
Microorganisms 2024, 12(5), 912; https://doi.org/10.3390/microorganisms12050912
Submission received: 14 March 2024 / Revised: 22 April 2024 / Accepted: 25 April 2024 / Published: 30 April 2024
(This article belongs to the Special Issue Emerging Pathogens in the Context of One Health)
Browse Figures
Review Reports Versions Notes

Abstract

:
Rickettsial pathogens are among the emerging and re-emerging vector-borne zoonoses of public health importance. Reports indicate human exposure to Rickettsial pathogens in Namibia through serological surveys, but there is a lack of data on infection rates in tick vectors, hindering the assessment of the relative risk to humans. Our study sought to screen Ixodid ticks collected from livestock for the presence of Rickettsia species in order to determine infection rates in ticks and to determine the Rickettsia species circulating in the country. We collected and pooled Hyalomma and Rhipicephalus ticks from two adjacent regions of Namibia (Khomas and Otjozondjupa) and observed an overall minimum Rickettsia infection rate of 8.6% (26/304), with an estimated overall pooled prevalence of 9.94% (95% CI: 6.5–14.3). There were no statistically significant differences in the estimated pooled prevalence between the two regions or tick genera. Based on the nucleotide sequence similarity and phylogenetic analysis of the outer membrane protein A (n = 9) and citrate synthase (n = 12) genes, BLAST analysis revealed similarity between Rickettsia africae (n = 2) and Rickettsia aeschlimannii (n = 11), with sequence identities ranging from 98.46 to 100%. Our initial study in Namibia indicates that both zoonotic R. africae and R. aeschlimannii are in circulation in the country, with R. aeschlimannii being the predominant species.

1. Introduction

Ticks are considered very important vectors of a variety of pathogens, including viruses, bacteria, and protozoa, which are of significant importance to animal and human health. Ticks have the ability to survive on multiple hosts in their lives and have a relatively long life span, which helps them to adapt and survive in different habitats [1]. Climatic and anthropogenic activities have resulted in a changed landscape of tick distribution geographically, with the creation of new ecological niches ideal for tick survival [1,2]. Climatic factors have also been shown to have a direct influence on the risk of pathogen transmission by ticks through their effect on pathogen survival in the tick and, more importantly, through the influence on tick questing behavior, which has a direct effect on the risk of pathogen transmission [3,4]. Consequently, a number of tick-transmitted pathogens are currently considered either emergent or re-emergent, due in part to the aforementioned change in tick distribution as well as an improvement in pathogen detection methods [2,5,6]. Among the tick-borne pathogens, the relative importance of Rickettsia species as an important pathogen, globally, has grown significantly in recent decades [1].
Rickettsia, which are considered endosymbiotic organisms of various arthropod species [7,8], can be broadly divided into five (5) basic groups, namely a basal ancestral group, the typhus group, the transitional group, the spotted fever group, and the Tamurae/Ixodes group [9]. With the advent and increasing use of molecular tools, the genus Rickettsia shows an increase in the number of newly reported species [10], with speciation based on the genetic divergence percentage in a number of genes [11]. The spotted fever group Rickettsiae (SFGR) are responsible for most human infections and is considered one of the most common emerging and re-emerging vector-borne pathogens globally [12,13]. Global interest in Rickettsia species has been shown by the increase in reports of new species in the last 30 years in different regions of the world [14], especially with new reports on human infections [15]. Of the reported SFGR, 21 of these are considered to be human pathogenic vector-borne pathogens [3,12,16].
SFGR are mostly transmitted by ticks, with the exception of R. felis and R. akari, which are transmitted by fleas and mites, respectively [17]. In ticks, transmission is known to occur transstadially [18] and/or transovarially [19], which makes ticks serve as vectors, reservoirs, and amplifiers of infections [13,20]. Therefore, the distribution and relative abundance of Rickettsia species in any geographical area are influenced by factors that affect tick distribution. A total of 146 tick species have been reported globally to carry SFGR, and about 13 SFGR species have been reported across the African continent [21]. Within the SFGR, R. africae and R. aeschlimannii exhibit a broad range of ticks that serve as vectors, hence their wide geographical distribution [21]. Even though Amblyomma species are considered the principal vectors of R. africae in sub-Saharan Africa [22], the bacterium has been reported to have varying infection rates in Hyalomma and Rhipicephalus tick species [23,24].
Despite reports of human infective Rickettsia species in ticks within the southern African region [24,25,26,27], and serological reports of human infections caused by Rickettsial pathogens in Namibia [28], there have been no molecular reports of Rickettsia circulation in the country. A previous study [29] conducted on small mammals in two regions of the country did not report the presence of Rickettsia species in this group of animals. Thus, the aim of this study was to screen for Rickettsia species in ticks from two neighboring regions of the country and characterize them to identify the species circulating in the area.

2. Materials and Methods

2.1. Study Sites

The study was conducted in the farming communities of the Khomas (Neudamm) and Otjozondjupa (Ovitoto) regions of Namibia (Figure 1). The two regions have semi-arid climatic conditions, with dry grassy plains. The Khomas region has more commercial farms, whereas the Otjozondjupa region is a resource-limited area with subsistence farming. Ticks were collected from cattle in the two sampling areas during the period of January to April 2023, and this was purposively carried out as they presented better chances of collecting significant numbers of ticks compared to environmental sampling. For the Khomas region, sampling was conducted on one farm (Neudamm) from animals that belonged to four (4) separate grazing groups. In the Otjozondjupa region, sampling was conducted in a village (Ovitoto) from a number of different herds that shared a common grazing area.
Ticks were collected from animals restrained in a crush pen using a pair of forceps and placed in aerated and humidified tubes for transportation to the laboratory. In the laboratory, the ticks were individually identified using established identification keys [30], and then placed in individual Eppendorf tubes and stored at −80 °C until further analysis. DNA was extracted from individual ticks using the Quick-DNA Miniprep Kit (Zymo Research, Orange, CA, USA), according to the manufacturer’s protocol, with the addition of a homogenization process for ticks that used a microbead beater. After the extraction process, DNA was pooled (4 ticks/pool) based on the genus of the tick and the sampling area.

