Next Article in Journal
Biochemical Responses in Populus tremula: Defending against Sucking and Leaf-Chewing Insect Herbivores
Previous Article in Journal
Optimizing the Mulching Pattern and Nitrogen Application Rate to Improve Maize Photosynthetic Capacity, Yield, and Nitrogen Fertilizer Utilization Efficiency
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Plants
Volume 13
Issue 9
10.3390/plants13091242
plants-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

MicroRNA164 Affects Plant Responses to UV Radiation in Perennial Ryegrass

by
Chang Xu
1,
Xin Huang
1,
Ning Ma
1,
Yanrong Liu
1,
Aijiao Xu
1,
Xunzhong Zhang
2,
Dayong Li
3,
Yue Li
1,
Wanjun Zhang
1,* and
Kehua Wang
1,*
1
College of Grassland Science and Technology, China Agricultural University, Beijing 100193, China
2
School of Plant and Environmental Sciences, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA
3
Beijing Academy of Agriculture and Forestry Sciences, Beijing 100097, China
*
Authors to whom correspondence should be addressed.
Plants 2024, 13(9), 1242; https://doi.org/10.3390/plants13091242
Submission received: 20 March 2024 / Revised: 22 April 2024 / Accepted: 23 April 2024 / Published: 30 April 2024
(This article belongs to the Topic Plant Responses to Environmental Stress)
Browse Figures
Review Reports Versions Notes

Abstract

:
Increasing the ultraviolet radiation (UV) level, particularly UV-B due to damage to the stratospheric ozone layer by human activities, has huge negative effects on plant and animal metabolism. As a widely grown cool-season forage grass and turfgrass in the world, perennial ryegrass (Lolium perenne) is UV-B-sensitive. To study the effects of miR164, a highly conserved microRNA in plants, on perennial ryegrass under UV stress, both OsmiR164a overexpression (OE164) and target mimicry (MIM164) transgenic perennial ryegrass plants were generated using agrobacterium-mediated transformation, and UV-B treatment (~600 μw cm−2) of 7 days was imposed. Morphological and physiological analysis showed that the miR164 gene affected perennial ryegrass UV tolerance negatively, demonstrated by the more scorching leaves, higher leaf electrolyte leakage, and lower relative water content in OE164 than the WT and MIM164 plants after UV stress. The increased UV sensitivity could be partially due to the reduction in antioxidative capacity and the accumulation of anthocyanins. This study indicated the potential of targeting miR164 and/or its targeted genes for the genetic manipulation of UV responses in forage grasses/turfgrasses; further research to reveal the molecular mechanism underlying how miR164 affects plant UV responses is needed.

1. Introduction

Ultraviolet radiation (UV) from the sun is divided into UV-A (400–320 nm), UV-B (320–280 nm), and UV-C (280–200 nm) according to the wavelength and biological effects. Although most higher plants and fungi would be damaged almost immediately from UV-C radiation, experiments show that if the amount of atmospheric ozone in the ozone layer reaches just 10% of the current level, it can still absorb all UV-C from the sun. UV-A radiation is basically harmless to plants, and even plays a regulatory role in the activities of plant life; however, despite the strong absorption of atmospheric ozone, there is still about 10% of UV-B radiation that reaches the ground. Its effect on plants is between UV-C and UV-A, and includes affecting plant growth and development and causing stress to plants [1]. Moreover, ozone depletion due to human activities resulted in an overall annual increase from 2 to 6% above the 1970–1980 UV levels after the 1990s, and this level will continue to increase in the future. This may pose a big threat to human health and global agricultural security as well [2,3].
As sessile organisms, plants have formed a series of morphological, physiological, biochemical, and molecular responses to adapt to different environmental changes during the long-term evolution process, including increased UV radiation. For instance, plants can adopt a number of protective strategies via the specific UV-B signaling pathways mediated by the UVR8 (UV RESISTANCE LOCUS 8) photoreceptor, such as increased leaf thickness, biosynthesis of UV-B reflective substances, increased antioxidants, and changes in UV-B-absorbing secondary metabolites at the cellular level [4,5,6]. By studying the different responses of plants under UV-B stress, we can further understand the mechanism of plant tolerance to UV-B and provide theoretical support for the future use of molecular biotechnology and genetic engineering methods to improve plant varieties.
MicroRNAs (miRNAs) are a class of conserved endogenous small non-coding RNAs with a length of 20–24 bases and they are key negative regulators in eukaryotic gene expression. Studies on miRNAs in Arabidopsis thaliana, maize (Zea mays), rice (Oryza sativa), and other model plants have shown that miRNAs play very important roles in the regulation of various aspects of plant growth and development, including leaf and flower morphogenesis, cell differentiation, tissue formation, hormone anabolism, signaling, and stress responses [7,8]. Their expression is generally tissue- and time-specific and is affected by various environmental stresses, such as salinity, drought, high temperature, and UV [9,10]. Global expression analysis of gene expression chips has helped researchers to speculate that 21 miRNAs from 11 miRNA families may be induced by UV-B radiation in Arabidopsis [11], and later experiments found 13 UV-upregulated and 11 UV-downregulated miRNAs [12] in Populus tremula, 17 highly UV-responsive miRNAs in maize leaves [9], and 7 UV-responsive miRNAs in wheat (Triticum aestivum) [13]; furthermore, high-throughput sequencing in grapes (Vitis vinifera) detected 13 differentially expressed miRNAs [14]. It has been found that the miRNAs that respond to UV stress in most plants are miR164, miR156, miR171, and miR398 [13,14,15,16], which indicates that these miRNAs may be involved in the regulation of targets after induction by UV-B stress.
The microRNA164 (miR164) family is a highly conserved class of miRNAs in plants [17]. Studies have found that the miR164 family in Arabidopsis consists of three members (miR164a, miR164b, and miR164c) which mediate five NAC (NAM, ATAF1/2, and CUC2) transcription factor genes; the miR164 family in rice has four mature sequences (miR164a/b/f, miR164c, miR164d, and miR164e), and the main targets are six NAC transcription factors. These target genes are mainly involved in the formation of vegetative and floral organs, the maintenance of organ boundaries, lateral root formation, senescence-mediated cell death, and biotic and abiotic stresses [18,19]. However, other than a few studies that showed that the expression of miR164 in plants changed under UV-B treatment [9,12,13], no report about the relationship between miR164 and the plant response to UV has been found so far, and the possible specific responses and tolerance mechanism need to be further revealed.
Therefore, the objective of this study was to investigate how miR164 would affect responses to UV in perennial ryegrass (Lolium perenne), a UV-B-sensitive and widely grown cool-season turfgrass and forage grass species in the world [20]. The finding could provide some useful knowledge about the role of miR164 in plant response to UV radiation, perhaps leading to a better understanding of the mechanism of plant adaptation to changing UV environments.

2. Results

2.1. Generation of Transgenic Perennial Ryegrass Plants with Overexpression or Target Mimicry of the Rice miR164a Gene

To investigate the function of the miR164 gene in perennial ryegrass, an Os-miR164a overexpression or target mimicry construct (35S::Os-miR164/35S::Hyg, 35S::Os-ISP1-MIM164/35S::Hyg, Figure 1G) was constructed and introduced into perennial ryegrass by agrobacterium-mediated plant transformation (Figure 1A–F). A total of eight putative OE164 lines were identified using a genomic DNA template PCR for a 510 bp Os-miR164a fragment (Figure 1H) and five putative MIM164 lines were identified using PCR for a 257 bp Os-ISP1-MIM164 fragment (Figure 1I). Five independent OE164 or MIM164 lines were tested using semi-quantitative RT-PCR of the primary Os-miR164 transcripts or Os-ISP1-MIM164 transcripts for further confirmation. All five of the selected OE164 lines were confirmed, but only one line of MIM164 was confirmed at the transcription level (Figure 1J,K). All five of the independent OE164 lines were morphologically similar and performed similarly when grown in the greenhouse. We selected one out of the five transcriptionally confirmed OE164 lines and one confirmed MIM164 line for further morphological and physiological analysis.

2.2. Phenotypic Characterization of Transgenic Plants

After comparing the OE164, WT, and MIM164 plants grown in the greenhouse, we observed that the OE164 plants were dwarfed, and had generally wider, shorter, and slower senescing leaves (fewer sensing leaves) than the WT plants, while it was nearly the opposite for MIM164 (Figure 2).

2.3. MiR164 Affects Perennial Ryegrass Responses to UV Stress

2.3.1. MiR164 Enhances Perennial Ryegrass Sensitivity to UV

To understand the role of miRNA164 in plant UV responses, the OE164, WT, and MIM164 plants were subjected to UV treatments for 7 days. The leaves showed a more severe wilting/scorching phenotype after 7 days of UV stress (UV+) in OE164 plants than those in both WT and MIN164 plants. And the MIM164 even looked slightly better than the WT plants (Figure 3A,B). To further investigate the different physiological changes among plants under UV+, we measured the leaf RWC and EL of OE164 and MIM164 in comparison with WT. UV caused a reduction in the RWC of all plants, regardless of the genotype. The result showed that OE164 had the lowest leaf RWC at both d3 and d7 of UV+, which indicated a worse water status in OE164 compared to both WT and MIM164 plants (Figure 3C). In accordance with the RWC, UV resulted in an increase in leaf EL, and the EL of OE164 was the highest among the plants after UV+, which was 80% and 25% higher than the WT and MIM164 plants at d3 and 43% and 22% higher than the WT and MIM164 plants at d7 of UV+, respectively (Figure 3D). These results indicate that UV-elicited leaf damage in OE164 plants was significantly more severe than that in the WT ones, while the damage in MIM164 was similar to that in the WT plants at d7, supporting a correlation with enhanced UV stress sensitivity in perennial ryegrass by miR164.

2.3.2. Leaf Pigments and Total Phenolic Content

Here, the contents of leaf pigments (chlorophyll a, chlorophyll b, carotenoids, and anthocyanins) and total phenolic content were measured to further assess the effects of miR164 on perennial ryegrass responses to UV+. We found that the OE164 looked greener than both the WT and the MIM164, and further examination of the total chlorophyll contents showed that the OE164 had 31% and 37% higher chlorophyll contents than the WT and MIM164, respectively (Figure 4A,B). Generally, with an increase in the stress period, the plant chlorophyll a, chlorophyll b, and carotenoid contents showed a trend of decrease, while the total anthocyanin and phenolic contents presented an overall tendency to increase (Figure 4). Meanwhile, under normal growth conditions, the WT plant maintained higher total anthocyanin and phenolic contents and a higher chlorophyll a/b ratio than both the OE164 and MIM164 plants, whereas it had lower contents of chlorophyll a, chlorophyll b, and carotenoids than OE164. Three days after UV+, OE164 had higher chlorophyll b than both the WT and MIM164, higher carotenoids and total phenolic content than MIM164, and lower total anthocyanin and chlorophyll a/b ratio than the WT. There were no differences in all of the parameters among the plants at d7, except higher total anthocyanin and phenolic contents in the WT (Figure 4).

2.3.3. Antioxidant Responses

The activities of four major antioxidant enzymes, SOD, POD, CAT, and APX, were measured in perennial ryegrass after UV+. In general, UV+ increased the SOD activity and the OE164 plants had the highest activity among the three types of plants. For instance, the SOD activities of OE164, WT, and MIM164 at 3d of UV+ increased by 32%, 38%, and 57% when compared with those under the UV- condition, respectively (Figure 5A). POD activity also showed an overall increase in UV+, and OE164 had the lowest activity. Plant CAT activity showed an opposite response with a decrease after UV+ (Figure 5B). Similarly to the POD, OE164 had the lowest activity of CAT and APX among the three types of plants under UV+ (Figure 5C,D). Additionally, we further assayed the production of two major reactive oxygen species (ROS), O2− and H2O2, in leaf tissues using NBT and DAB staining methods, respectively. The results showed that after UV+7d, OE164 had the strongest stain intensity for both O2− and H2O2, while MIM164 showed the lightest stain intensity of O2− and a similar stain intensity to the WT. Interestingly, under the control growth condition, OE164 had the lowest stain intensity of O2− (Figure 5E,F).

3. Discussion

As a highly conserved class of miRNAs in plants, the microRNA164 (miR164) family has been widely studied in various plant species during the past (almost) 20 years [21,22,23,24,25,26,27,28]. Similarly to other miRNAs, miR164 functions in plant growth and development by forming regulation modules with its target genes, mainly NAC (NAM, ATAF, and CUC) transcription factors and a few less broadly conserved target genes containing a sequence complementary to miR164 with few mismatches. For instance, in Arabidopsis meristems, miR164 constrains the boundary domain expansion by degrading CUC1 (CUP-SHAPED COTYLEDON1) and CUC2 gene expression at the mRNA level [28]. Moreover, miR164-directed post-transcriptional regulation of CUC1 is also required for the separation and normal development of adjacent embryonic, floral, and vegetative organs [29]. And in cotton (Gossypium hirsutum), miR164 forms a regulation module with GhCUC2-GhBRC1 to regulate plant architecture through abscisic acid [22]. In common wheat, miR164 regulates root growth and yield traits by targeting a phytosulfokine precursor gene, TaPSK5 [30]. Here, phenotypic analysis found that OE164 had reduced plant height and delayed leaf senescence (greener and less senescing leaves) compared with the WT, while MIM164 was almost the opposite (Figure 2), which could be due to the downregulation of miR164-targeted NAC genes. Wang [31] reported that the knockout of miR164-targeted OsCUC1 leads to multiple defects, including dwarf plant architecture in rice. Additionally, miR164 is involved in delaying leaf and fruit senescence by negatively regulating NAC transcription factor genes [32,33].
Besides the important roles in plant development, miR164 is also involved in regulating responses to biotic and abiotic stresses. Overexpressing a miR164-targeted NAC transcription factor NAC21/22 negatively regulates stripe rust resistance in wheat [34] and the overexpression of miR164-targeted NAC transcription factor genes has negative effects on drought resistance in rice at the reproduction stage [18]. Similarly, in wheat seedlings, tae-miR164 inhibits root development and reduces drought and salinity tolerance by downregulating the expression of TaNAC14 [21]. In this study, we found that miR164 affected plant responses to UV by generating OS-miR164a-overexpressing (OE164) and -silencing (MIM164) perennial ryegrass, more specifically, by having a negative effect on UV tolerance.
UV affects plant growth and development, and the type of plant responses to UV-B basically depend on the flux of UV radiation. At a low UV flux, it can promote metabolic and developmental changes, such as the biosynthesis of phenolic secondary metabolites and inhibition of hypocotyl elongation. UV-B radiation at a high flux can destroy leaf epidermal cells, even mesophyll cells, resulting in necrosis on the surface of the injured plant leaves [35]. UV+7d scorching and wilting leaves were observed in all three types of plants, particularly the OE164 plants. Furthermore, UV+ resulted in a reduction in the leaf RWC and an increase in the EL of all plants, regardless of the genotype (Figure 2). In accord with the leaf observation, OE164 had the highest EL and lowest RWC among the plants after UV+. UV-B radiation can also cause damage to the thylakoid membrane of plant cells, resulting in the production of ROS, mainly including superoxide anion radical (O2−), hydroxyl radical (·OH), hydrogen peroxide (H2O2), and singlet oxygen (1O2). ROS is very active in reacting with other macromolecules, such as proteins, lipids, nucleic acids, etc., resulting in damage to these substances and even cell death [1]. NBT and DAB staining of leaf tissues showed a higher production of both O2− and H2O2 in OE164 than both WT and MIM164 plants after UV+7d, indicated by more severe oxidative stress in OE164, which was a good coincidence with the previous observations (i.e., leaf scorching, RWL, EL).
In response to UV-B stress, plants have evolved specific UV-B signaling pathways to regulate growth, development, and protective adoption strategies [4,5]. During the growth and development of plants, the production and quenching of ROS in plants have dynamic balance. When plants are subjected to UV-B stress, a large number of ROS will be produced in plants. In order to reduce the damage caused by ROS, plants produce a series of anti-oxidation protection systems to remove ROS, which can often be divided into enzymatic protection systems and non-enzymatic protection systems. The enzymatic system mainly includes SOD, CAT, POD, APX, etc., while the non-enzymatic system not only includes ascorbic acid (ASA) and glutathione (GSH) in the Asada–Halliwell–Foyer cycle, but a number of molecules with radical scavenging ability can also provide the potential for ROS scavenging [36,37]. For example, plants contain a large number of non-enzymatic antioxidants, including polyphenols, carotenoids, polyamines, and proteins carrying redox-active thiol groups, etc., thus forming a dynamic network of redox interactions [38,39].
O2− is dismutated to H2O2 by SOD, which is the first line of the enzymatic defense system against ROS. And H2O2 is then further detoxified by CAT and an array of peroxidases, such as APX and POD [40,41]. Under UV+, the activity of SOD increased, which indicated an adaptative response to the increase in oxidative damage on the plants by UV stress (Figure 5A). Interestingly, OE164 maintained higher SOD activity than both WT and MIM164 plants under both control and UV conditions; it had the lowest O2− accumulation indicated by the NBT staining among the three types of plants concurrently under the control condition, but the highest O2− accumulation 7 d after UV+ (Figure 5E,F). In general, the activities of these antioxidant enzymes increase concomitantly with a decrease in ROS production, or vice versa [40,42], but a stable antioxidant system status could depend on stress duration, intensity, and probably other factors [43]. For example, lily (Lilium longiflorum) showed that lower SOD activity was concurrent with greater O2− production 10 h after heat stress, whereas higher SOD activity was accompanied by an equal or much higher O2− concentration 6 or 8 h after heat stress was also observed [44]. We inferred that the higher O2− accumulation in OE164 after UV stress was more likely an indication of much harsher oxidative stress damage than the WT and MIM164 plants, which would stimulate a higher SOD level in OE164 as a response in turn, or that there was just not high enough SOD to cope with the severity of the stress. The higher CAT, POD, and APX activities in MIM164 and WT over OE164 showed a higher capacity to detoxify the H2O2 under UV+, which paralleled the lower accumulation of H2O2 as demonstrated by the lighter stain intensity (Figure 5B–F). The reduced enzymatic antioxidant system, especially the lower H2O2 scavenging enzymes, could explain, at least partly, the enhanced UV sensitivity of OE plants.
In addition, the induction and synthesis of phenolic compounds (e.g., phenylpropanoids, flavonoids) is one of the most important and universal protective reactions of plants to UV radiation, as they act not only as a primary antioxidant to scavenge ROS, but also as a natural ‘UV sunscreen’ [45]. The accumulation of flavonoids (astilbin, quercetin, kaempferol, anthocyanins, etc.) and related UV-absorbing compounds in epidermal tissues reduces epidermal UV transmittance. And it is one of the main mechanisms for plants to adapt to UV environmental changes, including those caused by stratospheric ozone depletion and climate change [39,46]. The total phenolic content increased from 7.80 to 14.39, 12.09 to 15.63, and 8.34 to 11.91 mg/g DW in OE164, WT, and MIM164 after UV+7d, respectively. The OE164 and MIM164 had lower total phenols than the WT under UV-, but OE164 was not different from the WT both 3 and 7 d after UV stress. Similarly, UV+ also increased the total anthocyanin content, and both OE164 and MIM164 had lower total anthocyanin content than the WT plants (Figure 4E,F). This all indicated that the different accumulation of the total phenols, particularly the anthocyanins, might account for, to a certain degree, the difference in UV sensitivity among the three types of ryegrass plants. Different from the pigment anthocyanins, chlorophyll concentration usually decreases in response to high-level stresses, including UV [47,48,49]. All of the ryegrass plants showed a reduction in both the chlorophyll a and b concentrations after UV+, and OE164 maintained a lower chlorophyll a/chlorophyll b ratio (Chl a/b) than the WT and MIM164 for both UV- and UV+3d (Figure 4). The range of the Chl a/b ratio for healthy plants is between 2.5 and 3.5 and a higher Chl a/b ratio was reported to be a favorable trait in Euglena gracilis under shade [50] and in rice under oxidative stress [51]. However, whether lower Chl a/b in OE164 is related to plant UV sensitivity would need further detailed studies.

4. Conclusions

In summary, we generated both OsmiR164a overexpression and target mimicry perennial ryegrass. Morphological and physiological analysis showed that the miR164 gene affected perennial ryegrass UV tolerance in a negative way, demonstrated by the more scorching leaves, higher leaf LE, and lower RWL in OE164 than the WT and MIM164 plants. The increased UV sensitivity could be partially due to the reduction in antioxidative capacity and the accumulation of anthocyanins. This study indicated the potential of targeting miR164 and/or its targeted genes for genetic regulation of UV responses in forage grasses/turfgrasses, and further study to dissect the molecular mechanism through which miR164 affects plant UV responses is warranted.

