Keap1 Negatively Regulates Transcription of Three Counter-Defense Genes and Susceptibility to Plant Toxin Gossypol in Helicoverpa armigera
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing
2.2. Suppression of Keap1 Gene and Diet Bioassays
2.3. RNA Extraction and cDNA Synthesis
2.4. RT-qPCR Analysis of Keap1 Gene Expression
2.5. RT-qPCR Analysis of Down-Stream Target Genes Expression
2.6. Promoter Analysis of Three Target Genes
2.7. Statistical Analysis
3. Results
3.1. Knockdown of the Keap1 Gene Significantly Reduced Its Expression
3.2. Suppressing the Keap1 Gene Decreased the Susceptibility of H. armigera to Gossypol
3.3. Silencing the Keap1 Gene Resulted in Up-Regulation of Three Target Genes
3.4. Identification of AREs in the Promoter Regions of the Target Genes
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Schuler, M.A. P450s in plant-insect interactions. Biochim. Biophys. Acta 2011, 1814, 36–45. [Google Scholar] [CrossRef] [PubMed]
- Li, X.C.; Ni, X.Z. Deciphering the plant-insect phenotypic arms race. In Recent Advances in Entomological Research; Liu, T.X., Kang, L., Eds.; Springer: Berlin, Germany, 2011; pp. 3–33. [Google Scholar]
- Heckel, D.G. Insect detoxification and sequestration strategies. Annu. Plant Rev. 2014, 47, 77–114. [Google Scholar]
- Speed, M.P.; Fenton, A.; Jones, M.G.; Ruxton, G.D.; Brockhurst, M.A. Coevolution can explain defensive secondary metabolite diversity in plants. New Phytol. 2015, 208, 1251–1263. [Google Scholar] [CrossRef]
- Li, X.C.; Schuler, M.A.; Berenbaum, M.R. Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics. Annu. Rev. Entomol. 2007, 52, 231–253. [Google Scholar] [CrossRef] [PubMed]
- Hilliou, F.; Chertemps, T.; Maïbèche, M.; Le Goff, G. Resistance in the genus Spodoptera: Key insect detoxification genes. Insects 2021, 12, 544. [Google Scholar] [CrossRef] [PubMed]
- Li, X.C.; Baudry, J.; Berenbaum, M.R.; Schuler, M.A. Structural and functional divergence of insect CYP6B proteins: From specialist to generalist cytochrome P450. Proc. Natl. Acad. Sci. USA 2004, 101, 2939–2944. [Google Scholar] [CrossRef]
- Wang, C.Z.; Dong, J.F.; Tang, D.L.; Zhang, J.H.; Li, W.; Qin, J.D. Host selection of Helicoverpa armigera and H. assulta and its inheritance. Prog. Nat. Sci. 2004, 14, 880–884. [Google Scholar] [CrossRef]
- Cunningham, J.P.; Zalucki, M.P. Understanding heliothine (Lepidoptera: Heliothinae) pests: What is a host plant? J. Econ. Entomol. 2014, 107, 881–896. [Google Scholar] [CrossRef] [PubMed]
- Clark, A.G.; Eisen, M.B.; Smith, D.R.; Bergman, C.M.; Oliver, B.; Markow, T.A.; Kaufman, T.C.; Kellis, M.; Gelbart, W.; Lyer, V.N. Evolution of genes and genomes on the Drosophila phylogeny. Nature 2007, 450, 203–218. [Google Scholar]
- Grbić, M.; Van Leeuwen, T.; Clark, R.M.; Rombauts, S.; Rouzé, P.; Grbić, V.; Osborne, E.J.; Dermauw, W.; Ngoc, P.C.; Ortego, F. The genome of Tetranychus urticae reveals herbivorous pest adaptations. Nature 2011, 479, 487–492. [Google Scholar] [CrossRef]
- Barthel, A.; Kopka, I.; Vogel, H.; Zipfel, P.; Heckel, D.G.; Groot, A.T. Immune defence strategies of generalist and specialist insect herbivores. Proc. Biol. Sci. 2014, 281, 20140897. [Google Scholar] [CrossRef]
- Ding, Z.M.; Chen, Y.W.; Wang, Y.S.; Ahmad, M.J.; Yang, S.J.; Duan, Z.Q.; Liu, M.; Yang, C.X.; Xiong, J.J.; Liang, A.X.; et al. Gossypol exposure induces mitochondrial dysfunction and oxidative stress during mouse oocyte in vitro maturation. Chem. Biol. Interact. 2021, 348, 109642. [Google Scholar] [CrossRef]
- Gadelha, I.C.; Fonseca, N.B.; Oloris, S.C.; Melo, M.M.; Soto-Blanco, B. Gossypol toxicity from cottonseed products. Sci. World J. 2014, 2014, 231635. [Google Scholar] [CrossRef] [PubMed]
- El-Sebae, A.H.; Sherby, S.I.; Mansour, N.A. Gossypol as an inducer or inhibitor in Spodoptera littoralis larvae. J. Environ. Sci. Health Part B 1981, 16, 167–178. [Google Scholar] [CrossRef] [PubMed]
- Celorio-Mancera, M.; Ahn, S.J.; Vogel, H.; Heckel, D.G. Transcriptional responses underlying the hormetic and detrimental effects of the plant secondary metabolite gossypol on the generalist herbivore Helicoverpa armigera. BMC Genom. 2011, 12, 575. [Google Scholar] [CrossRef]
- Kong, G.C.; Daud, M.K.; Zhu, S.J. Effects of pigment glands and gossypol on growth, development and insecticide-resistance of cotton bollworm (Heliothis armigera (Hübner)). Crop Prot. 2010, 29, 813–819. [Google Scholar] [CrossRef]
- Dodou, K.; Anderson, R.J.; Small, D.A.; Groundwater, P.W. Investigations on gossypol: Past and present developments. Expert Opin. Invest. Drugs 2005, 14, 1419–1434. [Google Scholar] [CrossRef]
- Kovacic, P. Mechanism of drug and toxic actions of gossypol: Focus on reactive oxygen species and electron transfer. Curr. Med. Chem. 2003, 10, 2711–2718. [Google Scholar] [CrossRef] [PubMed]
- Ko, C.H.; Shen, S.C.; Yang, L.Y.; Lin, C.W.; Chen, Y.C. Gossypol reduction of tumor growth through ROS-dependent mitochondria pathway in human colorectal carcinoma cells. Int. J. Cancer 2007, 121, 1670–1679. [Google Scholar] [CrossRef]
- Arinbasarova, A.Y.; Medentsev, A.G.; Krupyanko, V.I. Gossypol inhibits electron transport and stimulates ROS generation in Yarrowia lipolytica mitochondria. Open Biochem. J. 2012, 6, 11–15. [Google Scholar] [CrossRef]
- Mao, Y.B.; Cai, W.J.; Wang, J.W.; Hong, G.J.; Tao, X.Y.; Wang, L.J.; Huang, Y.P.; Chen, X.Y. Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat. Biotechnol. 2007, 25, 1307–1313. [Google Scholar] [CrossRef] [PubMed]
- Celorio-Mancera, M.P.; Heckel, D.G.; Vogel, H. Transcriptional analysis of physiological pathways in a generalist herbivore: Responses to different host plants and plant structures by the cotton bollworm, Helicoverpa armigera. Entomol. Exp. Appl. 2012, 144, 123–133. [Google Scholar] [CrossRef]
- Brun-Barale, A.; Héma, O.; Martin, T.; Suraporn, S.; Audant, P.; Sezutsu, H.; Feyereisen, R. Multiple P450 genes overexpressed in deltamethrin-resistant strains of Helicoverpa armigera. Pest Manag. Sci. 2010, 66, 900–909. [Google Scholar] [CrossRef]
- Tao, X.Y.; Xue, X.Y.; Huang, Y.P.; Chen, X.Y.; Mao, Y.B. Gossypol-enhanced P450 gene pool contributes to cotton bollworm tolerance to a pyrethroid insecticide. Mol. Ecol. 2012, 21, 4371–4385. [Google Scholar] [CrossRef] [PubMed]
- Jin, M.; Liao, C.; Fu, X.; Holdbrook, R.; Wu, K.; Xiao, Y. Adaptive regulation of detoxification enzymes in Helicoverpa armigera to different host plants. Insect. Mol. Biol. 2019, 28, 628–636. [Google Scholar] [CrossRef]
- Krempl, C.; Sporer, T.; Reichelt, M.; Ahn, S.J.; Heidel-Fischer, H.; Vogel, H.; Heckel, D.G.; Joußen, N. Potential detoxification of gossypol by UDP-glycosyltransferases in the two Heliothine moth species Helicoverpa armigera and Heliothis virescens. Insect Biochem. Mol. Biol. 2016, 71, 49–57. [Google Scholar] [CrossRef] [PubMed]
- Deng, H. Multiple roles of Nrf2-Keap1 signaling: Regulation of development and xenobiotic response using distinct mechanisms. Fly 2014, 8, 7–12. [Google Scholar] [CrossRef] [PubMed]
- Motohashi, H.; Yamamoto, M. Nrf2-Keap1 defines a physiologically important stress response mechanism. Trends Mol. Med. 2004, 10, 549–557. [Google Scholar] [CrossRef]
- Yamamoto, M.; Kensler, T.W.; Motohashi, H. The Keap1-Nrf2 system: A thiol-based sensor-effector apparatus for maintaining redox homeostasis. Physiol. Rev. 2018, 98, 1169–1203. [Google Scholar] [CrossRef]
- Sykiotis, G.P.; Bohmann, D. Keap1/Nrf2 signaling regulates oxidative stress tolerance and lifespan in Drosophila. Dev. Cell 2008, 14, 76–85. [Google Scholar] [CrossRef]
- Tonelli, C.; Chio, I.I.C.; Tuveson, D.A. Transcriptional regulation by Nrf2. Antioxid. Redox Signal. 2018, 29, 1727–1745. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.; Shi, Y.; Liu, M.F.; Zhang, Y.; Liao, X.L. Transcription factor CncC potentially regulates the expression of multiple detoxification genes that mediate indoxacarb resistance in Spodoptera litura. Insect Sci. 2021, 28, 1426–1438. [Google Scholar] [CrossRef]
- Gaddelapati, S.C.; Kalsi, M.; Roy, A.; Palli, S.R. Cap ‘n’ collar C regulates genes responsible for imidacloprid resistance in the Colorado potato beetle, Leptinotarsa decemlineata. Insect Biochem. Mol. Biol. 2018, 99, 54–62. [Google Scholar] [CrossRef]
- Amezian, D.; Nauen, R.; Le Goff, G. Transcriptional regulation of xenobiotic detoxification genes in insects—An overview. Pestic. Biochem. Physiol. 2021, 174, 104822. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, T.; Nioi, P.; Pickett, C.B. The Nrf2-antioxidant response element signaling pathway and its activation by oxidative stress. J. Biol. Chem. 2009, 284, 13291–13295. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.D. Mechanistic studies of the Nrf2-Keap1 signaling pathway. Drug Metab. Rev. 2006, 38, 769–789. [Google Scholar] [CrossRef]
- Bayliak, M.M.; Demianchuk, O.I.; Gospodaryov, D.V.; Abrat, O.B.; Lylyk, M.P.; Lylyk, M.P.; Lushchak, V.I. Mutations in genes cnc or dKeap1 modulate stress resistance and metabolic processes in Drosophila melanogaster. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2020, 248, 110746. [Google Scholar] [CrossRef]
- Itoh, K.; Tong, K.I.; Yamamoto, M. Molecular mechanism activating Nrf2-Keap1 pathway in regulation of adaptive response to electrophiles. Free Radic. Biol. Med. 2004, 36, 1208–1213. [Google Scholar] [CrossRef]
- Jaiswal, A.K. Regulation of antioxidant response element-dependent induction of detoxifying enzyme synthesis. Methods Enzymol. 2004, 378, 221–238. [Google Scholar]
- Misra, J.R.; Lam, G.; Thummel, C.S. Constitutive activation of the Nrf2/Keap1 pathway in insecticide-resistant strains of Drosophila. Insect Biochem. Mol. Biol. 2013, 43, 1116–1124. [Google Scholar] [CrossRef]
- Palli, S.R. CncC/Maf-mediated xenobiotic response pathway in insects. Arch. Insect Biochem. Physiol. 2020, 104, e21674. [Google Scholar] [CrossRef] [PubMed]
- Misra, J.R.; Horner, M.A.; Lam, G.; Thummel, C.S. Transcriptional regulation of xenobiotic detoxification in Drosophila. Genes Dev. 2011, 25, 1796–1806. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Li, H.C.; Miao, X.X. Feasibility, limitation and possible solutions of RNAi-based technology for insect pest control. Insect Sci. 2013, 20, 15–30. [Google Scholar] [CrossRef] [PubMed]
- Kalsi, M.; Palli, S.R. Cap n collar transcription factor regulates multiple genes coding for proteins involved in insecticide detoxification in the red flour beetle, Tribolium castaneum. Insect Biochem. Mol. Biol. 2017, 90, 43–52. [Google Scholar] [CrossRef] [PubMed]
- Jackson, A.L.; Linsley, P.S. Recognizing and avoiding siRNA off-target effects for target identification and therapeutic application. Nat. Rev. Drug Discov. 2010, 9, 57–67. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.D.; An, S.H.; Li, Z.; Wu, F.M.; Yang, Q.P.; Liu, Y.C.; Cao, J.J.; Zhang, H.J.; Zhang, Q.W.; Liu, X.X. Identification and validation of reference genes for normalization of gene expression analysis using qRT-PCR in Helicoverpa armigera (Lepidoptera: Noctuidae). Gene 2015, 555, 393–402. [Google Scholar] [CrossRef] [PubMed]
- Wasserman, W.W.; Fahl, W.E. Functional antioxidant responsive elements. Proc. Natl. Acad. Sci. USA 1997, 94, 5361–5366. [Google Scholar] [CrossRef] [PubMed]
- Wilding, C.S. Regulating resistance: CncC:Maf, antioxidant response elements and the overexpression of detoxification genes in insecticide resistance. Curr. Opin. Insect Sci. 2018, 27, 89–96. [Google Scholar] [CrossRef]
- Hu, J.S.; Chen, J.; Wang, H.; Mao, T.T.; Li, J.X.; Cheng, X.Y.; Hu, J.H.; Xue, B.; Li, B. Cloning and functional analysis of CncC and Keap1 genes in silkworm. J. Agric. Food Chem. 2018, 66, 2630–2636. [Google Scholar] [CrossRef]
- Di Meo, S.; Reed, T.T.; Venditti, P.; Victor, V.M. Role of ROS and RNS sources in physiological and pathological conditions. Oxid. Med. Cell. Longev. 2016, 2016, 1245049. [Google Scholar] [CrossRef]
- Zug, R.; Hammerstein, P. Wolbachia and the insect immune system: What reactive oxygen species can tell us about the mechanisms of Wolbachia-host interactions. Front Microbiol. 2015, 6, 1201. [Google Scholar] [CrossRef]
- Mittler, R. ROS are good. Trends Plant Sci. 2017, 22, 11–19. [Google Scholar] [CrossRef] [PubMed]
- Kodrík, D.; Bednářová, A.; Zemanová, M.; Krishnan, N. Hormonal regulation of response to oxidative stress in insects-an update. Int. J. Mol. Sci. 2015, 16, 25788–25816. [Google Scholar] [CrossRef]
- Kobayashi, Y.; Nojima, Y.; Sakamoto, T.; Iwabuchi, K.; Nakazato, T.; Bono, H.; Toyoda, A.; Fujiyama, A.; Kanost, M.R.; Tabunoki, H. Comparative analysis of seven types of superoxide dismutases for their ability to respond to oxidative stress in Bombyx mori. Sci. Rep. 2019, 9, 2170. [Google Scholar] [CrossRef]
- Chaitanya, R.K.; Shashank, K.; Sridevi, P. Oxidative stress in invertebrate systems. In Free Radicals and Disease; Ahmad, R., Ed.; IntechOpen: London, UK, 2016; pp. 51–68. [Google Scholar]
- Wang, Y.; Branicky, R.; Noë, A.; Hekimi, S. Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. J. Cell Biol. 2018, 217, 1915–1928. [Google Scholar] [CrossRef]
- Pan, Y.; Zeng, X.C.; Wen, S.Y.; Liu, X.M.; Shang, Q.L. Characterization of the Cap ‘n’ Collar Isoform C gene in Spodoptera frugiperda and its association with superoxide dismutase. Insects. 2020, 11, 221. [Google Scholar] [CrossRef]
- Zhang, C.N.; Wang, X.X.; Tai, S.L.; Qi, L.J.; Yu, X.T.; Dai, W. Transcription factor CncC potentially regulates cytochrome P450 CYP321A1-mediated flavone tolerance in Helicoverpa armigera. Pestic. Biochem. Physiol. 2023, 191, 105360. [Google Scholar] [CrossRef] [PubMed]
- Peng, T.; Pan, Y.; Gao, X.; Xi, J.; Zhang, L.; Yang, C.; Bi, R.; Yang, S.; Xin, X.; Shang, Q. Cytochrome P450 CYP6DA2 regulated by cap ‘n’collar isoform C (CncC) is associated with gossypol tolerance in Aphis gossypii Glover. Insect Mol. Biol. 2016, 25, 450–459. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Lu, M.; Zhang, N.; Zou, X.; Mo, M.; Zheng, S. Nuclear factor erythroid-derived 2-related factor 2 activates glutathione S-transferase expression in the midgut of Spodoptera litura (Lepidoptera: Noctuidae) in response to phytochemicals and insecticides. Insect Mol. Biol. 2018, 27, 522–532. [Google Scholar] [CrossRef]
- Liu, Y.H.; Ge, M.Y.; Zhang, T.T.; Chen, L.; Xing, Y.P.; Liu, L.; Li, F.L.; Cheng, L.G. Exploring the correlation between deltamethrin stress and Keap1-Nrf2-ARE pathway from Drosophila melanogaster RNASeq data. Genomics 2020, 112, 1300–1308. [Google Scholar] [CrossRef]
- Chen, L.; Zhang, T.T.; Ge, M.Y.; Liu, Y.H.; Xing, Y.P.; Liu, L.; Li, F.L.; Cheng, L.G. The Nrf2-Keap1 pathway: A secret weapon against pesticide persecution in Drosophila Kc cells. Pestic. Biochem. Physiol. 2020, 164, 47–57. [Google Scholar] [CrossRef]
- Amezian, D.; Fricaux, T.; de Sousa, G.; Maiwald, F.; Huditz, H.I.; Nauen, R.; Le Goff, G. Investigating the role of the ROS/CncC signaling pathway in the response to xenobiotics in Spodoptera frugiperda using Sf9 cells. Pestic. Biochem. Physiol. 2023, 195, 105563. [Google Scholar] [CrossRef]
- Xu, C.J.; Li, C.Y.; Kong, A.N. Induction of phase I, II and III drug metabolism/transport by xenobiotics. Arch. Pharm. Res. 2005, 28, 249–268. [Google Scholar] [CrossRef] [PubMed]
- Guo, Z.J.; Qin, J.Y.; Zhou, X.M.; Zhang, Y.J. Insect transcription factors: A landscape of their structures and biological functions in Drosophila and beyond. Int. J. Mol. Sci. 2018, 19, 3691. [Google Scholar] [CrossRef]
- Raghunath, A.; Sundarraj, K.; Nagarajan, R.; Arfuso, F.; Bian, J.; Kumar, A.P.; Sethi, G.; Perumal, E. Antioxidant response elements: Discovery, classes, regulation and potential applications. Redox Biol. 2018, 17, 297–314. [Google Scholar] [CrossRef]
- Petersen, R.A.; Niamsup, H.; Berenbaum, M.R.; Schuler, M.A. Transcriptional response elements in the promoter of CYP6B1, an insect P450 gene regulated by plant chemicals. Biochim. Biophys. Acta 2003, 1619, 269–282. [Google Scholar] [CrossRef] [PubMed]
- Hu, B.; Huang, H.; Hu, S.Z.; Ren, M.M.; Wei, Q.; Tian, X.R.; Esmail Abdalla Elzaki, M.; Bass, C.; Su, J.Y.; Reddy Palli, S. Changes in both trans- and cis-regulatory elements mediate insecticide resistance in a lepidopteron pest, Spodoptera exigua. PLoS Genet. 2021, 17, e1009403. [Google Scholar] [CrossRef]
- Hu, B.; Huang, H.; Wei, Q.; Ren, M.M.; Mburu, D.K.; Tian, X.R.; Su, J.Y. Transcription factors CncC/Maf and AhR/ARNT coordinately regulate the expression of multiple GSTs conferring resistance to chlorpyrifos and cypermethrin in Spodoptera exigua. Pest Manag. Sci. 2019, 75, 2009–2019. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.N.; Luo, X.X.; Ni, X.Z.; Zhang, Y.L.; Li, X.C. Functional characterization of cis-acting elements mediating flavone-inducible expression of CYP321A1. Insect Biochem. Mol. Biol. 2010, 40, 898–908. [Google Scholar] [CrossRef]
- Wang, X.T.; Tomso, D.J.; Chorley, B.N.; Cho, H.Y.; Cheung, V.G.; Kleeberger, S.R.; Bell, D.A. Identification of polymorphic antioxidant response elements in the human genome. Hum. Mol. Genet. 2007, 16, 1188–1200. [Google Scholar] [CrossRef]
Primer | Sequence (5′-3′) | Amplification Efficiency |
---|---|---|
Keap1-F | TTCATCTTACGACAGCGATT | 97.45% |
Keap1-R | TCCATTACAGCAACTCCTAC | |
β-TUB-F | AGCAGTTCACCGCTATGTTC | 96.69% |
β-TUB-R | AGGTCGTTCATGTTGCTCTC | |
RPL32-F | CATCAATCGGATCGCTATG | 99.47% |
RPL32-R | CCATTGGGTAGCATGTGAC | |
CYP9A17-F | TCCGCCAGGTCTATTCCC | 96.06% |
CYP9A17-R | ACCAACTCCTTGATGAAT | |
CYP4L11-F | CGCTAATATAACTGCTCTT | 105.31% |
CYP4L11-R | ACCTTCATCGTCTATCTT | |
UGT41B3-F | TACCACAAGTATAGCAGTAGC | 94.17% |
UGT41B3-R | CAAGATGGCGTGATAGTTC | |
siRNAs | ||
Keap1 siRNA1 sense | GCTGTAATGGACGGACTAT | N.A. |
Keap1 siRNA2 sense | GCACGTCGTTCCTAGACAT | N.A. |
ncsiRNA sense | siM12921102701 (kept confidential according to RiboBio terms) | N.A. |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, X.; Wang, Q.; Deng, Z.; Gu, S.; Liang, G.; Li, X. Keap1 Negatively Regulates Transcription of Three Counter-Defense Genes and Susceptibility to Plant Toxin Gossypol in Helicoverpa armigera. Insects 2024, 15, 328. https://doi.org/10.3390/insects15050328
Xie X, Wang Q, Deng Z, Gu S, Liang G, Li X. Keap1 Negatively Regulates Transcription of Three Counter-Defense Genes and Susceptibility to Plant Toxin Gossypol in Helicoverpa armigera. Insects. 2024; 15(5):328. https://doi.org/10.3390/insects15050328
Chicago/Turabian StyleXie, Xingcheng, Qian Wang, Zhongyuan Deng, Shaohua Gu, Gemei Liang, and Xianchun Li. 2024. "Keap1 Negatively Regulates Transcription of Three Counter-Defense Genes and Susceptibility to Plant Toxin Gossypol in Helicoverpa armigera" Insects 15, no. 5: 328. https://doi.org/10.3390/insects15050328