2.2. Molecular Screening and Identification of Rickettsia Species

For initial screening for the presence of Rickettsia species, OneTaq® Quick-load 2X Mastermix with standard buffer (New England BioLabs® Inc., Ipswich, MA, USA) was used to amplify a 507-bp fragment of the outer membrane protein B (ompB) using primers designed for this study (Table 1). A known Rickettsia-positive sample (LC565644) [25] was included as a positive control, whereas purified water was included as a negative control. The PCR amplification reaction involved a one-step enzyme activation at 95 °C for 3 min, followed by 35 cycles of denaturation at 95 °C for 15 s, annealing at 46 °C for 30 s, extension at 72 °C for 45 s, with a final extension at 72 °C for 5 min. The amplified products were then electrophoresed on a 1% agarose gel, stained with ethidium bromide, and subsequently viewed under UV light.
All pools positive on the initial screening were subsequently selected for amplification of near-full-length fragments of the outer membrane protein A (ompA) (around 2971 bp) and citrate synthase (gltA) genes (around 1076 bp) using LongAmp® Taq 2X Mater mix (New England BioLabs® Inc., USA). The PCR amplification reaction involved a one-step enzyme activation at 94 °C for 30 s, followed by 30 cycles of denaturation at 94 °C for 15 s, annealing at 45 °C for 30 s, and extension at 65 °C for 6 min, with a final extension at 65 °C for 10 min. The amplified products were then electrophoresed on a 1% agarose gel, stained with ethidium bromide, and subsequently viewed under UV light to confirm the success of PCR amplification.
Near-full-length PCR products of the ompA and gltA genes were purified using the DNA Clean & Concentrator® kit (Zymo Research) in preparation for sequencing using the Illumina platform (iSeq 100, San Diego, CA, USA). The libraries were prepared and sequenced following the Illumina Baym Library preparation protocol with modifications to the first-stage PCRs and the first PCR clean-up. The first-stage PCR primers were modified to include Illumina iSeq 100 adapter sequences. The Rickettsia-specific gene libraries were subsequently sequenced by paired-end sequencing using the iSeq™ 100 i1 Reagent v2 kit (300-cycle) chemistry (San Diego, CA, USA), according to the manufacturer’s instructions.

2.3. Phylogenetic Analysis

The raw Illumina sequence data were first subjected to quality control using FastQC (https://github.com/s-andrews/FastQC/, accessed on 7 January 2024), followed by trimming and barcode removal using SICKLE (https://github.com/najoshi/sickle, accessed on 10 January 2024). Following these pre-processing steps, de novo assembly was performed using SPAdes [31] (https://github.com/ablab/spades, accessed on 12 January 2024). The sequences obtained in this study were deposited in GenBank under accession numbers LC799204–LC799224. Near-full-length gene sequences of gltA (1076 bp) and ompA (2971 bp) were successfully obtained and subjected to standard nucleotide BLAST analysis on the NCBI website (http://www.ncbi.nlm.nih.gov/BLAST, accessed on 6 February 2024). Further, reference sequences were downloaded from GenBank, and together with the obtained nucleotide sequences, a multiple sequence alignment file was generated using Clustal W1.6 (GENETYX Corporation, Tokyo, Japan). Subsequently, the multiple sequence alignment file in fasta format was converted to a mega file and then employed to construct maximum likelihood phylogenetic trees. For gltA, the Tamura-3 parameter + Invariable sites model was used, whereas for ompA, the Tamura-3 parameter + Gamma distribution model was applied. Before constructing the phylogenetic trees, model selection for each gene was conducted using the model selection function available in MEGA 6. The phylogenetic tree construction was performed with a confidence level of 1000 bootstrap replicates [32] using the computer software MEGA XI [33].

2.4. Statistical Analysis

The results from the initial screening based on the ompB gene were used to determine the minimum infection rate (MIR), which was calculated as the proportion of tick pools that showed amplification of the target gene out of the total number of ticks tested multiplied by 100 [34]. Pooled prevalence estimates for perfect tests with exact confidence limits were calculated using EpiTools epidemiological calculators [35], assuming 100% test sensitivity and specificity for a fixed pool size (http://epitools.ausvet.com.au accessed on 12 December 2023). EpiTools was additionally used to compare the different estimated pooled prevalence based on the sampling site and genera of ticks.

3. Results

3.1. Tick Sampling and Identification

A total of 304 ticks were collected from the two (2) sampling areas (Neudamm—204 ticks; and Ovitoto—100 ticks). After identification up to the genus level using morphological keys [30], the ticks were subsequently pooled into a total of 76 pools based on the sampling area and genus. There were 51 pools from Neudamm and 25 pools from Ovitoto, of which 70 were of Hyalomma species and the remaining six (6) were of Rhipicephalus species.

3.2. Rickettsia Screening and Identification

During the initial screening for Rickettsia, an overall MIR of 8.6% (26/304) was observed. When segregated by sampling area, the MIR were 8.82% (18/204) and 8% (8/100) for Neudamm and Ovitoto, respectively. When segregated by tick genus, the MIR for Hyalomma ticks was 8.57% (24/280), whereas that for Rhipicephalus was 8.33% (2/24). On statistical analysis, the overall pooled prevalence was determined as 9.94% (95% CI: 6.5–14.3), with the regional pooled prevalences of 10.31% (95% CI: 6.15–15.88) and 9.91% (95% CI: 3.97–17.42) for Neudamm and Ovitoto, respectively. When segregated by genera, the estimated pooled prevalence for Hyalomma ticks was 9.96% (95% CI: 6.43–14.52), whereas that for the Rhipicephalus genus was 9.64% (95% CI: 1.1–31.3). The differences in estimated prevalence when compared across sampling sites and tick genera were not statistically significant (p = 0.91 and p = 0.96, respectively).
A random selection of 14 Rickettsia-positive pools was chosen for amplification and sequencing using the near-full-length genes of the ompA and gltA. Twelve of the samples were successfully sequenced based on the gltA gene (1054–1647 bp), whereas nine (9) of the samples were successfully sequenced based on the ompA gene (2912 bp). Standard nucleotide BLAST analysis of the obtained gltA sequences showed high similarity to R. aeaschlimannii (91.7%; 11/12) and R. africae (8.3%; 1/12), with sequence identity ranging from 99 to 100% (Table 2). Based on the ompA sequence BLAST analysis, R. aeschlimannii constituted 77.8% (7/9), with the rest (22.2%; 2/9) being R. africae with sequence identity ranging from 98.5 to 99.9%.
Further, phylogenetic analysis of the gltA gene (1078 bp) (Figure 2) and ompA gene (2912 bp) (Figure 3) revealed a close clustering of sequences based on species. Eleven sequences from Namibia closely clustered with R. aeschlimannii (accession number HQ335153), whereas one (1) exhibited close clustering with R. africae (accession number KX 819298) when considering the gltA gene (Figure 2). Similarly, considering the ompA gene, seven (7) and two (2) Namibian sequences closely clustered with R. aeschlimannii (accession number U83446) and R. africae (accession number U83436), respectively. There was agreement in species identity between the gltA and ompA sequences in all the samples (n = 8) that were successfully sequenced for both genes. Four (4) samples were successfully sequenced using only the gltA gene and not the ompA gene.

4. Discussion

In this study, we sought to investigate the presence of Rickettsia species in Ixodid ticks collected from cattle in two regions of Namibia. To the best of our knowledge, this is the first study to screen for Rickettsia species in ticks in Namibia, despite previous evidence of human exposure to this bacterium [28]. The only other study that sought to screen for Rickettsia species in Namibia was based on screening small mammals, and no molecular evidence of the pathogen was reported in that study [29]. The lack of previous studies on Rickettsia in ticks in Namibia is in contrast to the global trend, where studies on Rickettsia predominantly focus on ticks rather than on animals or humans [21]. Within sub-Saharan Africa, Rickettsia species have been reported in Amblyomma, Hyalomma, and Rhipicephalus tick species, with Amblyomma and Hyalomma considered the principal vectors [13]. In our study, the overall MIR was 8.6%, which is within the prevalence range (3–77%) reported in other studies on ticks conducted in countries bordering Namibia [25,26,27,36,37,38,39,40], with the variability hypothesized to be due to factors such as ecological differences (biotic and abiotic) in different locations [41]. The detection of Rickettsia species in ticks from our study, coupled with the serological evidence of exposure to SFGR in humans [28] and molecular reports of the pathogen in hyenas [42], indicates the existence of transmission cycles of Rickettsia species in the country.
While Amblyomma and Hyalomma tick species are considered the main vectors of Rickettsia species, with relatively higher infection rates than those observed in Rhipicephalus [13], in our study, the estimated pooled prevalence between Hyalomma and Rhipicephalus species was comparable and not statistically significant. Infections in Rhipicephalus species are generally considered to be concomitant or through co-feeding and/or feeding on a bacterial host [36,43]. Considering that the Rhipicephalus ticks sampled in our study were collected from cattle with co-infestations with Hyalomma ticks, this could explain the similarity in infection rates between the two tick species. However, it should also be noted that there are some reports that highlight the role of Rhipicephalus tick species as efficient vectors of Rickettsia species, with evidence of transovarial transmission also occurring in this tick genus [44,45]. This shows that there is still much more to learn about the vector–pathogen role and interactions in order to fully elucidate the transmission dynamics of tick-borne Rickettsial pathogens.
Within the southern African region, various tick species have been shown to harbor Rickettsia species at varying prevalence levels, and these include Hyalomma marginatum rufipes, Hyalomma trancatum, Rhipicephalus appendiculatus, Rhipicephalus decoloratus, and Rhipicephalus evertsi evertsi [24,27,37,46,47]. Our current study, however, did not specify the ticks sampled; thus, we recommend that future studies in the country show the prevalence of different tick species, as this will allow for a better understanding of the epidemiology of Rickettsia species in the region. This is especially important, as genetic differences in vectors are known to influence their vector competence [48]; thus, the relative importance of each tick species in the epidemiology of any specified pathogen.
There were no statistically significant differences between the infection rates of ticks collected from the two regions. This could be explained by the fact that the ecological settings of the two regions are similar, both being dry to arid regions, with a predominance of cattle being the main hosts for ticks. Differences in land use, climate, and environmental conditions are commonly considered factors that influence the prevalence of tick-borne pathogens [49,50], and these factors being similar in the two study sites could explain the observed similarity.
The speciation of Rickettsia species is generally based on multilocus sequencing and the agreement of a number of genes [11] or sequencing of long fragments of genes [51]. In our study, we amplified and sequenced near-full-length fragments of the ompA and gltA genes for speciation, thus giving us confidence in our sequence identities for those samples on which both genes were sequenced and had agreement on sequence identity for both genes. Based on the agreement in sequence identity on BLAST for the ompA and gltA genes, we report the presence of R. aeschlimannii and R. africae in Ixodid ticks in Namibia. Our study reports, for the first time, the molecular evidence of R. africae and R. aeschlimannii in Namibia, further showing the expanded geographical range of this bacteria. There was a significantly higher proportion of R. aeschlimannii in our study in comparison to R. africae, which could be due to the predominance of Hyalomma tick species, which are generally considered to be the principal vector for R. aeschlimannii [13].
In our study, there was a failure of amplification, and thus, there was no subsequent sequence analysis of the four (4) samples based on the ompA gene, despite these samples being successfully amplified and sequenced based on the gltA gene. It is thus possible that these samples which could not be sequenced on the ompA gene belong to a different genotype that could not be detected through this gene, as has previously been reported [52]. As such, we could not conclusively speciate these Rickettsia species, as we only had one sequence, thus not meeting the threshold for multilocus sequencing required for Rickettsia species [11]. It is recommended that future studies explore more genes than the two used in our study in order to allow for the speciation of all positive samples.
Rickettsial infections are common causes of acute febrile illnesses in travelers to sub-Saharan African regions [53]. Evidence of human infection by Rickettsia species has been reported in Namibia since 1986 [54], with serological evidence in the local population. Subsequent reports of human infections in the country were based on reports from international travelers [22,55]. In none of the reported human cases was the Rickettsia species responsible for the infection reported, leaving a gap in knowledge regarding the infective species circulating in the country. Both Rickettsia species reported in our study are human infective; therefore, the results of this study highlight the risk of human infection by these rickettsial pathogens in Namibia. There exists a possibility that the previously reported human cases could have been the result of either of the pathogens reported in our study. Reports of human infection with R. africae date as far back as the 1930s [56], even though the naming of the infectious agent was only confirmed in 1996 [57]. R. aeschlimannii is a more recently reported zoonotic pathogen, which was first reported in a traveler from Morocco [58], and since then, there have been several reports of human infections [59,60,61], further confirming the zoonotic potential of this bacteria. Considering the apparent circulation of these pathogens in farming communities, as well as the fact that infections result in non-specific febrile illnesses, it is important to consider Rickettsia species as a possible causal agent in patients showing such clinical signs.

5. Conclusions

We report the detection of R. africae and R. aeschlimannii in Ixodid ticks from two regions of Namibia. Our study is the first in the country to conduct a molecular survey of Rickettsia species in ticks and adds to the growing body of knowledge on the epidemiology of Rickettsia species in the region. The Rickettsia species identified in our study are both known to be zoonotic, which indicates a threat of infection to humans from these bacteria. Thus, there is a need for more epidemiological surveys to fully understand the epidemiology of these tick-borne bacteria in the country, including aspects such as determining if there is a clustering of pathogens by the host animal and/or sampling farms, surveys to define the relative importance of each tick species in the transmission of the pathogens, as well as to determine if there are other zoonotic Rickettsia species in circulation. There is considerable habitat sharing between humans and ticks, a factor that makes it very challenging to avoid contact with ticks. This highlights the importance of awareness campaigns on the public health significance of Rickettsia and tick-borne pathogens. Knowledge and understanding of the key human behaviors that increase the risk of contact with ticks and potential exposure to Rickettsia species is necessary at a localized level in order to design control programs for communities.

Author Contributions

Conceptualization, B.H.N., K.C., P.C., S.W., E.N. and S.C.; sample collection, P.M., O.C.M. and S.C.; development of laboratory methods, W.M., K.C., E.N. and S.C.; laboratory analysis, P.M., O.C.M., L.M., A.D., C.M. and S.C.; supervision, S.W., E.N. and S.C.; writing—original draft, P.M., W.M., E.N. and S.C.; data analysis, all authors; writing—review and editing, all authors. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported in part by the National Institute of Allergy and Infectious Diseases of the National Institutes of Health ‘Spatial eco-epidemiology of tick-borne rickettsial pathogens’ under award number R01AI136035 [PI–Gaff H] through a sub-award to the University of Zambia [PI–Chitanga S]; the German Ministry of Health through a grant to Robert Koch Institute in the framework of the Global Health Protection Programme (ZM I5-2520GHP703); Faculty of Health Sciences and Veterinary Medicine seed corn grant. The funders had no role in the study design, data collection, and interpretation.

Institutional Review Board Statement

The study was approved by the following bodies; Faculty of Health and Applied Sciences Research Ethics Committee at the Namibia University of Science and Technology NUST) (FHAS 24/2021) and the University of Namibia Decentralized Ethics Committee reference number NEC0018.

Informed Consent Statement

Informed consent was obtained from the farmers allowing for the collection of tick samples from the livestock.

Data Availability Statement

Data are contained in the article as the sequences are available on GenBank.

Acknowledgments

We acknowledge the assistance of the farmers and the veterinary paraprofessionals who assisted us with the sample collection. We also acknowledge Birgit Arnold for logistics and administrative support.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Piotrowski, M.; Rymaszewska, A. Expansion of Tick-Borne Rickettsioses in the World. Microorganisms 2020, 8, 1906. [Google Scholar] [CrossRef] [PubMed]
  2. Sonenshine, D.E. Range Expansion of Tick Disease Vectors in North America: Implications for Spread of Tick-Borne Disease. Int. J. Environ. Res. Public Health 2018, 15, 478. [Google Scholar] [CrossRef]
  3. Merhej, V.; Angelakis, E.; Socolovschi, C.; Raoult, D. Genotyping, evolution and epidemiological findings of Rickettsia species. Infect. Genet. Evol. 2014, 25, 122–137. [Google Scholar] [CrossRef] [PubMed]
  4. Pfäffle, M.; Littwin, N.; Muders, S.V.; Petney, T.N. The ecology of tick-borne diseases. Int. J. Parasitol. 2013, 43, 1059–1077. [Google Scholar] [CrossRef]
  5. Kong, Y.; Zhang, G.; Jiang, L.; Wang, P.; Zhang, S.; Zheng, X.; Li, Y. Metatranscriptomics Reveals the Diversity of the Tick Virome in Northwest China. Microbiol. Spectr. 2022, 10, e0111522. [Google Scholar] [CrossRef]
  6. Tijsse-Klasen, E.; Koopmans, M.P.; Sprong, H. Tick-borne pathogen—Reversed and conventional discovery of disease. Front. Public Health 2014, 2, 73. [Google Scholar] [CrossRef]
  7. Raoult, D.; Roux, V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin. Microbiol. Rev. 1997, 10, 694–719. [Google Scholar] [CrossRef] [PubMed]
  8. Weinert, L.A.; Werren, J.A.; Aebi, A.; Stone, G.N.; Jiggins, F.M. Evolution and diversity of Rickettsiabacteria. BMC Biol. 2009, 7, 6. [Google Scholar] [CrossRef] [PubMed]
  9. Chaparro-Gutiérrez, J.J.; Acevedo-Gutiérrez, L.Y.; Mendell, N.L.; Robayo-Sánchez, L.N.; Rodríguez-Durán, A.; Cortés-Vecino, J.A.; Fernández, D.; Ramírez-Hernández, A.; Bouyer, D.H. First isolation of Rickettsia amblyommatis from Amblyomma mixtum in Colombia. Parasit. Vectors 2023, 16, 332. [Google Scholar] [CrossRef]
  10. Fang, R.; Blanton, L.S.; Walker, D.H. Rickettsiae as Emerging Infectious Agents. Clin. Lab. Med. 2017, 37, 383–400. [Google Scholar] [CrossRef]
  11. Fournier, P.E.; Dumler, J.S.; Greub, G.; Zhang, J.; Wu, Y.; Raoult, D. Gene sequence-based criteria for identification of new rickettsia isolates andnov description of Rickettsia heilongjiangensis sp. J. Clin. Microbiol. 2003, 41, 5456–5465. [Google Scholar] [CrossRef] [PubMed]
  12. Fournier, P.E.; Raoult, D. Current knowledge on phylogeny and taxonomy of Rickettsia spp. Ann. N. Y. Acad. Sci. 2009, 1166, 1–11. [Google Scholar] [CrossRef] [PubMed]
  13. Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.E.; et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [PubMed]
  14. Parola, P.; Paddock, C.D.; Raoult, D. Tick-borne rickettsioses around the world: Emerging diseases challenging old concepts. Clin. Microbiol. Rev. 2005, 18, 719–756. [Google Scholar] [CrossRef] [PubMed]
  15. Jia, N.; Jiang, J.F.; Huo, Q.B.; Jiang, B.G.; Cao, W.C. Rickettsia sibirica subspecies sibirica BJ-90 as a cause of human disease. N. Engl. J. Med. 2013, 369, 1176–1178. [Google Scholar] [CrossRef] [PubMed]
  16. Satjanadumrong, J.; Robinson, M.T.; Hughes, T.; Blacksell, S.D. Distribution and Ecological Drivers of Spotted Fever Group Rickettsia in Asia. Ecohealth 2019, 16, 611–626. [Google Scholar] [CrossRef] [PubMed]
  17. Chao, L.L.; Erazo, E.; Robinson, M.; Liang, Y.F.; Shih, C.M. First detection and molecular identification of a pathogenic spotted fever group Rickettsia, R. massiliae, from Rhipicephalus haemaphysaloides ticks infesting dogs in southern Taiwan. Acta Trop. 2022, 236, 106666. [Google Scholar] [CrossRef] [PubMed]
  18. Horta, M.C.; Pinter, A.; Schumaker, T.T.; Labruna, M.B. Natural infection, transovarial transmission, and transstadial survival of Rickettsia bellii in the Tick Ixodes loricatus (Acari: Ixodidae) from Brazil. Ann. N. Y. Acad. Sci. 2006, 1078, 285–290. [Google Scholar] [CrossRef] [PubMed]
  19. Socolovschi, C.; Huynh, T.P.; Davoust, B.; Gomez, J.; Raoult, D.; Parola, P. Transovarial and trans-stadial transmission of Rickettsiae africae in Amblyomma variegatum ticks. Clin. Microbiol. Infect. 2009, 15 (Suppl. S2), 317–318. [Google Scholar] [CrossRef]
  20. Azad, A.F.; Beard, C.B. Rickettsial pathogens and their arthropod vectors. Emerg. Infect. Dis. 1998, 4, 179–186. [Google Scholar] [CrossRef]
  21. Zhang, Y.Y.; Sun, Y.Q.; Chen, J.J.; Teng, A.Y.; Wang, T.; Li, H.; Hay, S.I.; Fang, L.Q.; Yang, Y.; Liu, W. Mapping the global distribution of spotted fever group rickettsiae: A systematic review with modelling analysis. Lancet Digit. Health 2023, 5, e5–e15. [Google Scholar] [CrossRef] [PubMed]
  22. Jensenius, M.; Fournier, P.E.; Vene, S.; Hoel, T.; Hasle, G.; Henriksen, A.Z.; Hellum, K.B.; Raoult, D.; Myrvang, B. African tick bite fever in travelers to rural sub-Equatorial Africa. Clin. Infect. Dis. 2003, 36, 1411–1417. [Google Scholar] [CrossRef] [PubMed]
  23. Bitam, I. Vectors of rickettsiae in Africa. Ticks Tick Borne Dis. 2012, 3, 382–386. [Google Scholar] [CrossRef] [PubMed]
  24. Pillay, A.; Manyangadze, T.; Mukaratirwa, S. Prevalence of Rickettsia africae in tick vectors collected from mammalian hosts in sub-Saharan Africa: A systematic review and meta-analysis. Ticks Tick Borne Dis. 2022, 13, 101960. [Google Scholar] [CrossRef] [PubMed]
  25. Chitanga, S.; Chibesa, K.; Sichibalo, K.; Mubemba, B.; Nalubamba, K.S.; Muleya, W.; Changula, K.; Simulundu, E. Molecular detection and characterization of Rickettsia species in Ixodid ticks collected from cattle in southern Zambia. Front. Vet. Sci. 2021, 8, 684487. [Google Scholar] [CrossRef] [PubMed]
  26. Phiri, B.S.J.; Kattner, S.; Chitimia-Dobler, L.; Woelfel, S.; Albanus, C.; Dobler, G.; Küpper, T. Rickettsia spp. in Ticks of South Luangwa Valley, Eastern Province, Zambia. Microorganisms, 2023; 11, 167. [Google Scholar] [CrossRef]
  27. Qiu, Y.; Simuunza, M.; Kajihara, M.; Ndebe, J.; Saasa, N.; Kapila, P.; Furumoto, H.; Lau, A.C.C.; Nakao, R.; Takada, A.; et al. Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia-Angola Border. Pathogens 2022, 11, 566. [Google Scholar] [CrossRef] [PubMed]
  28. Noden, B.H.; Tshavuka, F.I.; van der Colf, B.E.; Chipare, I.; Wilkinson, R. Exposure and risk factors to coxiella burnetii, spotted fever group and typhus group Rickettsiae, and Bartonella henselae among volunteer blood donors in Namibia. PLoS ONE 2014, 9, e108674. [Google Scholar] [CrossRef] [PubMed]
  29. Essbauer, S.; Hofmann, M.; Kleinemeier, C.; Wolfel, S.; Matthee, S. Rickettsia diversity in southern Africa: A small mammal perspective. Ticks Tick Borne Dis. 2018, 9, 288–301. [Google Scholar] [CrossRef]
  30. Walker, A.R.; Bouattour, A.; Camicas, J.L.; Estrada-Pena, A.; Horak, I.G.; Latif, A.A.; Pegram, R.G.; Preston, P.M. Ticks of Domestic Animals in Africa: A Guide to Identification of Species; Bioscience Reports; The University of Edinburgh: Edinburgh, UK, 2003. [Google Scholar]
  31. Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. Available online: https://github.com/ablab/spades (accessed on 12 January 2024). [CrossRef]
  32. Tamura, K. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+C-content biases. Mol. Biol. Evol. 1992, 9, 678–687. [Google Scholar] [CrossRef]
  33. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  34. Burket, C.T.; Vann, C.N.; Pinger, R.R.; Chatot, C.L.; Steiner, F.E. Minimum infection rate of Ambylomma americanum (Acari: Ixodidae) by Ehrlichia chaffeensis (Rickettsiales: Ehrlichieae) in southern Indiana. J. Med. Entomol. 1998, 35, 653–659. [Google Scholar] [CrossRef] [PubMed]
  35. Sergeant, E.S.G. EpiTools Epidemiological Calculators. Ausvet. 2018. Available online: http://epitools.ausvet.com.au (accessed on 12 December 2023).
  36. Portillo, A.; Perez-Martinez, L.; Santibanez, S.; Blanco, J.R.; Ibarra, V.; Oteo, J.A. Detection of Rickettsia africae in Rhipicephalus (Boophilus) decoloratus ticks from the Republic of Botswana, South Africa. Am. J. Trop. Med. Hyg. 2007, 77, 376–377. [Google Scholar] [CrossRef] [PubMed]
  37. Iweriebor, B.C.; Nqoro, A.; Obi, C.L. Rickettsia africae an Agent of African Tick Bite Fever in Ticks Collected from Domestic Animals in Eastern Cape, South Africa. Pathogens 2020, 9, 631. [Google Scholar] [CrossRef] [PubMed]
  38. Mazhetese, E.; Lukanji, Z.; Byaruhanga, C.; Neves, L.; Morar-Leather, D. Rickettsia africae infection rates and transovarial transmission in Amblyomma hebraeum ticks in Mnisi, Bushbuckridge, South Africa. Exp. Appl. Acarol. 2022, 86, 407–418. [Google Scholar] [CrossRef] [PubMed]
  39. Thekisoe, O.; Ramatla, T.; Ringo, A.; Mnisi, S.; Mphuthi, N.; Mofokeng, L.; Lekota, K.; Xuan, X. Molecular detection of Rickettsia africae from Amblyomma hebraeum ticks in Mafikeng city of North West Province, South Africa. Res. Vet. Sci. 2023, 164, 105027. [Google Scholar] [CrossRef] [PubMed]
  40. Barradas, P.F.; Mesquita, J.R.; Ferreira, P.; Gärtner, F.; Carvalho, M.; Inácio, E.; Chivinda, E.; Katimba, A.; Amorim, I. Molecular identification and characterization of Rickettsia spp. and other tick-borne pathogens in cattle and their ticks from Huambo, Angola. Ticks Tick Borne Dis. 2021, 12, 101583. [Google Scholar] [CrossRef] [PubMed]
  41. Corrigan, J.; Marion, B.; English, J.; Eneku, W.; Weng, J.L.; Rugg, M.; Dotrang, T.; Dunford, J.; Byaruhanga, A.M.; Byarugaba, D.K.; et al. Minimal Rickettsial Infection Rates and Distribution of Ticks in Uganda: An Assessment of the Seasonal Effects and Relevance to Tick-Borne Disease Risk in East Africa. J. Med. Entomol. 2023, 60, 185–192. [Google Scholar] [CrossRef] [PubMed]
  42. Krücken, J.; Czirják, G.; Ramünke, S.; Serocki, M.; Heinrich, S.K.; Melzheimer, J.; Costa, M.C.; Hofer, H.; Aschenborn, O.H.K.; Barker, N.A.; et al. Genetic diversity of vector-borne pathogens in spotted and brown hyenas from Namibia and Tanzania relates to ecological conditions rather than host taxonomy. Parasit. Vectors 2021, 14, 328. [Google Scholar] [CrossRef]
  43. Mediannikov, O.; Diatta, G.; Zolia, Y.; Balde, M.C.; Kohar, H.; Trape, J.F.; Raoult, D. Tick-borne rickettsiae in Guinea and Liberia. Ticks Tick Borne Dis. 2012, 3, 43–48. [Google Scholar] [CrossRef]
  44. Cordeiro, M.D.; de Azevedo Baêta, B.; Cepeda, P.B.; Teixeira, R.C.; Ribeiro, C.; de Almeida Valim, J.R.; Pinter, A.; da Fonseca, A.H. Experimental infection of Rickettsia parkeri in the Rhipicephalus microplus tick. Ticks Tick Borne Dis. 2018, 9, 93–96. [Google Scholar] [CrossRef] [PubMed]
  45. Olivieri, E.; Wijnveld, M.; Bonga, M.; Berger, L.; Manfredi, M.T.; Veronesi, F.; Jongejan, F. Transmission of Rickettsia raoultii and Rickettsia massiliae DNA by Dermacentor reticulatus and Rhipicephalus sanguineus (s.l.) ticks during artificial feeding. Parasit. Vectors 2018, 11, 494. [Google Scholar] [CrossRef] [PubMed]
  46. Palomar, A.M.; Molina, I.; Bocanegra, C.; Portillo, A.; Salvador, F.; Moreno, M.; Oteo, J.A. Old zoonotic agents and novel variants of tick-borne microorganisms from Benguela (Angola), July 2017. Parasit. Vectors 2022, 15, 140. [Google Scholar] [CrossRef] [PubMed]
  47. Mahlobo-Shwabede, S.I.C.; Zishiri, O.T.; Thekisoe, O.M.M.; Makalo, M.J.R. Molecular Detection of Coxiella burnetii, Rickettsia africae and Anaplasma Species in Ticks from Domestic Animals in Lesotho. Pathogens 2021, 10, 1186. [Google Scholar] [CrossRef] [PubMed]
  48. Beerntsen, B.T.; James, A.A.; Christensen, B.M. Genetics of mosquito vector competence. Microbiol. Mol. Biol. Rev. 2000, 64, 115–137. [Google Scholar] [CrossRef] [PubMed]
  49. Medlock, J.M.; Hansford, K.M.; Bormane, A.; Derdakova, M.; Estrada-Peña, A.; George, J.C.; Golovljova, I.; Jaenson, T.G.; Jensen, J.K.; Jensen, P.M.; et al. Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe. Parasit. Vectors 2013, 6, 1. [Google Scholar] [CrossRef] [PubMed]
  50. Clay, K.; Fuqua, C. The Tick Microbiome: Diversity, Distribution and Influence of the Internal Microbial Community for a Blood-Feeding Disease Vector. Critical Needs and Gaps in Understanding Prevention, Amelioration and Resolution of Lyme and Other Tick-Borne Diseases: The Short-Term and Long-Term Outcomes; Institute of Medicine Committee on Lyme Disease and Other Tick-Borne Diseases: The State of the Science: Washington DC, USA, 2010; pp. 1–22. [Google Scholar]
  51. Moron, C.G.; Bouyer, D.H.; Yu, X.J.; Foil, L.D.; Crocquet-Valdes, P.; Walker, D.H. Phylogenetic analysis of the rompB genes of Rickettsia felis and Rickettsia prowazekii European-human and North American flying-squirrel strains. Am. J. Trop. Med. Hyg. 2000, 62, 598–603. [Google Scholar] [CrossRef]
  52. Ishikura, M.; Ando, S.; Shinagawa, Y.; Matsuura, K.; Hasegawa, S.; Nakayama, T.; Fujita, H.; Watanabe, M. Phylogenetic analysis of spotted fever group rickettsiae based on gltA, 17-kDa, and rOmpA genes amplified by nested PCR from ticks in Japan. Microbiol. Immunol. 2003, 47, 823–832. [Google Scholar] [CrossRef]
  53. Freedman, D.O.; Weld, L.H.; Kozarsky, P.E.; Fisk, T.; Robins, R.; von Sonnenburg, F.; Keystone, J.S.; Pandey, P.; Cetron, M.S. Spectrum of disease and relation to place of exposure among ill returned travelers. N. Engl. J. Med. 2006, 354, 119–130. [Google Scholar] [CrossRef]
  54. Wessels, G.; Hesseling, P.B.; Cooper, R.C. Q-fever, OX19, OX2 and leptospirosis antibodies in patients with onyalai and in negroid, bushman and white inhabitants of Kavango, Namibia. Trans. R. Soc. Trop. Med. Hyg. 1986, 80, 847–848. [Google Scholar] [CrossRef]
  55. Méchaï, F.; Han, Y.; Gachot, B.; Consigny, P.H.; Viard, J.P.; Lecuit, M.; Lortholary, O. Pristinamycin for Rickettsia africae infection. J. Travel. Med. 2009, 16, 136–137. [Google Scholar] [CrossRef]
  56. Pijper, A. Tick-bite fever: A clinical lecture. S. Afr. Med. J. 1934, 8, 551–556. [Google Scholar]
  57. Kelly, P.J.; Beati, L.; Mason, P.R.; Matthewman, L.A.; Roux, V.; Raoult, D. Rickettsia africae sp. nov., the etiological agent of African tick bite fever. Int. J. Syst. Bacteriol. 1996, 46, 611–614. [Google Scholar] [CrossRef]
  58. Raoult, D.; Fournier, P.E.; Abboud, P.; Caron, F. First documented human Rickettsia aeschlimannii infection. Emerg. Infect. Dis. 2002, 8, 748–749. [Google Scholar] [CrossRef]
  59. Mokrani, N.; Parola, P.; Tebbal, S.; Dalichaouche, M.; Aouati, A.; Raoult, D. Rickettsia aeschlimannii infection, Algeria. Emerg. Infect. Dis. 2008, 14, 1814–1815. [Google Scholar] [CrossRef]
  60. Germanakis, A.; Chochlakis, D.; Angelakis, E.; Tselentis, Y.; Psaroulaki, A. Rickettsia aeschlimannii Infection in a Man, Greece. Emerg. Infect. Dis. 2013, 19, 1176–1177. [Google Scholar] [CrossRef]
  61. Igolkina, Y.; Rar, V.; Krasnova, E.; Filimonova, E.; Tikunov, A.; Epikhina, T.; Tikunova, N. Occurrence and clinical manifestations of tick-borne rickettsioses in Western Siberia: First Russian cases of Rickettsia aeschlimannii and Rickettsia slovaca infections. Ticks Tick Borne Dis. 2022, 13, 101927. [Google Scholar] [CrossRef]
Microorganisms 12 00912 g001
Figure 1. Map of Namibia showing the study sites; Ovitoto village in Otjozondjupa region and Neudamm farm in Khomas region.
Figure 1. Map of Namibia showing the study sites; Ovitoto village in Otjozondjupa region and Neudamm farm in Khomas region.
Microorganisms 12 00912 g001
Microorganisms 12 00912 g002
Figure 2. Maximum likelihood phylogenetic tree of Rickettsia spp. based on 1070 bp nucleotide sequences of the gltA gene. The tree was constructed using the Tamura-3 parameter + invariable sites model with 1000 bootstrap replicates as a confidence interval using MEGA XI. Bootstrap values less than 75% are not shown. Sequences from Namibia collected from ticks are highlighted in purple and have the prefix “Nam”.
Figure 2. Maximum likelihood phylogenetic tree of Rickettsia spp. based on 1070 bp nucleotide sequences of the gltA gene. The tree was constructed using the Tamura-3 parameter + invariable sites model with 1000 bootstrap replicates as a confidence interval using MEGA XI. Bootstrap values less than 75% are not shown. Sequences from Namibia collected from ticks are highlighted in purple and have the prefix “Nam”.
Microorganisms 12 00912 g002
Microorganisms 12 00912 g003
Figure 3. Phylogenetic tree for Rickettsia spp. generated using maximum likelihood analysis, utilizing 3170 base pair nucleotide sequences from the ompA gene. The Tamura-3 parameter + invariable sites model was employed for tree construction, incorporating 1000 bootstrap replicates as a confidence interval within MEGA XI. Bootstrap values below 75% are not displayed. Sequences from ticks collected in Namibia are highlighted in brown and have the prefix “Nam” in the tree.
Figure 3. Phylogenetic tree for Rickettsia spp. generated using maximum likelihood analysis, utilizing 3170 base pair nucleotide sequences from the ompA gene. The Tamura-3 parameter + invariable sites model was employed for tree construction, incorporating 1000 bootstrap replicates as a confidence interval within MEGA XI. Bootstrap values below 75% are not displayed. Sequences from ticks collected in Namibia are highlighted in brown and have the prefix “Nam” in the tree.
Microorganisms 12 00912 g003
Table 1. List of primer names and sequences used in this study.
Table 1. List of primer names and sequences used in this study.
Primer NamePrimer SequenceTarget Gene
Rick_ompB_2GGTGTAGGAACAATAGACTTompB 1
Rick_ompB_R2ATCTACGCTAACAACAAAT
Rick_gltA_F1TGCGGAAGCCGATTGCTTTAgltA 2
Rick_gltA_R3ATCCAGCCTACGGTTCTTGC
Rick_ompA_F1ACGGACCTCTTGATGGTGGTompA 3
Rick_ompA_R6CCATTGCGTAAAGCTCAGGTG
1 Outer membrane protein B; 2 citrate synthase; 3 outer membrane protein A.
Table 2. Table of sequence identity for samples sequenced in this study.
Table 2. Table of sequence identity for samples sequenced in this study.
Sample IDOuter Membrane Protein A (ompA) GeneCitrate Synthase (gltA) Gene
BLAST ResultAccession Number% IdentityFragment Length (bp)BLAST ResultAccession Number% IdentityFragment Length (bp)
T176R. aeschlimanniiOR68703299.92896R. aeschlimanniiOR68702399.911064
T177R. africaeCP00161298.922871R. africaeHQ33512699.911056
T189R. aeschlimanniiOR68703299.92900R. aeschlimanniiOR68702399.911054
T198R. aeschlimanniiOR68703299.552889R. aeschlimanniiHQ3351531001057
T200R. aeschlimanniiOR68703299.722890R. aeschlimanniiOR68702399.91048
T201R. aeschlimanniiOR68703299.552891R. aeschlimanniiHQ3351531001058
T281 R. aeschlimanniiOR68702399.91277
T282R. aeschlimanniiOR68703299.932966R. aeschlimanniiOR68702399.911185
T285 R. aeschlimanniiOR68702399.911245
T286 R. aeschlimanniiOR68702399.911465
T287R. africaeCP00161299.242968
T294R. aeschlimanniiOR68703299.623065R. aeschlimanniiHQ3351531001647
T296 R. aeschlimanniiHQ33515399.911073
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mbiri, P.; Matomola, O.C.; Muleya, W.; Mhuulu, L.; Diegaardt, A.; Noden, B.H.; Changula, K.; Chimwamurombe, P.; Matos, C.; Weiss, S.; et al. Molecular Detection and Characterization of Rickettsia Species in Ixodid Ticks from Selected Regions of Namibia. Microorganisms 2024, 12, 912. https://doi.org/10.3390/microorganisms12050912

AMA Style

Mbiri P, Matomola OC, Muleya W, Mhuulu L, Diegaardt A, Noden BH, Changula K, Chimwamurombe P, Matos C, Weiss S, et al. Molecular Detection and Characterization of Rickettsia Species in Ixodid Ticks from Selected Regions of Namibia. Microorganisms. 2024; 12(5):912. https://doi.org/10.3390/microorganisms12050912

Chicago/Turabian Style

Mbiri, Pricilla, Ophelia Chuma Matomola, Walter Muleya, Lusia Mhuulu, Azaria Diegaardt, Bruce Howard Noden, Katendi Changula, Percy Chimwamurombe, Carolina Matos, Sabrina Weiss, and et al. 2024. "Molecular Detection and Characterization of Rickettsia Species in Ixodid Ticks from Selected Regions of Namibia" Microorganisms 12, no. 5: 912. https://doi.org/10.3390/microorganisms12050912

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop