Next Article in Journal
Chemical Composition of Essential Oil from Citrus reticulata Blanco cv. Chachiensis (Chachi) and Its Anti-Mosquito Activity against Pyrethroid-Resistant Aedes albopictus
Previous Article in Journal
Effects of Black Soldier Fly (Hermetia illucens L., BSF) Larvae Addition on In Vitro Fermentation Parameters of Goat Diets
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 15
Issue 5
10.3390/insects15050344
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Artificial Sugar Supplementation on the Composition and Nutritional Potency of Honey from Apis cerana

by
Yueyang Hu
1,2,3,
Jianhui Liu
1,2,
Qizhong Pan
3,4,
Xinxin Shi
1,2 and
Xiaobo Wu
1,2,3,*
1
Honeybee Research Institute, Jiangxi Agricultural University, Nanchang 330045, China
2
Jiangxi Province Key Laboratory of Honeybee Biology and Beekeeping, Nanchang 330045, China
3
Jiangxi Anyuan Honeybee Science and Technology Backyard, Anyuan 342100, China
4
Jiangxi Ganzhou Agricultural College, Ganzhou 341199, China
*
Author to whom correspondence should be addressed.
Insects 2024, 15(5), 344; https://doi.org/10.3390/insects15050344
Submission received: 15 April 2024 / Revised: 5 May 2024 / Accepted: 9 May 2024 / Published: 10 May 2024
(This article belongs to the Section Insect Societies and Sociality)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

In the global beekeeping industry, supplementary feeding is crucial for bee colony maintenance. Beekeepers commonly use sugar syrup as an artificial supplement, yet its impact on honey quality remains unclear. To address this gap, this study compared three types of honey: sugar-based product, honey-sourced honey, and flower-sourced honey. Flower-sourced honey exhibited superior chemical composition, antioxidant capacity, and nutritional value compared to honey-sourced honey and sugar-based product. The study emphasizes the importance of sugar source selection in shaping honey quality and highlights potential drawbacks of substituting honey with sugar syrup in traditional beekeeping practices.

Abstract

In the global apiculture industry, reward feeding and supplementary feeding are essential for maintaining bee colonies. Beekeepers provide artificial supplements to their colonies, typically in the form of either a honey–water solution or sugar syrup. Owing to cost considerations associated with beekeeping, most beekeepers opt for sugar syrup. However, the effects of different types of artificial sugar supplements on bee colonies and their subsequent impact on honey composition remain unclear. To address this gap, this study compared the chemical composition, antioxidant capacity, and nutritional potency of three types of honey: honey derived from colonies fed sugar syrup (sugar-based product, SP) or a honey–water solution (honey-sourced honey, HH) and naturally sourced honey (flower-sourced honey, FH), which served as the control. The results revealed that FH outperformed HH and SP in terms of total acidity, sugar content, total protein content, and antioxidant capacity, and HH outperformed SP. Regarding nutritional efficacy, including the lifespan and learning and memory capabilities of worker bees, FH exhibited the best outcomes, with no significant differences observed between HH and SP. This study underscores the importance of sugar source selection in influencing honey quality and emphasizes the potential consequences of substituting honey with sugar syrup in traditional apiculture practices.

1. Introduction

Beekeeping boasts a rich history and a variety of bee-produced substances are utilized by humans. In recent times, bee products have gained significant importance in individuals’ dietary and healthcare practices [1]. Presently, bees and bee-derived products have emerged as focal points of global academic research, leading to advancements across various domains such as pollination, mutualistic symbiosis, apitherapy, and the pharmacological properties of bee products [2,3]. This underscores the significance of bees in scientific investigations concerning agricultural economics, ecosystems, and healthcare. Among the diverse array of bee products, honey stands out as the most widely utilized in daily life, finding extensive applications and serving as a traditional medicinal product [4,5].
Honey is a natural sweet substance stored by bees in bee combs through the collection and fermentation of plant nectar and honeydew [6]. It serves as a vital energy source for bees and is also a preferred sweetener for human consumption, playing a significant role in daily life and health-related preferences [7]. However, the physicochemical composition and nutritional potency of honey vary owing to factors such as the nectar source, production techniques, and beekeeping practices [8]. The quality of honey from different nectar sources can be assessed through physicochemical analysis, phenolic composition analysis, and chemometric evaluation [9]. Under natural conditions, nectar from flowers of honey-producing plants, along with honey stored in beehives, constitute the primary source of carbohydrates for bees [10].
Honey is widely recognized as a premium food product that serves as a natural food for bees [11]. During the rainy season or when honey sources are depleted, beekeepers must supplement the nutrition of the bee colony by providing sugar-based substances such as sugar syrup or honey–water [12]. However, overfeeding with sugar syrup can have detrimental effects on both the quality and composition of honey [13]. Undigested sugar syrup may be converted by bees into ‘sugar-based product’, thereby impacting the overall quality of honey within the colony [14,15]. Research had indicated that various sugar sources influence the growth and development of honey bees [16]. Honey had been found to enhance the activity of digestive enzymes in the midgut of overwintering bees, as well as promote the development of midgut tissues in these bees. Additionally, sucrose syrup and high fructose syrup had been shown to upregulate the expression of antioxidant genes in the midgut of overwintering bees [17]. The incidence of Nosema disease is higher in honey bees (Apis mellifera) fed with wheat starch syrup compared to those fed with honey or sugar syrup [18]. Furthermore, the composition and nutritional potency of mature honey produced from artificial sugar supplements that were not digested by worker bees, particularly the honeybee species Apis cerana, had not yet been studied. To address this gap, this study aimed to investigate the effects of supplementation with various sugar sources on the quality and composition of honey produced by Apis cerana bee colonies. To achieve this, bees were fed sugar syrup and honey–water solution, and mature honey- and sucrose-based products were obtained, referred to as sugar-based product (SP) and honey-sourced honey (HH), respectively. Additionally, flower-sourced honey (FH), obtained from undisturbed colonies, was used as a control. The nutritional potency and physicochemical composition of the two kinds of honey samples and one sample of a sugar-based product were analyzed. The results of this study would aim to compare the effects of different sugar sources provided as feed on the composition of honey and their impact on offspring bees and provide theoretical support for scientific beekeeping and the production of high-quality honey.

2. Materials and Methods

2.1. Sampling

Nine colonies of A. cerana with similar population sizes (approximately 10,000 bees per colony) were selected for the experiment. Prior to commencing the experiment, all honey was extracted from the honeycombs of the colonies using a standard stainless steel extraction centrifuge. Among these, three colonies were fed sugar syrup, whereas another three colonies were provided with a honey–water solution. Fresh sugar syrup and honey-water solutions with a sugar content of 50% were prepared daily and fed to the colonies. During daylight hours, the six colonies were managed within a closed system to prevent worker bees from venturing out to collect nectar. The remaining three bee colonies were left undisturbed to forage naturally for flower nectar. These colonies were bred and reared using conventional apicultural techniques between September and October 2021.
After 15 days of continuous feeding, mature honey was harvested from each colony. Initially, uncapped honey was extracted from the honeycomb using a honey extraction centrifuge. Subsequently, the honeycomb cappings from each colony were scraped off with a sterilized knife, and then honeycombs were processed in another standard honey extraction centrifuge to obtain the samples. The honey samples obtained from the sugar syrup-fed group were designated the sugar-based product (SP), and the honey from the honey–water-fed group was labeled as honey-sourced honey (HH). The honey gathered naturally from bee colonies foraging nectar was termed flower-sourced honey (FH).
In the honey production process, bee equipment such as honey extraction centrifuges, knives, and stainless-steel drums, must be cleaned, sterilized, and dried. All procedures were performed in hygienic facilities employing disinfection equipment adhering to the hygiene standards stipulated [19]. The extracted honey was stored at −20 °C prior to the experiments.

2.2. Methods

2.2.1. Physicochemical Analysis

The moisture content and total acidity of honey were assessed according to standardized methods established by the International Honey Commission [20]. Evaluation of amylase activity in honey samples was conducted through visible and near-infrared spectroscopy [21]. The total protein content of the samples was determined utilizing the Coomassie Brilliant Blue assay [22]. The levels of glucose, fructose, sucrose, and 5-hydroxymethyl furfuraldehyde (HMF) in honey were determined using high-performance liquid chromatography (Agilent, Palo Alto, CA, USA) [23,24].

2.2.2. Antioxidant Activity

Total Flavonoid and Total Phenolic Contents

The total flavonoid content of samples was determined using the aluminum chloride colorimetric method, and the total phenolic acid content was assessed using the Folin–Ciocalteu spectrophotometric method [25]. Honey was dissolved in ultrapure water and thoroughly mixed. Subsequently the honey–water solution was centrifuged. The supernatants of the centrifuged samples were then mixed with the respective reagents such as AlCl3 (XiLONG SCIENTIFIC, Shantou, China), Folin–Ciocalteu color developer (Yuanye, Shanghai, China), and Na2CO3 (XiLONG SCIENTIFIC, Shantou, China). After incubation, the mixture was transferred to a 96-well plate (Thermo Fisher Scientific, Waltham, MA, USA), and the absorbance of each sample was measured using a microplate reader (BioTek, Vermont, VT, USA). Each sample group was analyzed in quadruplicate. Standard curves were generated based on the standard solution concentrations and absorbance values to calculate the total flavonoid and phenolic acid contents of the FH, SP, and HH groups. The detailed steps followed were based on Hu’s method for determining the total flavonoid and phenolic acid content in centrifuged and pressed honey [26].

Antioxidant Activity Assays (Radical Scavenging Activity)

The antioxidant activities of the honey samples were evaluated using a 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging assay [27]. Additionally, the antioxidant activity of honey was assessed using a 2,2-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid (ABTS) radical scavenging assay [28]. These experiments were performed utilizing the total antioxidant capacity assay kit (ABTS microplate purchased from Yuanye, Shanghai, China). The detailed steps for the free radical scavenging experiment and the calculation of the half-inhibition concentration were performed in accordance with Hu’s method [26].

2.2.3. Effect of Honey with Different Sugar Sources on the Lifespan of Worker Bees

The effect of the three sugar sources on the lifespan of worker bees was assessed by the statistics of the lifespan of worker bees fed the three sugar sources. Frames with capped broods from three colonies of A. cerana, each with similar population sizes, were additionally selected from the same apiary as above. These frames were then transferred to a constant temperature and humidity chamber (T, 34 °C; RH, 75%, AIKANE, Shanghai, China). Worker bees newly emerged from the comb were randomly divided into four groups of around 100 bees and placed in specialized wooden boxes equipped with steel meshes on the upper and lower sides. These boxes were maintained in a chamber with constant temperature and humidity, and the worker bees were fed daily with sufficient flower-sourced honey, honey-sourced honey, sugar-based products, and sucrose solutions, with all solutions maintained at a total sugar content of 50%.
Continuous monitoring of the conditions within the specialized wooden boxes was conducted, and solutions containing various honey samples were replenished daily. Three days after the initiation of the feeding (to allow for acclimatization and excluding any potential damage to the worker bees during the transfer process), detailed records of dead worker bees are kept and then cleared daily until the entire colony perished. Subsequently, the effects of the three types of sugar sources on the lifespan of worker bees were assessed.

2.2.4. Effect of Honey with Different Sugar Sources on Learning and Memory of Worker Bees

To compare the effects of foods derived from three different sugar sources on learning and memory in honeybees, a proboscis extension response (PER) conditioning experiment was performed. Worker bees newly emerged from the comb were randomly divided into four groups of approximately 60 and fed as described above. The bees were maintained for 7 d under the aforementioned controlled temperature and humidity conditions. The experiment, which included newly emerged bees from the initial three colonies, was carried out as three independent biological replicates.
In accordance with the aforementioned feeding conditions, a subset of 30 worker bees aged 7 d was selected from each group for the PER conditioning experiment. Following Hu’s experimental method, CO2 was used to stun the worker bees, which were then briefly placed on ice for freeze-stunning [26]. Subsequently, each worker bee was carefully immobilized within a U-shaped metal tube to ensure a secure yet not overly constrictive position. The bees were then placed in a controlled environment with regulated temperature and humidity (T, 35 °C; RH, 75%) and subjected to a 2-h period of starvation. Worker bees in poor health and those that failed to respond to sugar water were removed. After training other worker bees through positive feedback stimulation (feeding sugar water after providing lemon odor) and negative feedback stimulation (not feeding sugar water after providing vanilla odor), the memory and learning abilities of the other worker bees were assessed based on the proboscis extension response behavior when positive feedback stimulation was provided [29].

2.2.5. Effect of Honey with Different Sugar Sources on the Expression of Learning- and Memory-Related Genes of Worker Bees

To assess gene expression related to learning and memory, three heads of 7-day-old worker bees were pooled together to create one sample, with each group consisting of three such composite samples [30]. The detailed steps for the extraction of total RNA and synthesis of cDNA were followed according to the protocol provided with the reagent kit (TransZol Up Plus RNA Kit, TransGen, Beijing, China; The PrimeScript™ RT Reagent Kit, Takara, Beijing, China).
GAPDH was selected as the internal reference gene based on learning- and memory-related genes (AcCREB, Acdop2, and Acdop3) in A. cerana [31]. These primers were synthesized by Shanghai Sangong Biotechnology Co. (Table 1).
The fluorescence quantification system and experimental procedures followed the methods outlined in the fluorescence quantification assay kit and Hu’s experimental protocol [26]. Each reaction was conducted with four technical replicates. The relative expression of each target gene was determined using the 2−ΔΔCt method [32].

2.3. Statistical Analysis

Data analysis was conducted using StatView (version 5.0) and GraphPad Prism software (version 9.0). Mean ± standard deviation (SD) was used to express the results. And the Pearson correlation coefficient test (r) was used to assess the linear relationship between the variables. Statistical comparisons of means were performed using analysis of variance (one-way ANOVA) and Tukey’s test, with the significance level set at p < 0.05.

3. Results

3.1. Physicochemical Analysis

Table 2 presents the results of the study. No significant differences were observed in the moisture content or amylase activities among the SP, HH, and FH groups (p > 0.05). The sucrose content of the SP group was significantly higher than that of the FH and HH groups (p < 0.0001), with no significant difference between the FH and HH groups (p > 0.05). Conversely, the fructose content of the FH group was significantly higher than that of the HH and SP group (p < 0.0001), whereas no significant difference was observed between the HH and SP groups (p = 0.2258).
The total acidity content was significantly higher in the SP group than in the FH and HH groups (p < 0.0001), and significantly higher in the HH group compared to the FH group (p < 0.0001). Additionally, the glucose and total protein contents were significantly higher in the FH group than in the HH and SP groups (p < 0.0001), and significantly higher in the HH group compared to the SP group (p < 0.0001; p = 0.0289). Hydroxymethylfurfural (HMF) was not detected in FH, HH, or SP samples.

3.2. Antioxidant Activity

3.2.1. Total Flavonoid and Total Phenolic Contents

The total flavonoid and phenolic contents of honey in the FH group were significantly higher than those in the HH and SP groups (p < 0.0001). Moreover, the HH group exhibited significantly higher levels compared to the SP group (p < 0.0001; p = 0.0016) (Figure 1A,B).

3.2.2. Radical Scavenging Activity

The IC50 represents the concentration required to scavenge 50% of the free radicals. Lower IC50 values indicate a better ability to scavenge free radicals and a higher antioxidant capacity. The IC50-DPPH and IC50-ABTS values of the SP group were significantly higher than those of the FH and HH groups (p < 0.0001). Furthermore, the HH group demonstrated significantly higher values compared to the FH group (p < 0.0001) (Figure 2).

3.3. Lifespan Analysis

As shown in Table 3 and Figure 3, the average lifespan of workers in the FH, HH, and SP groups was significantly longer than that of worker bees fed a sucrose solution (control group) (p < 0.0001, p = 0.0013, p = 0.0471). Additionally, the average lifespan of worker bees fed the FH diet was significantly longer than that of those fed the HH and SP diets (p = 0.0146, p = 0.0007).
The median lifespan of worker bees in the FH group was significantly higher than that in the HH, SP, and control groups (p = 0.0391, p = 0.0034 and p < 0.0001, respectively), whereas the HH group exhibited a significantly higher median lifespan compared to the control group (p = 0.0126). However, no significant differences in the median lifespan were observed between the HH and SP groups (p = 0.2247), nor between the SP and control groups (p = 0.0086).

3.4. Analysis of Memory and Learning Abilities

Learning and memory abilities of worker bees at 6 h and 24 h in the FH group were significantly higher than those in the SP, HH, and control groups (p = 0.0031, p = 0.0076; p = 0.0004, p = 0.0003; p < 0.0001, p < 0.0001). Conversely, the control group exhibited significantly lower abilities compared to the SP and HH groups (p = 0.0173, p = 0.0067; p = 0.0158, p = 0.0137). Interestingly, no significant difference in learning and memory abilities was observed between the SP and HH groups at both 6 and 24 h (p = 0.5436, p = 0.9252) (Figure 4).

3.5. Gene Expression Analysis

The relative expression levels of Acdop2, Acdop3, and AcCREB were significantly higher in the FH group compared to the HH, SP, and control groups (p < 0.0001). Conversely, the control group showed significantly lower expression levels compared to the HH group (p < 0.0001, p = 0.0080 and p = 0.0007, respectively). The relative expression of AcCREB was significantly higher in the HH group compared to the SP group (p < 0.0001), and the relative expression of Acdop2 was significantly higher in the SP group compared to the control group (p < 0.0001). Notably, no significant differences in the relative expression levels of Acdop2 and Acdop3 were observed between the SP and HH groups (p = 0.4320 and p = 0.2040, respectively), nor in the expression of Acdop3 between the control and SP groups (p = 0.1441) (Figure 5).

4. Discussion

Within the global apiculture industry, rewards and supplementary feeding play pivotal roles in maintaining bee colonies. Currently, sugar syrup and honey serve as the primary feed sources for bee colonies, with honey being widely regarded as the superior option [33]. However, in traditional apiculture, many beekeepers have resorted to the detrimental practice of substituting honey with sugar syrup for economic gains. This feeding method results in compromised health among bees within colonies, consequently leading to a decline in honey quality [8,34]. However, there exists a paucity of research on the effects of different sugar sources on honey quality. Therefore, this study aimed to assess the disparities in honey quality and nutritional efficacy resulting from the use of three distinct sugar sources.
Moisture content is one of the most critical indicators for evaluating honey quality, as the water content of honey indirectly influences its stability [35]. The results indicated that the moisture content of honey formed from all three sugar sources was slightly higher than the industry standards and showed no significant differences between the three groups. This is attributable to the fact that the experimental samples comprised mature honey formed through the thorough fermentation of the three sugar sources by bees. Furthermore, the moisture content of honey usually varies depending on the region of origin and the season, and is particularly high in the honey of A. cerana from Southern China [36]. Chemical and physical parameters such as HMF content, total acidity, and amylase value serve as important indicators of honey freshness and quality [37,38]. According to the experimental results, no HMF was detected in any of the honey samples. This is primarily because the honey samples produced in the experiment were freshly harvested and did not undergo extended storage or processing outside the hive. The amylase values of the three groups of honey samples exhibited no significant differences and exceeded industry standards, possibly because of the consistent experimental conditions, including bee species, environment, honey fermentation, and storage time, without any additional processing [39]. However, the acidity of FH was the lowest, followed by that of the HH, with SP displaying the highest acidity. This disparity may be attributed to the abundance of alkaline vitamin B present in pollen, which is stored in honey after being processed by bees, thus influencing its acidity [40]. Concurrently, the total protein content was the highest in FH, followed by HH, and lowest in SP. The primary reason for this trend may be the nutritional simplicity of sugar syrup as a feeding source, whereas flower nectar and pollen contain a rich array of nutrients, such as amino acids, proteins, vitamins, phenolics, and lipids. In contrast, honey is the product of bees freely collecting flower nectar and processing it [41].
Honey has extensive biomedical applications owing to its anti-inflammatory and antibacterial properties [42]. Research indicates that FH boasts the highest total flavonoid and phenolic acid content, along with the most potent free radical scavenging capacity, followed by HH. This suggests a hierarchy in their antioxidant capabilities: FH > HH > SP. This phenomenon is attributed to the abundance of polyphenolic compounds in the nectar consumed by bees; consequently, honey produced through nectar-processing also contains polyphenolic compounds [43].
Given their remarkable learning and memory abilities, bees can execute a range of complex social behaviors [44]. The nutritional aspects of food are crucial for the normal growth and reproduction of bees, especially affecting their lifespan and neurodevelopment [45]. In this study, bee lifespan was assessed using cage-rearing management experiments, and a PER experiment was conducted to evaluate the learning and memory abilities of bees [46]. In both the worker bee lifespan and PER experimental results, the average lifespan and learning–memory capabilities of bees in all experimental groups significantly surpassed those in the control group. The FH group exhibited the highest values, whereas the HH and SP groups showed no significant differences. This can be attributed to the fact that honey samples comprise a mixture of glucose, fructose, and sucrose, offering superior nutritional content compared to sucrose in the control group, with FH containing rich nutritional substances [47]. Furthermore, the polyphenols in honey are beneficial for brain development [48], indicating that feeding sugar syrup to bee colonies that lack adequate feed cannot fulfill the nutritional requirements of the bees. In addition, it can affect neurological development, resulting in decreased learning ability and lifespan.
To investigate the impact of feeds derived from different sugar sources on bee neurological development, experiments were conducted to assess their influence on learning- and memory-related gene expression. This study assessed the relative expression levels of three learning- and memory-related genes (AcCREB, Acdop2, and Acdop3) in 7-day-old worker bees fed different honey samples. Dopamine, a crucial neurotransmitter, regulates diverse behaviors and physiological processes, particularly learning and memory, by promoting CREB phosphorylation via receptor activation [49]. AcCREB regulates the transcription of specific genes, enhances neural cell connections, influences neuronal development, and participates in memory processes [50,51]. Acdop2 is involved in bee motor behavior [52], while Acdop3 is activated by a major component of the mandibular pheromone of the queen bee, high vanilla alcohol, inducing changes in cAMP levels in the brain and resulting in memory formation [53]. The relative expression of AcCREB in worker bees from the FH, SP, and HH groups was significantly higher than that of the control group. The FH group exhibited significantly higher levels than both the SP and HH groups, and the HH group displayed significantly higher levels than the SP group. This disparity can be attributed to the fact that FH originates from multiple nectar sources containing rich nutrients, as indicated by the aforementioned physicochemical parameters. Additionally, honey contains abundant nutrients derived from nectar following secondary metabolism. In terms of gene expression, the relative expression levels of Acdop3 in worker bees in the FH and HH groups were significantly higher than those in worker bees in the control group. The FH group surpassed the SP and HH groups significantly; however, the SP group showed no significant difference compared with the HH and control groups. These findings may be attributed not only to differences in physicochemical parameters but also to variations in the content of vitamins B and C in honey produced from different sugar sources, thus impacting the quality and nutritional efficacy of honey [54,55]. This resulted in the following quality and efficacy hierarchy: FH > HH > SP > sucrose solution. The absence of significant differences in Acdop2 and Acdop3 expression between the SP and HH groups may stem from the presence of more naturally active substances from wildflower nectar in pure honey. The active compounds in honey-sourced honey may be influenced by the consumption of honey within the bee colony, affecting its proportion and efficacy. Further research and validation are necessary to confirm this hypothesis.

5. Conclusions

This study compared the physicochemical composition, antioxidant capacity, and nutritional efficacy of SP, HH, and FH. The results revealed that FH outperformed HH and SP in terms of total acidity, sugar content, total protein content, and antioxidant capacity. Furthermore, HH exhibited superior performance compared to SP in these aspects. When considering nutritional efficacy, including the lifespan and learning–memory capabilities of worker bees, FH demonstrated the highest values, with no significant differences observed between HH and SP.
In summary, the overall nutritional composition of honey ranked as follows: FH > HH > SP. The overall nutritional potency of honey followed the same order: FH > HH > SP > sucrose solution. Consequently, beekeepers are advised to minimize the practice of substituting honey with sugar syrup to ensure the health of bee colonies and maintain the quality of honey.

Author Contributions

Conceptualization, Y.H., Q.P. and X.W.; Methodology, Y.H., Q.P. and X.W.; Investigation, Y.H., J.L. and X.S.; Data curation, Y.H.; Writing—original draft, Y.H.; Writing—review & editing, Y.H., J.L., X.S. and X.W.; Supervision, X.W.; Project administration, X.W.; Funding acquisition, X.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key R&D Program of China (2022YFD1600205), and the Science and Technology Project of Jiangxi Province (20181ACF60006).

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Attia, Y.A.; Giorgio, G.M.; Addeo, N.F.; Asiry, K.A.; Piccolo, G.; Nizza, A.; Di Meo, C.; Alanazi, N.A.; Al-Qurashi, A.D.; El-Hack, M.E.A. COVID-19 pandemic: Impacts on bees, beekeeping, and potential role of bee products as antiviral agents and immune enhancers. Environ. Sci. Pollut. Res. 2022, 29, 9592–9605. [Google Scholar] [CrossRef] [PubMed]
  2. Didaras, N.A.; Karatasou, K.; Dimitriou, T.G.; Amoutzias, G.D.; Mossialos, D. Antimicrobial activity of bee-collected pollen and beebread: State of the art and future perspectives. Antibiotics 2020, 9, 811. [Google Scholar] [CrossRef] [PubMed]
  3. El Ghouizi, A.; Bakour, M.; Laaroussi, H.; Ousaaid, D.; El Menyiy, N.; Hano, C.; Lyoussi, B. Bee pollen as functional food: Insights into its composition and therapeutic properties. Antioxidants 2023, 12, 557. [Google Scholar] [CrossRef] [PubMed]
  4. Zaheen, Z.; Yatoo, A.M.; Ali, S.; Ali, M.N.; Majid, S.; Rasool, S.; Rashid, S.M.; Ahmad, S.B.; Mir, M.u.R.; Zehra, U. Honey: Types, composition and antimicrobial mechanisms. Ther. Appl. Honey Phytochem. 2020, 1, 193–214. [Google Scholar]
  5. Kuropatnicki, A.K.; Kłósek, M.; Kucharzewski, M. Honey as medicine: Historical perspectives. J. Apic. Res. 2018, 57, 113–118. [Google Scholar] [CrossRef]
  6. Tafere, D.A. Chemical composition and uses of honey: A review. J. Food Sci. Nutr. Res. 2021, 4, 194–201. [Google Scholar]
  7. Ahmad, R.S.; Hussain, M.B.; Saeed, F.; Waheed, M.; Tufail, T. Phytochemistry, metabolism, and ethnomedical scenario of honey: A concurrent review. Int. J. Food Prop. 2017, 20, S254–S269. [Google Scholar] [CrossRef]
  8. Sperandio, G.; Simonetto, A.; Carnesecchi, E.; Costa, C.; Hatjina, F.; Tosi, S.; Gilioli, G. Beekeeping and honey bee colony health: A review and conceptualization of beekeeping management practices implemented in Europe. Sci. Total Environ. 2019, 696, 133795. [Google Scholar] [CrossRef]
  9. Zhang, X.-H.; Qing, X.-D.; Mu, S.-T.; Wang, D.; Zheng, J.-J.; Zhou, S.-J.; Kang, C.; Liu, Z. Authentication of honey of different nectar sources and antioxidant property evaluation by phenolic composition analysis with chemometrics. Food Control 2021, 124, 107900. [Google Scholar] [CrossRef]
  10. Soares, S.; Amaral, J.S.; Oliveira, M.B.P.; Mafra, I. A comprehensive review on the main honey authentication issues: Production and origin. Compr. Rev. Food Sci. Food Saf. 2017, 16, 1072–1100. [Google Scholar] [CrossRef]
  11. Fakhlaei, R.; Selamat, J.; Khatib, A.; Razis, A.F.A.; Sukor, R.; Ahmad, S.; Babadi, A.A. The toxic impact of honey adulteration: A review. Foods 2020, 9, 1538. [Google Scholar] [CrossRef]
  12. Landaverde, R.; Rodriguez, M.T.; Parrella, J.A. Honey production and climate change: Beekeepers’ perceptions, farm adaptation strategies, and information needs. Insects 2023, 14, 493. [Google Scholar] [CrossRef] [PubMed]
  13. Siddiqui, A.J.; Musharraf, S.G.; Choudhary, M.I. Application of analytical methods in authentication and adulteration of honey. Food Chem. 2017, 217, 687–698. [Google Scholar] [CrossRef] [PubMed]
  14. Guler, A.; Bakan, A.; Nisbet, C.; Yavuz, O. Determination of important biochemical properties of honey to discriminate pure and adulterated honey with sucrose (Saccharum Officinarum L.) syrup. Food Chem. 2007, 105, 1119–1125. [Google Scholar] [CrossRef]
  15. Kamal, M.M.; Rashid, M.H.U.; Mondal, S.C.; El Taj, H.F.; Jung, C. Physicochemical and microbiological characteristics of honey obtained through sugar feeding of bees. J. Food Sci. Technol. 2019, 56, 2267–2277. [Google Scholar] [CrossRef] [PubMed]
  16. Kaftanoglu, O.; Linksvayer, T.A.; Page, R.E., Jr. Rearing honey bees, apis mellifera, in vitro i: Effects of sugar concentrations on survival and development. J. Insect Sci. 2011, 11, 96. [Google Scholar] [CrossRef] [PubMed]
  17. Liu, C.; Xu, B.; Liu, Z.; Wang, Y.; Wang, H. Effects of different overwintering feeds on midgut digestive enzyme activities, tissue development status and antioxidant enzyme gene expression of honeybees. Chin. J. Anim. Nutr. 2017, 29, 1183–1190. [Google Scholar]
  18. Papežíková, I.; Palíková, M.; Syrová, E.; Zachová, A.; Somerlíková, K.; Kováčová, V.; Pecková, L. Effect of feeding honey bee (apis mellifera hymenoptera: Apidae) colonies with honey, sugar solution, inverted sugar, and wheat starch syrup on nosematosis prevalence and intensity. J. Econ. Entomol. 2020, 113, 26–33. [Google Scholar] [CrossRef] [PubMed]
  19. FAO; WHO. Recommended international code of practice general principles of food hygiene. CAC/RCP Rev. 2003, 4, 1–1969. [Google Scholar]
  20. Thrasyvoulou, A.; Tananaki, C.; Goras, G.; Karazafiris, E.; Dimou, M.; Liolios, V.; Kanelis, D.; Gounari, S. Legislation of honey criteria and standards. J. Apic. Res. 2018, 57, 88–96. [Google Scholar] [CrossRef]
  21. Huang, Z.; Liu, L.; Li, G.; Li, H.; Ye, D.; Li, X. Nondestructive determination of diastase activity of honey based on visible and near-infrared spectroscopy. Molecules 2019, 24, 1244. [Google Scholar] [CrossRef] [PubMed]
  22. Song, Y.-Q.; Milne, R.I.; Zhou, H.-X.; Ma, X.-L.; Fang, J.-Y.; Zha, H.-G. Floral nectar chitinase is a potential marker for monofloral honey botanical origin authentication: A case study from loquat (Eriobotrya japonica lindl.). Food Chem. 2019, 282, 76–83. [Google Scholar] [CrossRef] [PubMed]
  23. Soyseven, M.; Sezgin, B.; Arli, G. A novel, rapid and robust hplc-elsd method for simultaneous determination of fructose, glucose and sucrose in various food samples: Method development and validation. J. Food Compos. Anal. 2022, 107, 104400. [Google Scholar] [CrossRef]
  24. Mehrotra, S.; Rai, P.; Sharma, S.K. A quick and simple paper-based method for detection of furfural and 5-hydroxymethylfurfural in beverages and fruit juices. Food Chem. 2022, 377, 131532. [Google Scholar] [CrossRef] [PubMed]
  25. Otmani, A.; Amessis-Ouchemoukh, N.; Birinci, C.; Yahiaoui, S.; Kolayli, S.; Rodríguez-Flores, M.S.; Escuredo, O.; Seijo, M.C.; Ouchemoukh, S. Phenolic compounds and antioxidant and antibacterial activities of algerian honeys. Food Biosci. 2021, 42, 101070. [Google Scholar] [CrossRef]
  26. Hu, Y.; Li, Z.; Wang, S.; Wu, X. The difference in composition and nutritional potency of honey extracted by centrifugation and pressed processes. Food Qual. Saf. 2023, 7, fyad018. [Google Scholar] [CrossRef]
  27. Ibrahimi, H.; Hajdari, A. Phenolic and flavonoid content, and antioxidant activity of honey from Kosovo. J. Apic. Res. 2020, 59, 452–457. [Google Scholar] [CrossRef]
  28. Simonetti, A.; Perna, A.; Grassi, G.; Gambacorta, E. Antioxidant activity of different cheese-honey combinations before and after in vitro gastrointestinal digestion. LWT 2020, 131, 109725. [Google Scholar] [CrossRef]
  29. Ali, H.; Iqbal, J.; Raweh, H.S.; Alqarni, A.S. Proboscis behavioral response of four honey bee apis species towards different concentrations of sucrose, glucose, and fructose. Saudi J. Biol. Sci. 2021, 28, 3275–3283. [Google Scholar] [CrossRef] [PubMed]
  30. Wu, X.; Li, Z.; Yang, H.; He, X.; Yan, W.; Zeng, Z. The adverse impact on lifespan, immunity, and forage behavior of worker bees (apis mellifera linnaeus 1758) after exposure to flumethrin. Sci. Total Environ. 2023, 858, 160146. [Google Scholar] [CrossRef]
  31. Liao, C.; Yuan, A.; Wu, X.; Guo, Y. Effects of vitamin b2 on lifespan and learning memory ability of worker bees for apis cerana cerana. Chin. J. Anim. Nutr. 2016, 28, 3346–3351. [Google Scholar]
  32. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2−δδct method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  33. Wakgari, M.; Yigezu, G. Honeybee keeping constraints and future prospects. Cogent Food Agric. 2021, 7, 1872192. [Google Scholar] [CrossRef]
  34. Wang, W.; Liu, T.; Wu, X.; Zhang, F. Effect of high fructose syrup diet exposure on honeybee colony (Apis mellifera ligustica). Acta Agric. Univ. Jiangxiensis 2012, 34, 5. [Google Scholar]
  35. Singh, I.; Singh, S. Honey moisture reduction and its quality. J. Food Sci. Technol. 2018, 55, 3861–3871. [Google Scholar] [CrossRef] [PubMed]
  36. Engidaw, D.; Alemayehu, K.; Mustofa, S.; Tilahun, A. Effect of season on the major physico-chemical parameters of honey product. Food Environ. Saf. J. 2020, 19, 14–24. [Google Scholar]
  37. Živkov Baloš, M.; Popov, N.; Jakšić, S.; Mihaljev, Ž.; Pelić, M.; Ratajac, R.; Ljubojević Pelić, D. Sunflower honey—Evaluation of quality and stability during storage. Foods 2023, 12, 2585. [Google Scholar] [CrossRef] [PubMed]
  38. Ma, T.; Zhao, H.; Liu, C.; Zhu, M.; Gao, H.; Cheng, N.; Cao, W. Discrimination of natural mature acacia honey based on multi-physicochemical parameters combined with chemometric analysis. Molecules 2019, 24, 2674. [Google Scholar] [CrossRef] [PubMed]
  39. Eshete, Y.; Eshete, T. A review on the effect of processing temperature and time duration on commercial honey quality. Madridge J. Food Technol. 2019, 4, 158–162. [Google Scholar] [CrossRef]
  40. De Arruda, V.A.S.; Pereira, A.A.S.; de Freitas, A.S.; Barth, O.M.; de Almeida-Muradian, L.B. Dried bee pollen: B complex vitamins, physicochemical and botanical composition. J. Food Compos. Anal. 2013, 29, 100–105. [Google Scholar] [CrossRef]
  41. Parachnowitsch, A.L.; Manson, J.S.; Sletvold, N. Evolutionary ecology of nectar. Ann. Bot. 2019, 123, 247–261. [Google Scholar] [CrossRef] [PubMed]
  42. Silva, B.; Biluca, F.C.; Gonzaga, L.V.; Fett, R.; Dalmarco, E.M.; Caon, T.; Costa, A.C.O. In vitro anti-inflammatory properties of honey flavonoids: A review. Food Res. Int. 2021, 141, 110086. [Google Scholar] [CrossRef]
  43. Brudzynski, K. Honey as an ecological reservoir of antibacterial compounds produced by antagonistic microbial interactions in plant nectars, honey and honey bee. Antibiotics 2021, 10, 551. [Google Scholar] [CrossRef] [PubMed]
  44. Yan, H.; Liebig, J. Genetic basis of chemical communication in eusocial insects. Genes Dev. 2021, 35, 470–482. [Google Scholar] [CrossRef] [PubMed]
  45. Berenbaum, M.R.; Calla, B. Honey as a functional food for apis mellifera. Annu. Rev. Entomol. 2021, 66, 185–208. [Google Scholar] [CrossRef] [PubMed]
  46. Shi, J.-L.; Liao, C.-H.; Wang, Z.-L.; Wu, X.-B. Effect of royal jelly on longevity and memory-related traits of Apis mellifera workers. J. Asia-Pac. Entomol. 2018, 21, 1430–1433. [Google Scholar] [CrossRef]
  47. Tosun, M.; Keles, F. Investigation methods for detecting honey samples adulterated with sucrose syrup. J. Food Compos. Anal. 2021, 101, 103941. [Google Scholar] [CrossRef]
  48. El-Seedi, H.R.; Khalifa, S.A.; Abd El-Wahed, A.; Gao, R.; Guo, Z.; Tahir, H.E.; Zhao, C.; Du, M.; Farag, M.A.; Musharraf, S.G. Honeybee products: An updated review of neurological actions. Trends Food Sci. Technol. 2020, 101, 17–27. [Google Scholar] [CrossRef]
  49. Berke, J.D. What does dopamine mean? Nat. Neurosci. 2018, 21, 787–793. [Google Scholar] [CrossRef] [PubMed]
  50. Silva, A.J.; Kogan, J.H.; Frankland, P.W.; Kida, S. Creb and memory. Annu. Rev. Neurosci. 1998, 21, 127–148. [Google Scholar] [CrossRef] [PubMed]
  51. Chowdhury, M.A.R.; An, J.; Jeong, S. The pleiotropic face of creb family transcription factors. Mol. Cells 2023, 46, 399–413. [Google Scholar] [CrossRef] [PubMed]
  52. Mustard, J.A.; Pham, P.M.; Smith, B.H. Modulation of motor behavior by dopamine and the d1-like dopamine receptor amdop2 in the honey bee. J. Insect Physiol. 2010, 56, 422–430. [Google Scholar] [CrossRef] [PubMed]
  53. Baracchi, D.; Cabirol, A.; Devaud, J.-M.; Haase, A.; d’Ettorre, P.; Giurfa, M. Pheromone components affect motivation and induce persistent modulation of associative learning and memory in honey bees. Commun. Biol. 2020, 3, 447. [Google Scholar] [CrossRef] [PubMed]
  54. Ragab, M.A.; El-Yazbi, A.F.; El-Hawiet, A. Fast economic electrochemical assay for vitamins and heavy mineral components in honey samples of different botanical origin. Microchem. J. 2020, 155, 104770. [Google Scholar] [CrossRef]
  55. Sawicki, T.; Bączek, N.; Starowicz, M. Characterisation of the total phenolic, vitamins c and e content and antioxidant properties of the beebread and honey from the same batch. Czech J. Food Sci. 2020, 38, 158–163. [Google Scholar] [CrossRef]
Insects 15 00344 g001
Figure 1. Effect of sugar source on total flavonoid content (A) and total phenolic content (B) in flower-sourced honey (FH), honey-sourced honey (HH) and sugar-based product (SP). (According to Tukey’s test, different letters in the same column denote significant differences between values (p < 0.05), whereas the same letters denote no significant difference (p > 0.05)).
Figure 1. Effect of sugar source on total flavonoid content (A) and total phenolic content (B) in flower-sourced honey (FH), honey-sourced honey (HH) and sugar-based product (SP). (According to Tukey’s test, different letters in the same column denote significant differences between values (p < 0.05), whereas the same letters denote no significant difference (p > 0.05)).
Insects 15 00344 g001
Insects 15 00344 g002
Figure 2. Effect of sugar source on radical scavenging activity (IC50-DPPH and IC50-ABTS assays) for the flower-sourced honey (FH), honey-sourced honey (HH), and sugar-based product (SP). (According to Tukey’s test, different letters in the same column denote significant differences between values (p < 0.05), whereas the same letters denote no significant difference (p > 0.05)).
Figure 2. Effect of sugar source on radical scavenging activity (IC50-DPPH and IC50-ABTS assays) for the flower-sourced honey (FH), honey-sourced honey (HH), and sugar-based product (SP). (According to Tukey’s test, different letters in the same column denote significant differences between values (p < 0.05), whereas the same letters denote no significant difference (p > 0.05)).
Insects 15 00344 g002
Insects 15 00344 g003
Figure 3. Effects of sugar-based product, honey-sourced honey, and flower-sourced honey on the survival of A. cerana workers.
Figure 3. Effects of sugar-based product, honey-sourced honey, and flower-sourced honey on the survival of A. cerana workers.
Insects 15 00344 g003
Insects 15 00344 g004
Figure 4. Effects of different sugar sources of honey on the learning and memory abilities of worker bees (A. cerana). Different letters above bars indicate significant differences between groups (ANOVA test, p < 0.05), whereas the same letters indicate no significant difference (p > 0.05).
Figure 4. Effects of different sugar sources of honey on the learning and memory abilities of worker bees (A. cerana). Different letters above bars indicate significant differences between groups (ANOVA test, p < 0.05), whereas the same letters indicate no significant difference (p > 0.05).
Insects 15 00344 g004
Insects 15 00344 g005
Figure 5. Relative expression level of genes involved in the learning and memory of worker bees and effects of different honey on the relative expression levels of worker bees. The internal control gene in each group was GAPDH. Different letters above bars indicate significant differences between groups (ANOVA test, p < 0.05), whereas the same letters indicate no significant difference (p > 0.05).
Figure 5. Relative expression level of genes involved in the learning and memory of worker bees and effects of different honey on the relative expression levels of worker bees. The internal control gene in each group was GAPDH. Different letters above bars indicate significant differences between groups (ANOVA test, p < 0.05), whereas the same letters indicate no significant difference (p > 0.05).
Insects 15 00344 g005
Table 1. Gene primers used in the fluorescence quantitative PCR.
Table 1. Gene primers used in the fluorescence quantitative PCR.
Gene NamesForward Primer (5′—3′)Reverse Primer (5′—3′)
AcCREBTGAAAATCCAGTTTGATCATTCGATTTCAAATAATCAGCAAATCATGCAC
Acdop2TTGGTTCTCCCTCTCTCCGACCAAGAGGTCACTATGAATGCG
Acdop3AGAAGGACAAGAAAAATGCCGCCAAGAGGTCACTATGAATGCG
GAPDHGCTGGTTTCATCGATGGTTTACGATTTCGACCACCGTAA
Table 2. Results of physicochemical analysis of the flower-sourced honey, honey-sourced honey, and sugar-based product.
Table 2. Results of physicochemical analysis of the flower-sourced honey, honey-sourced honey, and sugar-based product.
ProcessGroups
Flower-Sourced HoneyHoney-Sourced HoneySugar-Based Product
Moisture %21.660 ± 0.337 a22.393 ± 0.547 a22.213 ± 0.348 a
Amylase activity [mL/(g·h)]27.149 ± 0.742 a27.030 ± 0.231 a26.868 ± 1.025 a
Total acidity (mL/kg)24.594 ± 0.675 a28.425 ± 0.455 b37.829 ± 0.525 c
Fructose %33.426 ± 0.609 a30.427 ± 0.026 b29.387 ± 1.748 b
Sucrose %1.526 ± 0.044 a1.585 ± 0.023 a4.849 ± 0.396 b
Glucose %43.807 ± 1.654 a35.010 ± 0.076 b26.986 ± 1.207 c
Total proteins (mg/100 g)39.725 ± 3.421 a21.571 ± 3.929 b16.817 ± 3.124 c
HMF (mL/kg)NDNDND
According to Tukey’s test, different letters in the same column denote significant differences between values (p < 0.05), whereas the same letters denote no significant difference (p > 0.05).
Table 3. Effects of different types of nutrition on the average lifespan of worker bees.
Table 3. Effects of different types of nutrition on the average lifespan of worker bees.
GroupsAverage Lifespan/DaysMedian/DaysSample Size
FH26.743 ± 1.707 a26.500 ± 0.500 a236
HH23.867 ± 0.121 b23.500 ± 0.500 b211
SP22.198 ± 0.543 b21.833 ± 1.041 bc237
Control20.257 ± 1.059 c20.000 ± 2.074 c256
According to Tukey’s test, different letters in the same column denote significant differences between values (p < 0.05), whereas the same letters denote no significant difference (p > 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hu, Y.; Liu, J.; Pan, Q.; Shi, X.; Wu, X. Effects of Artificial Sugar Supplementation on the Composition and Nutritional Potency of Honey from Apis cerana. Insects 2024, 15, 344. https://doi.org/10.3390/insects15050344

AMA Style

Hu Y, Liu J, Pan Q, Shi X, Wu X. Effects of Artificial Sugar Supplementation on the Composition and Nutritional Potency of Honey from Apis cerana. Insects. 2024; 15(5):344. https://doi.org/10.3390/insects15050344

Chicago/Turabian Style

Hu, Yueyang, Jianhui Liu, Qizhong Pan, Xinxin Shi, and Xiaobo Wu. 2024. "Effects of Artificial Sugar Supplementation on the Composition and Nutritional Potency of Honey from Apis cerana" Insects 15, no. 5: 344. https://doi.org/10.3390/insects15050344

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop