Sea Buckthorn Polysaccharide Ameliorates Colitis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals Treatments and Sample Collection
2.2. Fecal Microbiota Transplantation
2.3. Histological Analysis
2.4. Measurements of Antioxidant and Inflammation Indexes
2.5. RNA Extraction and Quantification of Gene Expression
2.6. Quantifcation of SCFAs Profiles
2.7. Microbial Community Analysis
2.8. Microbiota Data Analysis
2.9. Statistical Analysis
3. Results
3.1. Prophylactic SBP Supplementation Attenuated Colitis Symptoms
3.2. Prophylactic SBP Suppressed DSS-Induced Inflammation
3.3. Prophylactic SBP Ameliorated DSS-Induced Oxidative Stress
3.4. Prophylactic SBP Improves Intestinal Integrity and Mucosal Barrier Function
3.5. Effects of SBP and DSS on Gut Microbiota
3.6. Effects of SBP and DSS on SCFAS
3.7. SBP-FMT Contributed to Alleviating Colitis Symptoms
3.8. SBP-FMT Alleviated DSS-Induced Inflammation
3.9. SBP-FMT Alleviated DSS-Induced Oxidative Stress
3.10. Regulation of SBP-FMT on Intestinal Integrity
3.11. Impacts of SBP-FMT on the Gastrointestinal Microbiome
3.12. Effects of SBP-FMT on SCFAS
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Frank, D.N.; St Amand, A.L.; Feldman, R.A.; Boedeker, E.C.; Harpaz, N.; Pace, N.R. Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc. Natl. Acad. Sci. USA 2007, 104, 13780–13785. [Google Scholar] [CrossRef]
- Ramos, G.P.; Papadakis, K.A. Mechanisms of Disease: Inflammatory Bowel Diseases. Mayo Clin. Proc. 2019, 94, 155–165. [Google Scholar] [CrossRef] [PubMed]
- Bouma, G.; Strober, W. The immunological and genetic basis of inflammatory bowel disease. Nat. Rev. Immunol. 2003, 3, 521–533. [Google Scholar] [CrossRef] [PubMed]
- Aniwan, S.; Park, S.H.; Loftus, E.V. Epidemiology, Natural History, and Risk Stratification of Crohn’s Disease. Gastroenterol. Clin. N. Am. 2017, 46, 463–480. [Google Scholar] [CrossRef] [PubMed]
- Ng, S.C.; Shi, H.Y.; Hamidi, N.; Underwood, F.E.; Tang, W.; Benchimol, E.I.; Panaccione, R.; Ghosh, S.; Wu, J.C.Y.; Chan, F.K.L.; et al. Worldwide incidence and prevalence of inflammatory bowel disease in the 21st century: A systematic review of population-based studies. Lancet 2017, 390, 2769–2778. [Google Scholar] [CrossRef] [PubMed]
- Shouval, D.S.; Rufo, P.A. The Role of Environmental Factors in the Pathogenesis of Inflammatory Bowel Diseases: A Review. JAMA Pediatr. 2017, 171, 999–1005. [Google Scholar] [CrossRef]
- Sartor, R.B.; Wu, G.D. Roles for Intestinal Bacteria, Viruses, and Fungi in Pathogenesis of Inflammatory Bowel Diseases and Therapeutic Approaches. Gastroenterology 2017, 152, 327–339.e4. [Google Scholar] [CrossRef]
- Gilbert, J.A.; Quinn, R.A.; Debelius, J.; Xu, Z.Z.; Morton, J.; Garg, N.; Jansson, J.K.; Dorrestein, P.C.; Knight, R. Microbiome-wide association studies link dynamic microbial consortia to disease. Nature 2016, 535, 94–103. [Google Scholar] [CrossRef]
- Wang, Y.; Gao, X.; Ghozlane, A.; Hu, H.; Li, X.; Xiao, Y.; Li, D.; Yu, G.; Zhang, T. Characteristics of Faecal Microbiota in Paediatric Crohn’s Disease and Their Dynamic Changes During Infliximab Therapy. J. Crohn’s Colitis 2017, 12, 337–346. [Google Scholar] [CrossRef]
- Corrêa-Oliveira, R.; Fachi, J.L.; Vieira, A.; Sato, F.T.; Vinolo, M.A.R. Regulation of immune cell function by short-chain fatty acids. Clin. Transl. Immunol. 2016, 5, e73. [Google Scholar] [CrossRef]
- Furusawa, Y.; Obata, Y.; Fukuda, S.; Endo, T.A.; Nakato, G.; Takahashi, D.; Nakanishi, Y.; Uetake, C.; Kato, K.; Kato, T.; et al. Commensal microbe-derived butyrate induces the differentiation of colonic regulatory T cells. Nature 2013, 504, 446–450. [Google Scholar] [CrossRef] [PubMed]
- Parada Venegas, D.; De la Fuente, M.K.; Landskron, G.; González, M.J.; Quera, R.; Dijkstra, G.; Harmsen, H.J.M.; Faber, K.N.; Hermoso, M.A. Short Chain Fatty Acids (SCFAs)-Mediated Gut Epithelial and Immune Regulation and Its Relevance for Inflammatory Bowel Diseases. Front. Immunol. 2019, 10, 277. [Google Scholar] [CrossRef] [PubMed]
- Tan, J.K.; Macia, L.; Mackay, C.R. Dietary fiber and SCFAs in the regulation of mucosal immunity. J. Allergy Clin. Immunol. 2022, 151, 361–370. [Google Scholar] [CrossRef] [PubMed]
- Ni, J.; Wu, G.D.; Albenberg, L.; Tomov, V.T. Gut microbiota and IBD: Causation or correlation? Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 573–584. [Google Scholar] [CrossRef] [PubMed]
- Federici, S.; Kredo-Russo, S.; Valdés-Mas, R.; Kviatcovsky, D.; Weinstock, E.; Matiuhin, Y.; Silberberg, Y.; Atarashi, K.; Furuichi, M.; Oka, A.; et al. Targeted suppression of human IBD-associated gut microbiota commensals by phage consortia for treatment of intestinal inflammation. Cell 2022, 185, 2879–2898.e24. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Huang, S.; Li, T.; Li, N.; Han, D.; Zhang, B.; Xu, Z.Z.; Zhang, S.; Pang, J.; Wang, S.; et al. Gut microbiota from green tea polyphenol-dosed mice improves intestinal epithelial homeostasis and ameliorates experimental colitis. Microbiome 2021, 9, 184. [Google Scholar] [CrossRef] [PubMed]
- Weingarden, A.R.; Vaughn, B.P. Intestinal microbiota, fecal microbiota transplantation, and inflammatory bowel disease. Gut Microbes 2017, 8, 238–252. [Google Scholar] [CrossRef]
- Zhang, W.; Zou, G.; Li, B.; Du, X.; Sun, Z.; Sun, Y.; Jiang, X. Fecal Microbiota Transplantation (FMT) Alleviates Experimental Colitis in Mice by Gut Microbiota Regulation. J. Microbiol. Biotechnol. 2020, 30, 1132–1141. [Google Scholar] [CrossRef]
- Hou, Y.; Wei, W.; Guan, X.; Liu, Y.; Bian, G.; He, D.; Fan, Q.; Cai, X.; Zhang, Y.; Wang, G.; et al. A diet-microbial metabolism feedforward loop modulates intestinal stem cell renewal in the stressed gut. Nat. Commun. 2021, 12, 271. [Google Scholar] [CrossRef]
- Li, D.; Feng, Y.; Tian, M.; Ji, J.; Hu, X.; Chen, F. Gut microbiota-derived inosine from dietary barley leaf supplementation attenuates colitis through PPARγ signaling activation. Microbiome 2021, 9, 83. [Google Scholar] [CrossRef]
- Peng, Y.; Yan, Y.; Wan, P.; Chen, D.; Ding, Y.; Ran, L.; Mi, J.; Lu, L.; Zhang, Z.; Li, X.; et al. Gut microbiota modulation and anti-inflammatory properties of anthocyanins from the fruits of Lycium ruthenicum Murray in dextran sodium sulfate-induced colitis in mice. Free Radic. Biol. Med. 2019, 136, 96–108. [Google Scholar] [CrossRef] [PubMed]
- Ren, R.; Li, N.; Su, C.; Wang, Y.; Zhao, X.; Yang, L.; Li, Y.; Zhang, B.; Chen, J.; Ma, X. The bioactive components as well as the nutritional and health effects of sea buckthorn. RSC Adv. 2020, 10, 44654–44671. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Yang, W.; Kallio, H.; Yang, B. Health promoting properties and sensory characteristics of phytochemicals in berries and leaves of sea buckthorn (Hippophaë rhamnoides). Crit. Rev. Food Sci. Nutr. 2021, 62, 3798–3816. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Zhang, W.; Dong, S.; Song, L.; Zhao, S.; Wu, C.; Wang, X.; Liu, F.; Xie, J.; Wang, J.; et al. Protective effects of sea buckthorn polysaccharide extracts against LPS/d-GalN-induced acute liver failure in mice via suppressing TLR4-NF-κB signaling. J. Ethnopharmacol. 2015, 176, 69–78. [Google Scholar] [CrossRef] [PubMed]
- Lan, Y.; Ma, Z.; Chang, L.; Peng, J.; Zhang, M.; Sun, Q.; Qiao, R.; Hou, X.; Ding, X.; Zhang, Q.; et al. Sea buckthorn polysaccharide ameliorates high-fat diet induced mice neuroinflammation and synaptic dysfunction via regulating gut dysbiosis. Int. J. Biol. Macromol. 2023, 236, 123797. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Wei, Z.; Cheng, P.; Qian, C.; Xu, F.; Yang, Y.; Wang, A.; Chen, W.; Sun, Z.; Lu, Y. Rhein modulates host purine metabolism in intestine through gut microbiota and ameliorates experimental colitis. Theranostics 2020, 10, 10665–10679. [Google Scholar] [CrossRef] [PubMed]
- Olson, C.A.; Vuong, H.E.; Yano, J.M.; Liang, Q.Y.; Nusbaum, D.J.; Hsiao, E.Y. The Gut Microbiota Mediates the Anti-Seizure Effects of the Ketogenic Diet. Cell 2018, 173, 1728–1741.e13, Erratum in Cell 2018, 174, 497. [Google Scholar] [CrossRef]
- Kiesler, P.; Fuss, I.J.; Strober, W. Experimental Models of Inflammatory Bowel Diseases. Cell. Mol. Gastroenterol. Hepatol. 2015, 1, 154–170. [Google Scholar] [CrossRef]
- Carlsson, A.H.; Yakymenko, O.; Olivier, I.; Håkansson, F.; Postma, E.; Keita, Å.V.; Söderholm, J.D. Faecalibacterium prausnitzii supernatant improves intestinal barrier function in mice DSS colitis. Scand. J. Gastroenterol. 2013, 48, 1136–1144. [Google Scholar] [CrossRef]
- Eichele, D.D.; Kharbanda, K.K. Dextran sodium sulfate colitis murine model: An indispensable tool for advancing our understanding of inflammatory bowel diseases pathogenesis. World J. Gastroenterol. 2017, 23, 6016–6029. [Google Scholar] [CrossRef]
- Gevers, D.; Kugathasan, S.; Denson, L.A.; Vázquez-Baeza, Y.; Van Treuren, W.; Ren, B.; Schwager, E.; Knights, D.; Song, S.J.; Yassour, M.; et al. The Treatment-Naive Microbiome in New-Onset Crohn’s Disease. Cell Host Microbe 2014, 15, 382–392. [Google Scholar] [CrossRef] [PubMed]
- Halfvarson, J.; Brislawn, C.J.; Lamendella, R.; Vázquez-Baeza, Y.; Walters, W.A.; Bramer, L.M.; D’Amato, M.; Bonfiglio, F.; McDonald, D.; Gonzalez, A.; et al. Dynamics of the human gut microbiome in inflammatory bowel disease. Nat. Microbiol. 2017, 2, 17004. [Google Scholar] [CrossRef] [PubMed]
- Smith, P.M.; Howitt, M.R.; Panikov, N.; Michaud, M.; Gallini, C.A.; Bohlooly-y, M.; Glickman, J.; Garrett, W.S. The microbial metabolites, short-chain fatty acids, regulate colonic Treg cell homeostasis. Science 2013, 341, 569–573. [Google Scholar] [CrossRef] [PubMed]
- Louis, P.; Hold, G.L.; Flint, H.J. The gut microbiota, bacterial metabolites and colorectal cancer. Nat. Rev. Microbiol. 2014, 12, 661–672. [Google Scholar] [CrossRef] [PubMed]
- Koh, A.; De Vadder, F.; Kovatcheva-Datchary, P.; Bäckhed, F. From Dietary Fiber to Host Physiology: Short-Chain Fatty Acids as Key Bacterial Metabolites. Cell 2016, 165, 1332–1345. [Google Scholar] [CrossRef]
- Ríos-Covián, D.; Ruas-Madiedo, P.; Margolles, A.; Gueimonde, M.; De Los Reyes-Gavilán, C.G.; Salazar, N. Intestinal Short Chain Fatty Acids and their Link with Diet and Human Health. Front. Microbiol. 2016, 7, 185. [Google Scholar] [CrossRef]
- Singh, N.; Gurav, A.; Sivaprakasam, S.; Brady, E.; Padia, R.; Shi, H.; Thangaraju, M.; Prasad, P.D.; Manicassamy, S.; Munn, D.H.; et al. Activation of Gpr109a, Receptor for Niacin and the Commensal Metabolite Butyrate, Suppresses Colonic Inflammation and Carcinogenesis. Immunity 2014, 40, 128–139. [Google Scholar] [CrossRef]
- Tedelind, S.; Westberg, F.; Kjerrulf, M.; Vidal, A. Anti-inflammatory properties of the short-chain fatty acids acetate and propionate: A study with relevance to inflammatory bowel disease. World J. Gastroenterol. 2007, 13, 2826–2832. [Google Scholar] [CrossRef]
- Kaur, R.; Thakur, S.; Rastogi, P.; Kaushal, N. Resolution of Cox mediated inflammation by Se supplementation in mouse experimental model of colitis. PLoS ONE 2018, 13, e0201356. [Google Scholar] [CrossRef]
- Costello, S.P.; Soo, W.; Bryant, R.V.; Jairath, V.; Hart, A.L.; Andrews, J.M. Systematic review with meta-analysis: Faecal microbiota transplantation for the induction of remission for active ulcerative colitis. Aliment. Pharmacol. Ther. 2017, 46, 213–224. [Google Scholar] [CrossRef]
- Liu, J.; Xue, C.; Sun, D.; Zhu, W.; Mao, S. Impact of high-grain diet feeding on mucosa-associated bacterial community and gene expression of tight junction proteins in the small intestine of goats. Microbiologyopen 2019, 8, e00745. [Google Scholar] [CrossRef] [PubMed]
- Shen, C.; Wang, T.; Guo, F.; Sun, K.; Wang, B.; Wang, J.; Zhang, Z.; Zhang, X.; Zhao, Y.; Chen, Y. Structural characterization and intestinal protection activity of polysaccharides from Sea buckthorn (Hippophae rhamnoides L.) berries. Carbohydr. Polym. 2021, 274, 118648. [Google Scholar] [CrossRef] [PubMed]