5. Materials and Methods

5.1. Plant Materials, Growth Conditions, and Experiment Treatments

Perennial ryegrass “Citation Fore” (Pure Seed, Canby, OR, USA) was used in this study. MiR164-overexpressing (OE164) and target mimicry (MIM164) transgenic perennial ryegrass plants harboring the genes of interest under the of 35S promoter from the plant pathogen Cauliflower Mosaic Virus (CaMV) were developed as described previously [23,52,53]. Briefly, the OE164 contains pre-OsmiR164a (same mature miR164 sequence as perennial ryegrass, 5′-UGGAGAAGCAGGGCACGUGCA-3′) amplified by PCR using Nipponbare rice genomic DNA as the template. To generate a target mimicry construct (reducing the active level of miR164), Arabidopsis AtISP1 (induced by phosphate starvation1), showing incomplete complementarity to At-miR399, was modified to mimic the targets OsMIM164a using DNA synthesis (General Biol, China); the resulting gene showed incomplete complementarity to the mature OS-miR164a, with four additional unpaired bases (TCTA) in the center [52,53,54] (Figure 1). After confirmation by Sanger sequencing, the correct sequences of OS-miR164a and the target mimicry sequence (OsMIM164a) were cloned into pZh01 and the pTCK303 vector with the hyg gene for hygromycin resistance as a selectable marker, respectively. The plasmid was then transferred into the Agrobacterium tumefaciens strain LBA4404 for plant transformation. The transformed Agrobacterium containing the overexpression construct of OsmiR164a and OsMIM164a was used to infect the embryonic callus induced from the mature seeds of perennial ryegrass, respectively. Transgenic plants were produced and maintained as described previously [55]. Target genes in putative overexpressing (OE164) and target mimicry (MIM164) lines in the T0 generation were identified by PCR and RT-PCR using sequence-specific primers (Table 1).
Wild-type (WT) control plants and one line of each transgenic perennial ryegrass plant (OE164, MIM164) were clonally propagated from tillers in plastic pots (8.5 cm depth and 10 cm diameter) filled with a soil mixture of sand/peat (1:1) in the greenhouse (15 ± 2 °C/25 ± 3 °C, night/day) at China Agricultural University (Beijing, China). The plants of the same growth status were selected and transferred to plant growth chambers (PQX-450, Shanghai Haixiang Instrument Factory, Shanghai, China) that provided LED white light, photosynthetically active radiation (PAR) of 400 µmol s−1 m−2, a dark/light cycle of 16/22 °C for 10/14 h, and 70% relative humidity. The plants were watered every other day, clipped to 10 cm, and fertilized weekly using Miracle-Gro (5 kg N ha−1 per month, N-P-K 24-12-14, Scotts) to achieve uniform plant growth. After acclimatizing to chamber conditions for 2 weeks, 30 pots of plants (5 pots/replication per treatment, UV− and UV+) were randomly subjected to UV radiation treatment (SANKYO DENKI G15T8E UV-B fluorescent tube, wavelength of 280–360 nm, peak at 302–306 nm; UV-AB 1000 μw cm−2, UV-A 400 μw cm−2) for 7 days (22/16 °C, 14/10 h, d/n, PAR 400 µmol s−1 m−2). In order to minimize the effects of the microenvironment, the pots in the chamber were rotated every 24 h during the experiments.

5.2. Sampling and Measurements

5.2.1. Phenotypic Analysis of Transgenic Plants

Phenotypic assessment was conducted on WT and transgenic plants (OE164 and MIM164) after being transferred and maintained under normal growth conditions in a greenhouse for 4 months. The width of the ryegrass leaves was determined by measuring the width of the widest part of the first fully developed leaf (from the top to the bottom of the plant) of each tiller with a vernier caliper, and the same leaf was used for measuring the length from the leaf collar to the leaf tip. Ten measurements of randomly selected leaves were taken for each pot of plants. Plant height was measured from the soil surface to the top of the plants.

5.2.2. Measurement of Physiological Parameters

Leaf chlorophylls and carotenoids were extracted using dimethyl sulfoxide (DMSO) and quantified as described previously [56]. The absorbance of extracts was read at 665, 649, and 480 nm using a UV-VIS spectrophotometer (Hitachi UH5300, Tokyo, Japan). Chlorophyll a, b, and carotenoids were calculated as milligrams per gram dry weight (DW) using the following equations: Chlorophyll a (Chla) = 12.19 × A665 − 3.45 × A649, Chlorophyll b (Chlb) = 21.99 × A649 − 3.52 × A665, and Carotenoids = (1000 × A480 − 2.14 × Chla-70.16 × Chlb)/220. Total anthocyanin content was quantified following the procedure described by Li et al. [57], with minor modifications. Briefly, 0.2 g of finely ground leaf powder in liquid nitrogen was mixed well with 10 mL acidic ethanol and incubated for 24 h at 4 °C in darkness with gentle shaking. The aqueous phase was then collected after centrifuging at 12,000× g for 8 min. The absorbance was subsequently measured at 530 nm using a UV-VIS spectrometer. Total anthocyanin content (TAC) was calculated using the following equation: Anthocyanin content (Anth) = A530 × V × N × 10–2 × 98.2−1 × M–1, where A530 is the absorbance at 530 nm, V is the volume of the extract (mL), N is the dilution factor, 98.2 is the molar absorptivity constant for the acidic ethanol at 530 nm, and M is the weight of the plant material used for extraction (g). Total phenolic content (TPC) determination of the Folin–Ciocalteu assay was conducted according to a method described previously [58,59], with minor modifications. Briefly, leaf tissues were ground into powder in liquid nitrogen. Then, 0.2 g powder was mixed with 10 mL of 50% acetone and sonicated in an ultrasonic bath for up to 10 min. The aqueous phase was collected after centrifuging at 10,000× g for 10 min. A total of 1 mL of diluted sample was added with 5 mL H2O, 1 mL Folin–C reagent, and 3 mL Na2CO3 solution (7.5% w/v), and then quickly mixed by shaking. We let the reaction mixture stand for 2 h at room temperature and the absorbance was subsequently measured at 765 nm. Gallic acid was used as the standard and total polyphenol contents were expressed as mg gallic acid per g dry weight.
Leaf relative water content (RWC) was measured in accordance with the method by Barrs and Weatherley [60], with minor modifications [61]. Leaves were harvested 3 and 7 d after UV treatments. About 10 fully expanded leaves (~0.2 g) from each plant pot were weighed (W1) and cut into 1–2 cm pieces. The leaf weight was measured (W2) after soaking in deionized distilled water (dd H2O) for 24 h. The leaves were then dried to constant weight (W3) in an oven at 65 °C. RWC (%) = (W1 − W3)/(W2 − W3) × 100%. Leaf electrolyte leakage (EL) was measured as described by Blum and Ebercon [62], with some modifications. Another 0.2 g of freshly harvested leaves was soaked into 20 mL dd H2O. The initial conductivity (S1) of leaf electrolyte leakage after shaking on a shaker for 24 h and the final conductivity (S2) after killing the leaves autoclaved for 20 min was measured using a conductivity meter (Hengxin TDS86555, Taiwan). EL = S1/S2 × 100%.
Enzyme extracts were prepared using the method by Chaitanya et al. [63], with modifications [43]. Leaf samples of 0.2 g were frozen quickly in liquid N and then ground in 4 mL solution containing 50 mM pH 7.8 phosphate buffer (PBS), 0.1 mM ethylenediaminetetraacetic acid (EDTA), and 1% polyvinylpolypyrrolidone (PVPP). The homogenate was centrifuged at 12,000× g for 15 min at 4 °C, and the supernatant was used for antioxidant enzyme activity assays. The activities of superoxide dismutase (SOD), ascorbate peroxidase (APX), guaiacol peroxidase (POD), and catalase (CAT) were determined following a previous protocol [61,63]. For measuring SOD activity, the reaction mixture without enzyme extract developed the maximum color after illumination and was used for maximum reduction of p-Nitro-Blue tetrazolium chloride (NBT); the mixture without illumination served as the control. The A560 was measured using a spectrophotometer. For measuring the activity of APX, the absorbance of a 3 mL reaction mixture containing 50 mM pH 7.0 PBS, 0.1 mM H2O2, 0.5 mM ASA (ascorbic acid), and 50 µL enzyme extract was recorded at 290 nm for 3 min. The A470 of a 3 mL assay solution (20 mM pH 6.0 PBS, 0.4 mM 2-methoxyphenol, 0.3 mM H2O2, and 0.2 mL enzyme extract) was recorded for 3 min to measure POD activity. The CAT activity was quantified by mixing 3 mL reaction solution containing 50 mM pH 7.0 PBS, 10 mM H2O2, and 30 μL enzyme extract. The A240 was recorded for 3 min. A unit of APX, POD, and CAT activity was defined as the quantity of enzyme that changes the absorbance (A290, A470, and A240, respectively) by 0.01/min under the specified conditions. Leaf H2O2 and superoxide production were detected by the DAB (3,3′-diaminobenzidine) staining method [64] and the NBT staining method [65], respectively. The staining intensity was further quantified using Quantity One 4.6.2 software (Bio-Rad, Hercules, CA, USA).

5.3. Experimental Design and Statistical Analysis

The experiment consisted of a split-plot design with five replications. The UV treatments (control, UV-; UV-B radiation, UV+) were defined as the whole/main-plot and three genotypes of ryegrass plants (WT, OE164, MIM164) were defined as the split/sub-plot. We analyzed all of the measurements using the samples collected at the sampling time described previously (3 d and 7 d after UV treatments), unless stated otherwise. All of the data obtained were analyzed using SPSS software (Version 25.0, IBM, Armonk, NY, USA). Treatment means were separated using Fisher’s least significant difference (LSD) test at a significance level of 0.05.

Author Contributions

W.Z. and K.W. designed and coordinated this study. C.X., X.H., N.M. and K.W. wrote the manuscript and performed the data analysis. X.H., N.M., Y.L. (Yanrong Liu) and A.X. collected and grew the plant material and conducted treatments. D.L., Y.L. (Yue Li) and X.Z. gave helpful suggestions for the whole project and further revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

National Natural Science Foundation of China. Grant/award number: 32071887.

Data Availability Statement

The original contributions presented in the study are included in the article.

Conflicts of Interest

The authors declare that there are no conflicts of interest.

References

  1. Sharma, S.; Chatterjee, S.; Kataria, S.; Joshi, J.; Datta, S.; Vairale, M.G.; Veer, V. A Review on Responses of Plants to UV-B Radiation Related Stress. In UV-B Radiation; John Wiley & Sons: Hoboken, NJ, USA, 2017; pp. 75–97. [Google Scholar] [CrossRef]
  2. Lemus-Deschamps, L.; Makin, J.K. Fifty years of changes in UV Index and implications for skin cancer in Australia. Int. J. Biometeorol. 2012, 56, 727–735. [Google Scholar] [CrossRef]
  3. Tevini, M. Plant Responses to Ultraviolet Radiation Stress. In Chlorophyll a Fluorescence: A Signature of Photosynthesis; Papageorgiou, G.C., Govindjee, Eds.; Springer: Dordrecht, The Netherlands, 2004; pp. 605–621. [Google Scholar] [CrossRef]
  4. Yadav, A.; Singh, D.; Lingwan, M.; Yadukrishnan, P.; Masakapalli, S.K.; Datta, S. Light signaling and UV-B-mediated plant growth regulation. J. Integr. Plant Biol. 2020, 62, 1270–1292. [Google Scholar] [CrossRef] [PubMed]
  5. Yin, R.; Ulm, R. How plants cope with UV-B: From perception to response. Curr. Opin. Plant Biol. 2017, 37, 42–48. [Google Scholar] [CrossRef]
  6. Singh, S.; Agrawal, S.B.; Agrawal, M. UVR8 mediated plant protective responses under low UV-B radiation leading to photosynthetic acclimation. J. Photochem. Photobiol. B Biol. 2014, 137, 67–76. [Google Scholar] [CrossRef]
  7. Reinhart, B.J.; Weinstein, E.G.; Rhoades, M.W.; Bartel, B.; Bartel, D.P. MicroRNAs in plants. Genes. Dev. 2002, 16, 1616–1626. [Google Scholar] [CrossRef] [PubMed]
  8. Khraiwesh, B.; Zhu, J.-K.; Zhu, J. Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants. Biochim. Et Biophys. Acta (BBA) Gene Regul. Mech. 2012, 1819, 137–148. [Google Scholar] [CrossRef]
  9. Casati, P. Analysis of UV-B regulated miRNAs and their targets in maize leaves. Plant Signal Behav. 2013, 8, e26758. [Google Scholar] [CrossRef] [PubMed]
  10. Bartel, D.P. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
  11. Zhou, X.; Wang, G.; Zhang, W. UV-B responsive microRNA genes in Arabidopsis thaliana. Mol. Syst. Biol. 2007, 3, 103. [Google Scholar] [CrossRef]
  12. Jia, X.; Ren, L.; Chen, Q.J.; Li, R.; Tang, G. UV-B-responsive microRNAs in Populus tremula. J. Plant Physiol. 2009, 166, 2046–2057. [Google Scholar] [CrossRef]
  13. Wang, B.; Sun, Y.F.; Song, N.; Wang, X.J.; Feng, H.; Huang, L.L.; Kang, Z.S. Identification of UV-B-induced microRNAs in wheat. Genet. Mol. Res. 2013, 12, 4213–4221. [Google Scholar] [CrossRef] [PubMed]
  14. Sunitha, S.; Loyola, R.; Alcalde, J.A.; Arce-Johnson, P.; Matus, J.T.; Rock, C.D. The Role of UV-B light on Small RNA Activity During Grapevine Berry Development. G3 Genes Genomes Genet. 2019, 9, 769–787. [Google Scholar] [CrossRef] [PubMed]
  15. Pashkovskii, P.P.; Ryazanskii, S.S.; Radyukina, N.L.; Gvozdev, V.A.; Kuznetsov, V.V. MIR398 and expression regulation of the cytoplasmic Cu/Zn-superoxide dismutase gene in Thellungiella halophila plants under stress conditions. Russ. J. Plant Physiol. 2010, 57, 707–714. [Google Scholar] [CrossRef]
  16. Islam, W.; Waheed, A.; Idrees, A.; Rashid, J.; Zeng, F. Role of plant microRNAs and their corresponding pathways in fluctuating light conditions. Biochim. Et Biophys. Acta (BBA) Mol. Cell Res. 2023, 1870, 119304. [Google Scholar] [CrossRef]
  17. Sunkar, R.; Zhou, X.; Zheng, Y.; Zhang, W.; Zhu, J.K. Identification of novel and candidate miRNAs in rice by high throughput sequencing. BMC Plant Biol. 2008, 8, 25. [Google Scholar] [CrossRef]
  18. Fang, Y.; Xie, K.; Xiong, L. Conserved miR164-targeted NAC genes negatively regulate drought resistance in rice. J. Exp. Bot. 2014, 65, 2119–2135. [Google Scholar] [CrossRef]
  19. Lee, M.-H.; Jeon, H.S.; Kim, H.G.; Park, O.K. An Arabidopsis NAC transcription factor NAC4 promotes pathogen-induced cell death under negative regulation by microRNA164. New Phytol. 2017, 214, 343–360. [Google Scholar] [CrossRef]
  20. Huarancca Reyes, T.; Pompeiano, A.; Ranieri, A.; Volterrani, M.; Guglielminetti, L.; Scartazza, A. Photosynthetic performance of five cool-season turfgrasses under UV-B exposure. Plant Physiol. Biochem. 2020, 151, 181–187. [Google Scholar] [CrossRef] [PubMed]
  21. Qing, C.H.I.; Du, L.Y.; Wen, M.A.; Niu, R.Y.; Wu, B.W.; Guo, L.J.; Meng, M.A.; Liu, X.L.; Zhao, H.X. The miR164-TaNAC14 module regulates root development and abiotic-stress tolerance in wheat seedlings. J. Integr. Agric. 2023, 22, 981–998. [Google Scholar] [CrossRef]
  22. Zhan, J.; Chu, Y.; Wang, Y.; Diao, Y.; Zhao, Y.; Liu, L.; Wei, X.; Meng, Y.; Li, F.; Ge, X. The miR164-GhCUC2-GhBRC1 module regulates plant architecture through abscisic acid in cotton. Plant Biotechnol. J. 2021, 19, 1839–1851. [Google Scholar] [CrossRef]
  23. Wang, Z.; Xia, Y.; Lin, S.; Wang, Y.; Guo, B.; Song, X.; Ding, S.; Zheng, L.; Feng, R.; Chen, S.; et al. Osa-miR164a targets OsNAC60 and negatively regulates rice immunity against the blast fungus Magnaporthe oryzae. Plant J. 2018, 95, 584–597. [Google Scholar] [CrossRef]
  24. Lira, B.S.; Gramegna, G.; Trench, B.A.; Alves, F.R.R.; Silva, E.M.; Silva, G.F.F.; Thirumalaikumar, V.P.; Lupi, A.C.D.; Demarco, D.; Purgatto, E.; et al. Manipulation of a Senescence-Associated Gene Improves Fleshy Fruit Yield. Plant Physiol. 2017, 175, 77–91. [Google Scholar] [CrossRef]
  25. Phookaew, P.; Netrphan, S.; Sojikul, P.; Narangajavana, J. Involvement of miR164-and miR167-mediated target gene expressions in responses to water deficit in cassava. Biol. Plant. 2014, 58, 469–478. [Google Scholar] [CrossRef]
  26. Huang, T.; Lopez-Giraldez, F.; Townsend, J.P.; Irish, V.F. RBE controls microRNA164 expression to effect floral organogenesis. Development 2012, 139, 2161–2169. [Google Scholar] [CrossRef]
  27. Kim, J.H.; Woo, H.R.; Kim, J.; Lim, P.O.; Lee, I.C.; Choi, S.H.; Hwang, D.; Nam, H.G. Trifurcate Feed-Forward Regulation of Age-Dependent Cell Death Involving miR164 in Arabidopsis. Science 2009, 323, 1053–1057. [Google Scholar] [CrossRef]
  28. Laufs, P.; Peaucelle, A.; Morin, H.; Traas, J. MicroRNA regulation of the CUC genes is required for boundary size control in Arabidopsis meristems. Development 2004, 131, 4311–4322. [Google Scholar] [CrossRef]
  29. Mallory, A.C.; Dugas, D.V.; Bartel, D.P.; Bartel, B. MicroRNA Regulation of NAC-Domain Targets Is Required for Proper Formation and Separation of Adjacent Embryonic, Vegetative, and Floral Organs. Curr. Biol. 2004, 14, 1035–1046. [Google Scholar] [CrossRef]
  30. Geng, Y.; Jian, C.; Xu, W.; Liu, H.; Hao, C.; Hou, J.; Liu, H.; Zhang, X.; Li, T. miR164-targetedTaPSK5encodes a phytosulfokine precursor that regulates root growth and yield traits in common wheat (Triticum aestivum L.). Plant Mol. Biol. 2020, 104, 615–628. [Google Scholar] [CrossRef]
  31. Wang, J.; Bao, J.; Zhou, B.; Li, M.; Li, X.; Jin, J. The osa-miR164 target OsCUC1 functions redundantly with OsCUC3 in controlling rice meristem/organ boundary specification. New Phytol. 2021, 229, 1566–1581. [Google Scholar] [CrossRef]
  32. Wen, C.-H.; Hong, S.-F.; Hu, S.-F.; Lin, S.-S.; Chu, F.-H. Lfo-miR164b and LfNAC1 as autumn leaf senescence regulators in Formosan sweet gum (Liquidambar formosana Hance). Plant Sci. 2020, 291, 110325. [Google Scholar] [CrossRef]
  33. Li, J.; Lai, T.; Song, H.; Xu, X. MiR164 is involved in delaying senescence of strawberry (Fragaria ananassa) fruit by negatively regulating NAC transcription factor genes under low temperature. Russ. J. Plant Physiol. 2017, 64, 251–259. [Google Scholar] [CrossRef]
  34. Feng, H.; Duan, X.; Zhang, Q.; Li, X.; Wang, B.; Huang, L.; Wang, X.; Kang, Z. The target gene of tae-miR164, a novel NAC transcription factor from the NAM subfamily, negatively regulates resistance of wheat to stripe rust. Mol. Plant Pathol. 2014, 15, 284–296. [Google Scholar] [CrossRef] [PubMed]
  35. Brown, B.A.; Jenkins, G.I. UV-B Signaling Pathways with Different Fluence-Rate Response Profiles Are Distinguished in Mature Arabidopsis Leaf Tissue by Requirement for UVR8, HY5, and HYH. Plant Physiol. 2007, 146, 323–324. [Google Scholar] [CrossRef]
  36. Jayaraj, J.; Punja, Z.K. Transgenic carrot plants accumulating ketocarotenoids show tolerance to UV and oxidative stresses. Plant Physiol. Biochem. 2008, 46, 875–883. [Google Scholar] [CrossRef]
  37. Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef]
  38. Ahmed, F.; Schenk, P.M. UV-C radiation increases sterol production in the microalga Pavlova lutheri. Phytochem. 2017, 139, 25–32. [Google Scholar] [CrossRef] [PubMed]
  39. Barnes, P.W.; Ryel, R.J.; Flint, S.D. UV Screening in Native and Non-native Plant Species in the Tropical Alpine: Implications for Climate Change-Driven Migration of Species to Higher Elevations. Front. Plant Sci. 2017, 8, 1451. [Google Scholar] [CrossRef] [PubMed]
  40. Blokhina, O.; Virolainen, E.; Fagerstedt, K.V. Antioxidants, oxidative damage and oxygen deprivation stress: A review. Ann. Bot. 2003, 91, 179–194. [Google Scholar] [CrossRef]
  41. Hasanuzzaman, M.; Nahar, K.; Alam, M.; Roychowdhury, R.; Fujita, M. Physiological, Biochemical, and Molecular Mechanisms of Heat Stress Tolerance in Plants. Int. J. Mol. Sci. 2013, 14, 9643–9684. [Google Scholar] [CrossRef]
  42. Miller, G.; Suzuki, N.; Ciftci-Yilmaz, S.; Mittler, R. Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ. 2010, 33, 453–467. [Google Scholar] [CrossRef]
  43. Wang, K.; Zhang, X.; Ervin, E. Antioxidative responses in roots and shoots of creeping bentgrass under high temperature: Effects of nitrogen and cytokinin. J. Plant Physiol. 2012, 169, 492–500. [Google Scholar] [CrossRef]
  44. Yin, H.; Chen, Q.; Yi, M. Effects of short-term heat stress on oxidative damage and responses of antioxidant system in Lilium longiflorum. Plant Growth Regul. 2008, 54, 45–54. [Google Scholar] [CrossRef]
  45. Fini, A.; Brunetti, C.; Di Ferdinando, M.; Ferrini, F.; Tattini, M. Stress-induced flavonoid biosynthesis and the antioxidant machinery of plants. Plant Signal Behav. 2011, 6, 709–711. [Google Scholar] [CrossRef]
  46. Alonso, R.; Berli, F.J.; Fontana, A.; Piccoli, P.; Bottini, R. Malbec grape (Vitis vinifera L.) responses to the environment: Berry phenolics as influenced by solar UV-B, water deficit and sprayed abscisic acid. Plant Physiol. Biochem. 2016, 109, 84–90. [Google Scholar] [CrossRef]
  47. Agathokleous, E.; Feng, Z.; Peñuelas, J. Chlorophyll hormesis: Are chlorophylls major components of stress biology in higher plants? Sci. Total Environ. 2020, 726, 138637. [Google Scholar] [CrossRef]
  48. Salama, H.M.; Al Watban, A.A.; Al-Fughom, A.T. Effect of ultraviolet radiation on chlorophyll, carotenoid, protein and proline contents of some annual desert plants. Saudi J. Biol. Sci. 2011, 18, 79–86. [Google Scholar] [CrossRef]
  49. Chauhan, J.; Prathibha, M.D.; Singh, P.; Choyal, P.; Mishra, U.N.; Saha, D.; Kumar, R.; Anuragi, H.; Pandey, S.; Bose, B.; et al. Plant photosynthesis under abiotic stresses: Damages, adaptive, and signaling mechanisms. Plant Stress. 2023, 10, 100296. [Google Scholar] [CrossRef]
  50. Beneragama, C.; Goto, K. Chlorophyll a:b Ratio Increases Under Low-light in S‘hade-tolerant’ Euglena gracilis. Trop Agric. Res. 2011, 22, 12–25. [Google Scholar] [CrossRef]
  51. Kasajima, I. Difference in oxidative stress tolerance between rice cultivars estimated with chlorophyll fluorescence analysis. BMC Res. Notes 2017, 10, 168. [Google Scholar] [CrossRef]
  52. Zhou, Y.; Zhou, S.; Wang, L.; Wu, D.; Cheng, H.; Du, X.; Mao, D.; Zhang, C.; Jiang, X. miR164c and miR168a regulate seed vigor in rice. J. Integr. Plant Biol. 2020, 62, 470–486. [Google Scholar] [CrossRef]
  53. Franco-Zorrilla, J.M.; Valli, A.; Todesco, M.; Mateos, I.; Puga, M.I.; Rubio-Somoza, I.; Leyva, A.; Weigel, D.; Garcia, J.A.; Paz-Ares, J. Target mimicry provides a new mechanism for regulation of microRNA activity. Nat. Genet. 2007, 39, 1033–1037. [Google Scholar] [CrossRef]
  54. Wang, H.; Li, Y.; Chern, M.; Zhu, Y.; Zhang, L.L.; Lu, J.H.; Li, X.P.; Dang, W.Q.; Ma, X.C.; Yang, Z.R.; et al. Suppression of rice miR168 improves yield, flowering time and immunity. Nat. Plants 2021, 7, 129–136. [Google Scholar] [CrossRef]
  55. Zhang, W.J.; Dewey, R.E.; Boss, W.; Phillippy, B.Q.; Qu, R. Enhanced Agrobacterium-mediated transformation efficiencies in monocot cells is associated with attenuated defense responses. Plant Mol. Biol. 2013, 81, 273–286. [Google Scholar] [CrossRef]
  56. Wellburn, A.R. The Spectral Determination of Chlorophylls a and b, as well as Total Carotenoids, Using Various Solvents with Spectrophotometers of Different Resolution. J. Plant Physiol. 1994, 144, 307–313. [Google Scholar] [CrossRef]
  57. Li, H.; Zhu, L.; Yuan, G.; Heng, S.; Yi, B.; Ma, C.; Shen, J.; Tu, J.; Fu, T.; Wen, J. Fine mapping and candidate gene analysis of an anthocyanin-rich gene, BnaA.PL1, conferring purple leaves in Brassica napus L. Mol. Genet. Genom. 2016, 291, 1523–1534. [Google Scholar] [CrossRef]
  58. Georgé, S.; Brat, P.; Alter, P.; Amiot, M.J. Rapid determination of polyphenols and vitamin C in plant-derived products. J. Agric. Food Chem. 2005, 53, 1370–1373. [Google Scholar] [CrossRef]
  59. Kupina, S.; Fields, C.; Roman, M.C.; Brunelle, S.L. Determination of Total Phenolic Content Using the Folin-C Assay: Single-Laboratory Validation, First Action 2017.13. J. AOAC Int. 2018, 101, 1466–1472. [Google Scholar] [CrossRef] [PubMed]
  60. Barrs, H.D.; Weatherley, P.E. A Re-Examination of the Relative Turgidity Technique for Estimating Water Deficits in Leaves. Aust. J. Biol. Sci. 1962, 15, 413–428. [Google Scholar] [CrossRef]
  61. Taier, G.; Hang, N.; Shi, T.; Liu, Y.; Ye, W.; Zhang, W.; Wang, K. Ectopic Expression of Os-miR408 Improves Thermo-Tolerance of Perennial Ryegrass. Agronomy 2021, 11, 1930. [Google Scholar] [CrossRef]
  62. Blum, A.; Ebercon, A. Cell Membrane Stability as a Measure of Drought and Heat Tolerance in Wheat. Crop Sci. 1981, 21, 43–47. [Google Scholar] [CrossRef]
  63. Chaitanya, K.V.; Sundar, D.; Masilamani, S.; Reddy, A.R. Variation in heat stress-induced antioxidant enzyme activities among three mulberry cultivars. Plant Growth Regul. 2002, 36, 175–180. [Google Scholar] [CrossRef]
  64. Hüve, K.; Bichele, I.; Rasulov, B.; Niinemets, Ü. When it is too hot for photosynthesis: Heat-induced instability of photosynthesis in relation to respiratory burst, cell permeability changes and H2O2 formation. Plant Cell Environ. 2011, 34, 113–126. [Google Scholar] [CrossRef]
  65. Jambunathan, N. Determination and Detection of Reactive Oxygen Species (ROS), Lipid Peroxidation, and Electrolyte Leakage in Plants. In Plant Stress Tolerance: Methods and Protocols; Sunkar, R., Ed.; Humana Press: Totowa, NJ, USA, 2010; pp. 291–297. [Google Scholar] [CrossRef]
Plants 13 01242 g001
Figure 1. Generation and molecular confirmation of Os-miR164a overexpression (OE164) and target mimicry (MIM164) transgenic perennial ryegrass plants. (A–F) Callus transformation and transgenic plant generation process. (G) The schematic map of the T-DNA region of Os-miR164a overexpression (35S::Os-miR164//35S::Hyg) and target mimicry (35S::At-ISP1-MIM164//35S::Hyg) construct; UBi, maize ubiquitin promotor; 35S, CaMV 35S promoter; LB/RB, left/right border; NOS, nopaline synthase; PolyA, poly adenine; Hyg, hygromycin B phosphotransferase gene. (H,I) PCR assay of miRNA164 overexpression and target mimicry transgenic plants; T1–8/T1–10, putative OE164/MIM164 plants; +, positive control, pZH01. (J,K) RT-PCR assay of miRNA164 overexpression (J) and target mimicry (K) transgenic plants; T1–5/T1–5, putative OE164/MIM164 plants; +, positive control, pTCK303; −, negative control, H2O; WT, wild type; M, molecular marker.
Figure 1. Generation and molecular confirmation of Os-miR164a overexpression (OE164) and target mimicry (MIM164) transgenic perennial ryegrass plants. (A–F) Callus transformation and transgenic plant generation process. (G) The schematic map of the T-DNA region of Os-miR164a overexpression (35S::Os-miR164//35S::Hyg) and target mimicry (35S::At-ISP1-MIM164//35S::Hyg) construct; UBi, maize ubiquitin promotor; 35S, CaMV 35S promoter; LB/RB, left/right border; NOS, nopaline synthase; PolyA, poly adenine; Hyg, hygromycin B phosphotransferase gene. (H,I) PCR assay of miRNA164 overexpression and target mimicry transgenic plants; T1–8/T1–10, putative OE164/MIM164 plants; +, positive control, pZH01. (J,K) RT-PCR assay of miRNA164 overexpression (J) and target mimicry (K) transgenic plants; T1–5/T1–5, putative OE164/MIM164 plants; +, positive control, pTCK303; −, negative control, H2O; WT, wild type; M, molecular marker.
Plants 13 01242 g001
Plants 13 01242 g002
Figure 2. Phenotypic analysis of Os-miR164a overexpression (OE164) and target mimicry (MIM164) transgenic perennial ryegrass plants. (A) Comparison of whole plants of OE164 and WT. (B) Comparison of whole plants of MIM164 and WT. (C) Comparison of leaves of OE164, WT, and MIM164. (D–F) Plant height, leaf length, and leaf width of OE164, WT, and MIM164. The different lowercase letters indicate a significant difference among plants at p < 0.05, n = 40.
Figure 2. Phenotypic analysis of Os-miR164a overexpression (OE164) and target mimicry (MIM164) transgenic perennial ryegrass plants. (A) Comparison of whole plants of OE164 and WT. (B) Comparison of whole plants of MIM164 and WT. (C) Comparison of leaves of OE164, WT, and MIM164. (D–F) Plant height, leaf length, and leaf width of OE164, WT, and MIM164. The different lowercase letters indicate a significant difference among plants at p < 0.05, n = 40.
Plants 13 01242 g002
Plants 13 01242 g003
Figure 3. Morphological changes (A,B) and leaf relative water content (C); leaf electrolyte leakage (D) of OE164, WT, and MIM164 plants after UV+. The different lowercase letters indicate a significant difference among the plants 3 and 7 days after UV+ at p < 0.05, n = 5.
Figure 3. Morphological changes (A,B) and leaf relative water content (C); leaf electrolyte leakage (D) of OE164, WT, and MIM164 plants after UV+. The different lowercase letters indicate a significant difference among the plants 3 and 7 days after UV+ at p < 0.05, n = 5.
Plants 13 01242 g003
Plants 13 01242 g004
Figure 4. Leaf pigments and total phenolic content of OE164, WT, and MIM164 plants after UV+. (A–C) Chlorophyll a and b content and chlorophyll a/b ratio; (D) carotenoid content; (E) total anthocyanin content; (F) total phenolic content. UV−, normal growth condition. UV+3d and UV+7d 3 and 7 days after UV+. The different lowercase letters indicate a significant difference among the plants at p < 0.05, n = 5.
Figure 4. Leaf pigments and total phenolic content of OE164, WT, and MIM164 plants after UV+. (A–C) Chlorophyll a and b content and chlorophyll a/b ratio; (D) carotenoid content; (E) total anthocyanin content; (F) total phenolic content. UV−, normal growth condition. UV+3d and UV+7d 3 and 7 days after UV+. The different lowercase letters indicate a significant difference among the plants at p < 0.05, n = 5.
Plants 13 01242 g004
Plants 13 01242 g005
Figure 5. The activities of antioxidant enzymes and production of reactive oxygen species of OE164, WT, and MIM164 plants after UV stress. (A–D) The activities of superoxide dismutase (SOD), guaiacol peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX); (E,F) leaf NBT and DAB staining and staining intensity quantification. UV−, normal growth condition. UV+3d and UV+7d 3 and 7 days after UV treatment. The different lowercase letters indicate a significant difference among the plants at p < 0.05, n = 5.
Figure 5. The activities of antioxidant enzymes and production of reactive oxygen species of OE164, WT, and MIM164 plants after UV stress. (A–D) The activities of superoxide dismutase (SOD), guaiacol peroxidase (POD), catalase (CAT), and ascorbate peroxidase (APX); (E,F) leaf NBT and DAB staining and staining intensity quantification. UV−, normal growth condition. UV+3d and UV+7d 3 and 7 days after UV treatment. The different lowercase letters indicate a significant difference among the plants at p < 0.05, n = 5.
Plants 13 01242 g005
Table 1. Information on the primers used in this study.
Table 1. Information on the primers used in this study.
Primer NamePrimer Sequence (5′–3′)Purpose
miR164-F-XbaTCTAGATTGCTTCAGTTGTTCGCAGTVector construction and PCR and RT-PCR analysis
miR164-R-SalGTCGACGCGTCTTAGTGTTACTTTGGACVector construction and PCR and RT-PCR analysis
ISP1-MIM164-F-KpnTGGTACCAAAACACCACAAAAACAMIM164 vector construction
ISP1-MIM164-R-SpelACTAGTAAGAGGAATTCACTATAAAMIM164 vector construction
MIM164-FGCCTAAATACAAAATGAAAACTCTCPCR and RT-PCR analysis
MIM164-RGTACAACCCAAACATAATGAAGAAPCR and RT-PCR analysis
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xu, C.; Huang, X.; Ma, N.; Liu, Y.; Xu, A.; Zhang, X.; Li, D.; Li, Y.; Zhang, W.; Wang, K. MicroRNA164 Affects Plant Responses to UV Radiation in Perennial Ryegrass. Plants 2024, 13, 1242. https://doi.org/10.3390/plants13091242

AMA Style

Xu C, Huang X, Ma N, Liu Y, Xu A, Zhang X, Li D, Li Y, Zhang W, Wang K. MicroRNA164 Affects Plant Responses to UV Radiation in Perennial Ryegrass. Plants. 2024; 13(9):1242. https://doi.org/10.3390/plants13091242

Chicago/Turabian Style

Xu, Chang, Xin Huang, Ning Ma, Yanrong Liu, Aijiao Xu, Xunzhong Zhang, Dayong Li, Yue Li, Wanjun Zhang, and Kehua Wang. 2024. "MicroRNA164 Affects Plant Responses to UV Radiation in Perennial Ryegrass" Plants 13, no. 9: 1242. https://doi.org/10.3390/plants13091242

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop