A Novel, Efficient Method to Isolate Chicken Primordial Germ Cells from Embryonic Blood Using Cell Culture Inserts
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Chicken Embryonic Blood
2.2. Preparation of PGC Medium
2.3. Preparation of Feeder Cells
2.4. Isolation of PGCs
2.5. Identification of PGCs
2.6. Identification of the Migration Ability of PGCs
2.7. Establishment of the PGC Line
3. Results
3.1. PGCs Pass through Cell Culture Insert with Smaller Pore Sizes
3.2. A 3 µm Cell Culture Insert Is Suitable to Isolate PGCs from Chicken Embryonic Blood
3.3. Characteristics of PGCs Isolated from Blood Using the Cell Culture Insert/CEF Adhesion Method
3.4. High PGC Recovery Efficiency Achieved Using the Cell Culture Insert/CEF Adhesion Method
3.5. High Proliferative Potential of PGCs Isolated Using the Cell Culture Insert/CEF Adhesion Method
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, C.; Khazanehdari, K.A.; Baskar, V.; Saleem, S.; Kinne, J.; Wernery, U.; Chang, I.-K. Production of chicken progeny (Gallus gallus domesticus) from interspecies germline chimeric duck (Anas domesticus) by primordial germ cell transfer. Biol. Reprod. 2012, 86, 101. [Google Scholar] [CrossRef] [PubMed]
- Macdonald, J.; Glover, J.D.; Taylor, L.; Sang, H.M.; McGrew, M.J. Characterisation and germline transmission of cultured avian primordial germ cells. PLoS ONE 2010, 5, e15518. [Google Scholar] [CrossRef] [PubMed]
- Naito, M.; Sakurai, M.; Kuwana, T. Expression of exogenous DNA in the gonads of chimaeric chicken embryos produced by transfer of primordial germ cell transfected in vitro and subsequent fate of the introduced DNA. J. Reprod. Fertil. 1998, 113, 137–143. [Google Scholar] [CrossRef] [PubMed]
- Szczerba, A.; Kuwana, T.; Bednarczyk, M. Concentration and total number of circulating primordial germ cells in Green-legged Partridgelike chicken embryos. Poult. Sci. 2021, 100, 319–324. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.M.; Han, J.Y. The early development of germ cells in chicken. Int. J. Dev. Biol. 2018, 62, 145–152. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.Y.; Nagele, R.G. Goldstein MM. Scanning electron microscopy of primordial germ cells in early chick embryos. J. Exp. Zool. 1978, 206, 457–462. [Google Scholar] [CrossRef] [PubMed]
- Mathan, Z.G.; Jin, K.; Zuo, Q.; Habib, M.; Zhang, Y.; Li, B. Formation, Application, and Significance of Chicken Primordial Germ Cells: A Review. Animals 2023, 13, 1096. [Google Scholar] [CrossRef] [PubMed]
- Oishi, I. Improvement of transfection efficiency in cultured chicken primordial germ cells by percoll density gradient centrifugation. Biosci. Biotechnol. Biochem. 2010, 74, 2426–2430. [Google Scholar] [CrossRef] [PubMed]
- Yasuda, Y.; Tajima, A.; Fujimoto, T.; Kuwana, T. A method to obtain avian germ-line chimaeras using isolated primordial germ cells. J. Reprod. Fertil. 1982, 96, 521–528. [Google Scholar] [CrossRef] [PubMed]
- Yu, F.; Zhu, Z.; Chen, X.; Huang, J.; Jia, R.; Pan, J. Isolation, characterization and germline chimera preparation of primordial germ cells from the Chinese Meiling chicken. Poult. Sci. 2019, 98, 566–572. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, Y.; Usui, F.; Nakamura, Y.; Ito, Y.; Tagami, T.; Nirasawa, K.; Matsubara, Y.; Ono, T.; Kagami, H. A novel method to isolate primordial germ cells and its use for the generation of germline chimeras in chicken. Biol. Reprod. 2007, 77, 115–119. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.J.; Choi, J.W.; Park, K.J.; Lee, Y.M.; Kim, T.M.; Sohn, S.H.; Lim, J.M.; Han, J.Y. Development of a pheasant interspecies primordial germ cell transfer to chicken embryo: Effect of donor cell sex on chimeric semen production. Theriogenology 2009, 72, 519–527. [Google Scholar] [CrossRef] [PubMed]
- Mozdziak, P.E.; Angerman-Stewart, J.; Rushton, B.; Pardue, S.L.; Petitte, J.N. Isolation of chicken primordial germ cells using fluorescence-activated cell sorting. Poult. Sci. 2005, 84, 594–600. [Google Scholar] [CrossRef] [PubMed]
- Collarini, E.J.; Leighton, P.A.; Van de Lavoir, M.C. Production of Transgenic Chickens Using Cultured Primordial Germ Cells and Gonocytes. Methods Mol. Biol. 2019, 1874, 403–430. [Google Scholar] [PubMed]
- Jung, J.G.; Kim, D.K.; Park, T.S.; Lee, S.D.; Lim, J.M.; Han, J.Y. Development of novel markers for the characterization of chicken primordial germ cells. Stem Cells 2005, 23, 689–698. [Google Scholar] [CrossRef] [PubMed]
- Rengaraj, D.; Zheng, Y.; Kang, K.; Park, K.; Lee, B.; Lee, S.; Choi, J.; Han, J. Conserved expression pattern of chicken DAZL in primordial germ cells and germ-line cells. Theriogenology 2010, 74, 765–776. [Google Scholar] [CrossRef] [PubMed]
- Xie, L.; Lu, Z.; Chen, D.; Yang, M.; Liao, Y.; Mao, W.; Mo, L.; Sun, J.; Yang, W.; Xu, H.; et al. Derivation of chicken primordial germ cells using an indirect Co-culture system. Theriogenology 2019, 123, 83–89. [Google Scholar] [CrossRef] [PubMed]
- Szczerba, A.; Kuwana, T.; Paradowska, M.; Bednarczyk, M. In Vitro Culture of Chicken Circulating and Gonadal Primordial Germ Cells on a Somatic Feeder Layer of Avian Origin. Animals 2020, 10, 1769. [Google Scholar] [CrossRef] [PubMed]
- Blaser, H.; Eisenbeiss, S.; Neumann, M.; Reichman-Fried, M.; Thisse, B.; Thisse, C.; Raz, E. Transition from non-motile behaviour to directed migration during early PGC development in zebrafish. J. Cell Sci. 2005, 118, 4027–4038. [Google Scholar] [CrossRef] [PubMed]
- Raz, E. Guidance of primordial germ cell migration. Curr. Opin. Cell Biol. 2004, 16, 169–173. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence | Product Length |
---|---|---|
cDAZL | F: TGTTTTTAAGTGTGCGGGCG | 449 bp |
R: GCTATGGAATTGCGGTGCAG | ||
Nanog | F: CACCCAGATGCCTCTCCAG | 426 bp |
R: AGGGAAGCCCTGGTGAAATG | ||
cPou5fl | F: GTTGTCCGGGTCTGGTTCT | 187 bp |
R: GTGGAAAGGTGGCATGTAGAC | ||
Sox2 | F: GCAGAGAAAAGGGAAAAAGGA | 171 bp |
R: TTTCCTAGGGAGGGGTATGAA | ||
GAPDH | F: GAGGGTAGTGAAGGCTGCTG | 109 bp |
R: CATCAAAGGTGGAGGAATGG |
Separation Methods | Separation Rate (%) | Efficiency of Red Blood Cell Removal (%) | Days to Double the Number of PGCs (d) |
---|---|---|---|
Percoll Density Gradient | 46.1 | 90 | 7 |
Lysis with ACK Buffer | 53.9 | 65 | 9 |
CEFs Attachment | 87.5 | 95 | 2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, X.; Xian, R.; Fu, Y.; Dai, Y.; Peng, R. A Novel, Efficient Method to Isolate Chicken Primordial Germ Cells from Embryonic Blood Using Cell Culture Inserts. Animals 2023, 13, 3805. https://doi.org/10.3390/ani13243805
Zhang X, Xian R, Fu Y, Dai Y, Peng R. A Novel, Efficient Method to Isolate Chicken Primordial Germ Cells from Embryonic Blood Using Cell Culture Inserts. Animals. 2023; 13(24):3805. https://doi.org/10.3390/ani13243805
Chicago/Turabian StyleZhang, Xia, Rui Xian, Yingxiao Fu, Yanyan Dai, and Rui Peng. 2023. "A Novel, Efficient Method to Isolate Chicken Primordial Germ Cells from Embryonic Blood Using Cell Culture Inserts" Animals 13, no. 24: 3805. https://doi.org/10.3390/ani13243805