- Lan, Y.; Wang, C.; Zhang, C.; Li, P.; Zhang, J.; Ji, H.; Yu, H. Dietary sea buckthorn polysaccharide reduced lipid accumulation, alleviated inflammation and oxidative stress, and normalized imbalance of intestinal microbiota that was induced by high-fat diet in zebrafish Danio rerio. Fish Physiol. Biochem. 2022, 48, 1717–1735. [Google Scholar] [CrossRef] [PubMed]
- Han, Y.; Yuan, C.; Zhou, X.; Han, Y.; He, Y.; Ouyang, J.; Zhou, W.; Wang, Z.; Wang, H.; Li, G. Anti-Inflammatory Activity of Three Triterpene from Hippophae rhamnoides L. in Lipopolysaccharide-Stimulated RAW264.7 Cells. Int. J. Mol. Sci. 2021, 22, 12009. [Google Scholar] [CrossRef] [PubMed]
- Arimboor, R.; Arumughan, C. Effect of polymerization on antioxidant and xanthine oxidase inhibitory potential of sea buckthorn (H. rhamnoides) proanthocyanidins. J. Food Sci. 2012, 77, C1036–C1041. [Google Scholar] [CrossRef]
- Kim, J.-S.; Kwon, Y.-S.; Sa, Y.-J.; Kim, M.-J. Isolation and Identification of Sea Buckthorn (Hippophae rhamnoides) Phenolics with Antioxidant Activity and α-Glucosidase Inhibitory Effect. J. Agric. Food Chem. 2011, 59, 138–144. [Google Scholar] [CrossRef]
- Neurath, M.F. Current and emerging therapeutic targets for IBD. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 269–278. [Google Scholar] [CrossRef]
- Maloy, K.J.; Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature 2011, 474, 298–306. [Google Scholar] [CrossRef]
- Abraham, C.; Medzhitov, R. Interactions Between the Host Innate Immune System and Microbes in Inflammatory Bowel Disease. Gastroenterology 2011, 140, 1729–1737. [Google Scholar] [CrossRef]
- Hunter, C.A.; Jones, S.A. IL-6 as a keystone cytokine in health and disease. Nat. Immunol. 2015, 16, 448–457, Correction in Nat. Immunol. 2017, 18, 1271. [Google Scholar] [CrossRef]
- Schoenborn, J.R.; Wilson, C.B. Regulation of interferon-gamma during innate and adaptive immune responses. Adv. Immunol. 2007, 96, 41–101. [Google Scholar] [PubMed]
- Gaffen, S.L.; Hajishengallis, G. A new inflammatory cytokine on the block: Re-thinking periodontal disease and the Th1/Th2 paradigm in the context of Th17 cells and IL-17. J. Dent. Res. 2008, 87, 817–828. [Google Scholar] [CrossRef] [PubMed]
- Neurath, M.F. Cytokines in inflammatory bowel disease. Nature Reviews. Immunology 2014, 14, 329–342. [Google Scholar] [PubMed]
- Papadakis, K.A.; Targan, S.R. Role of Cytokines in the Pathogenesis of Inflammatory Bowel Disease. Annu. Rev. Med. 2000, 51, 289–298. [Google Scholar] [CrossRef] [PubMed]
- Cario, E. Toll-like receptors in inflammatory bowel diseases: A decade later. Inflamm. Bowel Dis. 2010, 16, 1583–1597. [Google Scholar] [CrossRef] [PubMed]
- Chang, J.T. Pathophysiology of Inflammatory Bowel Diseases. N. Engl. J. Med. 2020, 383, 2652–2664. [Google Scholar] [CrossRef] [PubMed]
- Zaki, H.; Lamkanfi, M.; Kanneganti, T.-D. The Nlrp3 inflammasome: Contributions to intestinal homeostasis. Trends Immunol. 2011, 32, 171–179. [Google Scholar] [CrossRef] [PubMed]
- Lukens, J.R.; Gross, J.M.; Kanneganti, T.-D. IL-1 family cytokines trigger sterile inflammatory disease. Front. Immunol. 2012, 3, 315. [Google Scholar] [CrossRef]
- Wang, M.; Dai, T.; Li, S.; Wang, W. Eugenol suppresses the proliferation and invasion of TNF-α-induced fibroblast-like synoviocytes via regulating NF-κB and COX-2. Biochem. Biophys. Res. Commun. 2022, 612, 63–69. [Google Scholar] [CrossRef]
- Meriwether, D.; Sulaiman, D.; Volpe, C.; Dorfman, A.; Grijalva, V.; Dorreh, N.; Solorzano-Vargas, R.S.; Wang, J.; O’Connor, E.; Papesh, J.; et al. Apolipoprotein A-I mimetics mitigate intestinal inflammation in COX2-dependent inflammatory bowel disease model. J. Clin. Investig. 2019, 129, 3670–3685. [Google Scholar] [CrossRef]
- Camba-Gómez, M.; Arosa, L.; Gualillo, O.; Conde-Aranda, J. Chemokines and chemokine receptors in inflammatory bowel disease: Recent findings and future perspectives. Drug Discov. Today 2022, 27, 1167–1175. [Google Scholar] [CrossRef]
- Glass, W.G.; Lim, J.K.; Cholera, R.; Pletnev, A.G.; Gao, J.-L.; Murphy, P.M. Chemokine receptor CCR5 promotes leukocyte trafficking to the brain and survival in West Nile virus infection. J. Exp. Med. 2005, 202, 1087–1098. [Google Scholar] [CrossRef] [PubMed]
- Dansereau, M.A.; Midavaine, É.; Bégin-Lavallée, V.; Belkouch, M.; Beaudet, N.; Longpré, J.M.; Mélik-Parsadaniantz, S.; Sarret, P. Mechanistic insights into the role of the chemokine CCL2/CCR2 axis in dorsal root ganglia to peripheral inflammation and pain hypersensitivity. J. Neuroinflamm. 2021, 18, 79. [Google Scholar] [CrossRef] [PubMed]
- Nauseef, W.M. Myeloperoxidase in human neutrophil host defence. Cell. Microbiol. 2014, 16, 1146–1155. [Google Scholar] [CrossRef] [PubMed]
- El-Hajjar, L.; Hindieh, J.; Andraos, R.; El-Sabban, M.; Daher, J. Myeloperoxidase-Oxidized LDL Activates Human Aortic Endothelial Cells through the LOX-1 Scavenger Receptor. Int. J. Mol. Sci. 2022, 23, 2837. [Google Scholar] [CrossRef] [PubMed]
- Van Itallie, C.M.; Anderson, J.M. Architecture of tight junctions and principles of molecular composition. Semin. Cell Dev. Biol. 2014, 36, 157–165. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, T. Regulation of intestinal epithelial permeability by tight junctions. Cell. Mol. Life Sci. 2013, 70, 631–659. [Google Scholar] [CrossRef]
- Turner, J.R. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 2009, 9, 799–809. [Google Scholar] [CrossRef]
- Matter, K.; Balda, M.S. Signalling to and from tight junctions. Nat. Rev. Mol. Cell Biol. 2003, 4, 225–237. [Google Scholar] [CrossRef]
- Gustafsson, J.K.; Johansson, M.E.V. The role of goblet cells and mucus in intestinal homeostasis. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 785–803. [Google Scholar] [CrossRef]
- Johansson, M.E.V.; Sjövall, H.; Hansson, G.C. The gastrointestinal mucus system in health and disease. Nat. Rev. Gastroenterol. Hepatol. 2013, 10, 352–361. [Google Scholar] [CrossRef] [PubMed]
- Hasnain, S.Z.; Wang, H.; Ghia, J.; Haq, N.; Deng, Y.; Velcich, A.; Grencis, R.K.; Thornton, D.J.; Khan, W.I. Mucin Gene Deficiency in Mice Impairs Host Resistance to an Enteric Parasitic Infection. Gastroenterology 2010, 138, 1763–1771.e5. [Google Scholar] [CrossRef] [PubMed]
- Silberg, D.G.; Swain, G.P.; Suh, E.R.; Traber, P.G. Cdx1 and Cdx2 expression during intestinal development. Gastroenterology 2000, 119, 961–971. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Liu, D.; Sun, X.; Yang, K.; Yao, J.; Cheng, C.; Wang, C.; Zheng, J. CDX2 inhibits the proliferation and tumor formation of colon cancer cells by suppressing Wnt/β-catenin signaling via transactivation of GSK-3β and Axin2 expression. Cell Death Dis. 2019, 10, 26. [Google Scholar] [CrossRef] [PubMed]
- Croxen, M.A.; Law, R.J.; Scholz, R.; Keeney, K.M.; Wlodarska, M.; Finlay, B.B. Recent Advances in Understanding Enteric Pathogenic Escherichia coli. Clin. Microbiol. Rev. 2013, 26, 822–880. [Google Scholar] [CrossRef] [PubMed]
- Shiloach, J.; Fass, R. Growing E. coli to high cell density--a historical perspective on method development. Biotechnol. Adv. 2005, 23, 345–357. [Google Scholar] [CrossRef] [PubMed]
- Blount, Z.D. The unexhausted potential of E. coli. Elife 2015, 4, e05826. [Google Scholar] [CrossRef]
- Riley, L.W. Pandemic lineages of extraintestinal pathogenic Escherichia coli. Clin. Microbiol. Infect. Off. Publ. Eur. Soc. Clin. Microbiol. Infect. Dis. 2014, 20, 380–390. [Google Scholar] [CrossRef]
- Dao, M.C.; Everard, A.; Aron-Wisnewsky, J.; Sokolovska, N.; Prifti, E.; Verger, E.O.; Kayser, B.D.; Levenez, F.; Chilloux, J.; Hoyles, L.; et al. Akkermansia muciniphila and improved metabolic health during a dietary intervention in obesity: Relationship with gut microbiome richness and ecology. Gut 2016, 65, 426–436. [Google Scholar] [CrossRef]
- Zhai, R.; Xue, X.; Zhang, L.; Yang, X.; Zhao, L.; Zhang, C. Strain-Specific Anti-inflammatory Properties of Two Akkermansia muciniphila Strains on Chronic Colitis in Mice. Front. Cell. Infect. Microbiol. 2019, 9, 239. [Google Scholar] [CrossRef]
- Milani, C.; Duranti, S.; Bottacini, F.; Casey, E.; Turroni, F.; Mahony, J.; Belzer, C.; Delgado Palacio, S.; Arboleya Montes, S.; Mancabelli, L.; et al. The First Microbial Colonizers of the Human Gut: Composition, Activities, and Health Implications of the Infant Gut Microbiota. Microbiol. Mol. Biol. Rev. 2017, 81, e00036-17. [Google Scholar] [CrossRef] [PubMed]
- Turroni, F.; Milani, C.; Duranti, S.; Ferrario, C.; Lugli, G.A.; Mancabelli, L.; van Sinderen, D.; Ventura, M. Bifidobacteria and the infant gut: An example of co-evolution and natural selection. Cell. Mol. Life Sci. 2017, 75, 103–118. [Google Scholar] [CrossRef] [PubMed]
- Arboleya, S.; Watkins, C.; Stanton, C.; Ross, R.P. Gut Bifidobacteria Populations in Human Health and Aging. Front. Microbiol. 2016, 7, 1204. [Google Scholar] [CrossRef] [PubMed]
- Flint, H.J.; Duncan, S.H.; Scott, K.P.; Louis, P. Interactions and competition within the microbial community of the human colon: Links between diet and health. Environ. Microbiol. 2007, 9, 1101–1111. [Google Scholar] [CrossRef] [PubMed]
- Mazmanian, S.K.; Round, J.L.; Kasper, D.L. A microbial symbiosis factor prevents intestinal inflammatory disease. Nature 2008, 453, 620–625. [Google Scholar] [CrossRef]
- Maslowski, K.M.; Vieira, A.T.; Ng, A.; Kranich, J.; Sierro, F.; Yu, D.; Schilter, H.C.; Rolph, M.S.; Mackay, F.; Artis, D.; et al. Regulation of inflammatory responses by gut microbiota and chemoattractant receptor GPR43. Nature 2009, 461, 1282–1286. [Google Scholar] [CrossRef]
- Kimura, I.; Inoue, D.; Maeda, T.; Hara, T.; Ichimura, A.; Miyauchi, S.; Kobayashi, M.; Hirasawa, A.; Tsujimoto, G. Short-chain fatty acids and ketones directly regulate sympathetic nervous system via G protein-coupled receptor 41 (GPR41). Proc. Natl. Acad. Sci. USA 2011, 108, 8030–8035. [Google Scholar] [CrossRef]
- Chambers, E.S.; Morrison, D.J.; Frost, G. Control of appetite and energy intake by SCFA: What are the potential underlying mechanisms? Proc. Nutr. Soc. 2015, 74, 328–336. [Google Scholar] [CrossRef]
Target Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
CAT | CCTCGTTCAGGATGTGGTTT | TCTGGTGATATCGTGGGTGA |
Ccl2 | TACAAGAGGATCACCAGCAGC | ACCTTAGGGCAGATGCAGTT |
Ccl5 | TGCTGCTTTGCCTACCTCTC | TCTTCTCTGGGTTGGCACAC |
CDX2 | CTGGACAAGGACGTGAGCAT | ACTGCGGAGGACTGACAAAG |
Claudin-1 | CCTGCCCCAGTGGAAGATTT | CTTTGCGAAACGCAGGACAT |
COX2 | CCCATTAGCAGCCAGTTGTC | CAGGATGCAGTGCTGAGTTC |
FFAR2 | TACTGATCCGCAATCCTGCC | CACCCCTGTCCATCTTGGTC |
FFAR3 | CGACTAGAGATGGCTGTGGT | AGAAGATGAGCAGTGTGGCT |
GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
GSH-px | CCTCAAGTACGTCCGACCTG | CAATGTCGTTGCGGCACACC |
IFN-γ | AGCAAGGCGAAAAAGGATGC | TCATTGAATGCTTGGCGCTG |
IL-1β | AGCTTCAAATCTCGCAGCAG | TCTCCACAGCCACAATGAGT |
IL-6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
IL10 | TGAATTCCCTGGGTGAGAAGC | GACACCTTGGTCTTGGAGCTTA |
Muc2 | TCCTGACCAAGAGCGAACAC | ACAGCACGACAGTCTTCAGG |
Muc3 | GCTGGCTTTCATCCTCCACT | CCTCCATCCCACACACTTCC |
NLRP3 | TATCCACTGCCGAGAGGTGA | TCTTGCACACTGGTGGGTTT |
Occludin | CCTCCACCCCCATCTGACTA | TCGCTTGCCATTCACTTTGC |
SOD1 | GGAACCATCCACTTCGAGCA | CTGCACTGGTACAGCCTTGT |
TLR-4 | CACCAGGAAGCTTGAATCCCT | GGAATGTCATCAGGGACTTTGC |
TNF-α | TCCCAGGTTCTCTTCAAGGGA | GGTGAGGAGCACGTAGTCGG |
ZO-1 | GAGCCCCCTAGTGATGTGTG | TAGGGTCACAGTGTGGCAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ouyang, Q.; Li, X.; Liang, Y.; Liu, R. Sea Buckthorn Polysaccharide Ameliorates Colitis. Nutrients 2024, 16, 1280. https://doi.org/10.3390/nu16091280
Ouyang Q, Li X, Liang Y, Liu R. Sea Buckthorn Polysaccharide Ameliorates Colitis. Nutrients. 2024; 16(9):1280. https://doi.org/10.3390/nu16091280
Chicago/Turabian StyleOuyang, Qinqin, Xin Li, Yongheng Liang, and Rong Liu. 2024. "Sea Buckthorn Polysaccharide Ameliorates Colitis" Nutrients 16, no. 9: 1280. https://doi.org/10.3390/nu16091280