A Novel PCR-Based Functional Marker of Rice Blast Resistance Gene Pi25

Abstract

Rice blast is arguably the most devastating fungal disease of rice. Utilization of resistance genes to breed resistant cultivars is one of the most economical and environmentally friendly approaches to combat the disease. Pi25, a major resistance gene conferring broad-spectrum resistance to both leaf and neck blast, is an ideal gene resource to improve the resistance of rice varieties to blast. Recently, several allele-specific markers were developed. However, they were deficiently efficient due to either an additional process of restriction enzyme digestion for cleaved amplified polymorphic sequence (CAPS) markers or the risk of false-positive error in identifying susceptible Tetep allele (Pi25^TTP) for PCR-based markers. In this study, based on a conserved single nucleotide polymorphism (SNP) between resistant and susceptible alleles, a tetra-primer amplification refractory mutation system (ARMS)-PCR marker was developed. The new marker, namely Pi25-2687R3, could effectively distinguish the resistant Gumei 2 (GM2) allele (Pi25^GM2) and the susceptible allele Pi25^TTP. Moreover, a perfect consistency of genotyping was exhibited between Pi25-2687R3 and published CAPS marker CAP3/Hpy 99I. A more accurate genotyping was also displayed compared to the previous PCR-based SNP marker Pi25-2566. Our finding proved that Pi25-2687R3 could achieve the same result as CAP3/Hpy 99I with less workload and cost and could promote the accuracy in the identification of genotypes superior to Pi25-2566. This study provided a quick and reliable functional marker for discriminating Pi25 alleles, which would be a valuable tool for genotypic assay and rice molecular breeding of blast resistance.

1. Introduction

Rice blast, caused by the fungus Magnaporthe oryzae, is arguably the most devastating fungal disease of rice [1]. Annually, 10–30% of yield losses occurred due to rice blast. However, even 10% is significant, being sufficient to feed 60 million people for one year [2]. Therefore, it is critical to adopt effective means to control the disease to ensure global food security. The exploitation of host plant resistance has generally been considered one of the most economical and environmentally friendly approaches to combat the disease [3]. A prerequisite for improving or breeding the resistant varieties is mining desired resistance (R) genes against rice blast [4,5].

Pi25 is a major R gene conferring broad-spectrum resistance to both leaf and neck blast, with a favorable allele derived from a durable resistance indica variety Gumei 2 (GM2) [6,7]. The functional allele Pi25^GM2 encodes a typical coiled coil-nucleotide binding site-leucine rich repeat (CC-NBS-LRR) protein [8]. The loss of function may be probably caused by a premature stop codon or missense mutations in the coding sequence (CDS) region. For example, Pi25^TTP (Tetep allele at Pi25 locus, GenBank: JQ838018.1) contains a nucleotide substitution from “a” to “g” at position 2462 from the start codon, leading to a truncated protein. Pi25^ZJ100 (Zhongjian 100 allele at Pi25 locus, GenBank: JQ838019.1) contains five missense mutations (g775a, t1197c, t2444a, c2566g, g2680a, and g2687a), resulting in a susceptible (S) protein [9].

Since Pi25 is an ideal gene resource to improve the resistance to blast in rice breeding programs, several kinds of molecular markers of Pi25 have been developed and used for marker assist-selection (MAS) breeding. Firstly, simple sequence repeat markers flanking the Pi25 locus, including RM3330, RM564, and RM7193, were applied to MAS breeding of rice blast-resistant restorer lines [10,11]. Subsequently, sequence-targeted site markers tightly linked to the Pi25 locus, including SA7, Si13070C, and Si13070D, were applied to MAS breeding of elite rice parents and hybrids with improved resistance to rice blast [10,11,12,13,14]. Two kinds of markers were both PCR-based and convenient for utilization in MAS. However, they were deficient in the accuracy of genotypic identification among breeding parents and germplasm due to the certain recombination with the Pi25 locus.

Along with the map-based cloning of Pi25, the allele-specific and gene-targeted markers were achieved according to the variations in the CDS region. Wang et al. developed four sets of cleaved amplified polymorphic sequence (CAPS) markers. CAP1/Hinc II and CAP3/Hpy 99I could digest specifically the R allele Pi25^GM2, according to single nucleotide polymorphism (SNP) 775 and SNP 2687, respectively. Meanwhile, CAP3/Bgl II and CAP3/Nde I could digest specifically the S allele Pi25^ZJ100, according to SNP 2444 and SNP 2566, respectively [9]. These markers were used to improve the blast resistance of varieties [15,16]. Furthermore, they were also utilized to clarify the distribution of the R allele of the Pi25 gene in rice germplasm in China [17,18,19,20,21]. Nevertheless, the CAPS marker requires an additional restriction enzyme digestion process after PCR amplification, resulting in the limit in simplicity and low cost.

Recently, a PCR-based functional SNP marker was developed by Zhou et al. [22]. The principle of primer design is similar to the method of tetra-primer amplification refractory mutation system (ARMS)-PCR marker [23]. The 3′-terminal nucleotide of the inner primer corresponded to the site of the SNP, and an artificial mismatch at position −3 from 3′-terminus was introduced. Consequently, allele-specific PCR product would be amplified due to higher efficiency with matched primer and lower efficiency with mismatched one. This marker was based on the SNP at the site of 2566, where the resistant allele Pi25^GM2 carried “c”, while the susceptible allele Pi25⁹³¹¹ carried “g”. However, Zhou et al. did not assess the susceptible allele Pi25^TTP, which owned the same nucleotide as Pi25^GM2 at this site. This conflict would bring the risk of false-positive identification of the resistant allele of the Pi25 gene when this marker was used.

To improve the convenience and accuracy of the allele-specific marker for the Pi25 gene, we developed a novel tetra-primer ARMS-PCR marker in this study. The new marker was based on the SNP at the site of 2687, where the resistant allele and the susceptible allele were highly conserved in “g” and “a”, respectively. For effective screening, we designed multiple primer pairs and conducted examinations using different annealing temperatures. For validation of the accuracy and reliability of the new marker, we also assayed various genotypes and rice germplasm compared with previously developed markers.

2. Materials and Methods

2.1. Plant Materials

Four sets of rice materials were applied in this study. (1) GM2, Zhong 156 (Z156), and TTP were used to screen the primer pairs of tetra-primer ARMS-PCR marker; (2) Ten varieties with known alleles at Pi25 locus were employed to validate the accuracy of the selected marker. They included GM2, Z156, TTP, ZJ100, Gumei 4 (GM4), Lijiangxintuanheigu (LTH), IRBLz-Fu, IRBLzt-T, IRBLz5-CA and IRBL9-W. The latter four are near-isogenic lines (NILs) of LTH and contain multiple alleles Piz, Pizt, Pi2, and Pi9 at Piz locus, respectively [24]; (3) Twelve breeding restorer lines and five rice hybrid varieties with different blast reactions were genotyped to verify the correlation between the genotype and phenotype; (4) Ninety-four rice landraces collected from 23 countries worldwide were genotyped to identify Pi25 alleles (

Table 1. Information on rice germplasm was used in this study.

No.	Accession Name	Country	Pi25-2687R3	CAP3/Hpy 99I	Pi25-2566
1	AKHNI SAIL	Bangladesh	−	−	−
2	AUS 43	Bangladesh	−	−	−
3	BERI	Bangladesh	−	−	−
4	BR 601-3-3-2-4	Bangladesh	−	−	−
5	CHAKULA	Bangladesh	−	−	−
6	RANGPUR	Bangladesh	−	−	−
7	MA HNAN THU KA	Burma	−	−	+
8	X72-7-1	Burma	−	−	−
9	IB 28	Burundi	−	−	−
10	IB 42	Burundi	−	−	−
11	NEANG CHHOUK	Cambodia	−	−	−
12	NEANG SAN	Cambodia	−	−	−
13	5173	Colombia	+	+	+
14	RT 1031-69	Congo	−	−	−
15	AMISTAD 82-8	Cuba	−	−	−
16	C.CORTO 1	Cuba	−	−	+
17	GU2725	Cuba	−	−	−
18	SELECCION VG-5	Cuba	−	−	−
19	GIZA 181	Egypt	−	−	−
20	CSR 11	India	−	−	−
21	CSR 12	India	−	−	−
22	CSR 13	India	−	−	−
23	CSR 5	India	−	−	−
24	CSR 9	India	−	−	−
25	DULAR	India	−	−	−
26	HARWA	India	−	−	−
27	HIMDHAN	India	−	−	−
28	HPA 74	India	−	−	−
29	JC 195	India	−	−	−
30	JW 42	India	−	−	−
31	JW 60	India	−	−	−
32	K 428-25	India	−	−	−
33	KAJARU	India	−	−	−
34	KALING A2	India	−	−	−
35	NDR 4012	India	−	−	−
36	NDR 89	India	−	−	−
37	OR 79-21	India	−	−	−
38	PR32-PD47-PD4	India	−	−	−
39	RP 1017-76-1-3-2	India	−	−	−
40	T 23	India	−	−	−
41	TM 10265	India	−	−	−
42	VL DHAN 16	India	−	−	−
43	B 6397F-MR-7-5M-1-1	Indonesia	−	−	−
44	BAHBUTONG	Indonesia	−	−	−
45	BATANG PANE	Indonesia	−	−	−
46	BOYO	Indonesia	−	−	−
47	CIMANUK	Indonesia	−	−	−
48	CIPUNEGARA	Indonesia	−	−	−
49	PADI SEGUTUK	Indonesia	−	−	+
50	DOMSIAH 138	Iran	−	−	−
51	HABATAKI	Japan	−	−	−
52	SANJIANG	Japan	−	−	−
53	SHINKWANG	Korea	−	−	−
54	JHALI	Nepal	−	−	−
55	ITA 304	Nigeria	−	−	−
56	MILYANG 70	North Korea	−	−	−
57	SHUIYUAN299	North Korea	−	−	−
58	368	Pakistan	−	−	−
59	BASMATI 370	Pakistan	−	−	−
60	BASMATI 685	Pakistan	−	−	−
61	GANJAY	Pakistan	−	−	−
62	JIJAI NIKI	Pakistan	−	−	−
63	KHARA GANJA	Pakistan	−	−	+
64	RATRIA	Pakistan	−	−	−
65	TAK RATIA	Pakistan	−	−	+
66	PANAMA 1537	Panama	+	+	+
67	75-1-120	Philippines	−	−	−
68	97A-M54	Philippines	−	−	−
69	A1452	Philippines	−	−	−
70	BINICOL	Philippines	−	−	−
71	PIRURUTONG	Philippines	−	−	−
72	PR 23631-98	Philippines	−	−	−
73	PRATAO PRECOCE	Philippines	−	−	−
74	SINABA	Philippines	−	−	−
75	SINANDOMENG	Philippines	−	−	−
76	BATHKIRIEL	Sri Lanka	−	−	−
77	BG 1165-1	Sri Lanka	−	−	−
78	BG 170	Sri Lanka	−	−	−
79	BG 915	Sri Lanka	−	−	−
80	KATAHATA HAMBA	Sri Lanka	−	−	−
81	MALKORA	Sri Lanka	−	−	−
82	MURUNGAWEE	Sri Lanka	−	−	−
83	SINNA SIVAPPU	Sri Lanka	−	−	−
84	NIAW SANPAH TAWNG	Thailand	−	−	−
85	XIANLUOSICHI	Thailand	−	−	−
86	DAWN CI9534	USA	−	−	−
87	NOVA 66 CI9481	USA	−	−	−
88	BAU HUONG DOONG	Vietnam	−	−	−
89	CHAH NONG NGHE AN	Vietnam	−	−	+
90	CHIEM BAC	Vietnam	−	−	−
91	LAI TRANG	Vietnam	−	−	−
92	QUCM	Vietnam	−	−	−
93	RE BAU	Vietnam	−	−	+
94	RE CHANH	Vietnam	−	−	+

Note: +, resistant allele; −, susceptible allele.

).

LTH, IRBLz-Fu, IRBLzt-T, IRBLz5-CA, and IRBL9-W were provided by the Zhejiang Academy of Agricultural Sciences, Zhejiang Province, China, while the others were from the China National Rice Research Institute.

2.2. Primer Design

The design of primer pairs was followed Ye’s method [23]. Because SNP 2687 is located very close to the 3′ end of CDS (2775 bp) (GenBank: HM448480.1), and the CDS sequence of Pi25^TTP is only 2463 bp (GenBank: JQ838018.1), we re-sequenced GM2, Z156 and TTP alleles at Pi25 locus and extended the nucleotide sequence to about 3000 bp. The forward and reverse outer primers were designed 100~300 bps away from SNP 2687 using Oligo Primer Analysis Software Version 7.0. The forward and reverse inner primers were determined using the following principles: (1) SNP 2687 was put in the 3′ terminus of either forward primer or reverse primer (Figure 1); (2) Extra destabilizing mismatches were introduced at the position −2 and −3 from the 3′ terminus in order to increase the specificity in amplification of each allele (Figure 1); (3) The length of primer was adjusted to ensure the similar Tm value output within the paired primers using Oligo Primer Analysis Software Version 7.0.

Near SNP 2687, additional SNP (g2680a) was occurred. At SNP 2680, the R allele Pi25^GM2 and the S allele Pi25^TTP owned the identical nucleotide “g”, while another susceptible allele Pi25^{ZJ 100} carried “a” (Figure 1). To obtain the best effect of amplification and specificity, we carried out two ways to design the inner primers based on whether two SNPs were involved in producing an R-specific fragment or an S-specific fragment. (A) The oligonucleotide of the Pi25^GM2 allele containing both “g” at SNP 2680 and SNP 2687 was used as the template of forward inner (FI) primer-R. The R-specific fragment would be produced when FI primer-R is paired with a common reverse outer (RO) primer. On the other hand, the S-specific fragment was generated using the reverse inner (RI) primer-S based on the antisense strand of Pi25^Z156 with a common forward outer (FO) primer (Figure. 1A). (B) The oligonucleotide of the Pi25^Z156 allele containing both “a” at SNP 2680 and SNP 2687 was used as the template of forward inner (FI) primer-S. The S-specific fragment would be generated using FI primer-S and common RO primer. The R-specific fragment was produced using FO primer and RI primer-R based on the antisense strand of Pi25^GM2 (Figure 1B).

As a result, two sets of primer pairs were employed. The first set (set A) consisted of three pairs, namely R1, R2 and R3. They shared the same primers, 2687-FO, 2687-RO, and 2687-FI-R, but differed in the 2687-RI-S primer with multiple artificial mismatches, such as TT/CC, TT/GG, and TT/AA, respectively. Another one (set B) is composed of F1, F2, and F3 primer pairs. The difference occurred in the 2687-FI-S primers with GA mutated to TC, TG, and TT, respectively (

Table 2. Primers of tetra-primer ARMS-PCR markers developed in this study.

Type	Name	Sequence (5′-3′)
Forward outer primer	2687-FO	CACACCTGAATGAAATTAAGATGACA
Reverse outer primer	2687-RO	ATATACAATATTGAGGGTATGGAAC
Forward inner primer-R	2687-FI-R	GCTTGTGGATAGAGTCCTTCG
Reverse inner primer-S	2687-RI-S1	CAAATCATTCGCTCTTTTCCCT
	2687-RI-S2	CAAATCATTCGCTCTTTTGGCT
	2687-RI-S3	TCACAAATCATTCGCTCTTTTAACT
Forward inner primer-S	2687-FI-S1	GAGCTTGTGGATAGAATCCTCCA
	2687-FI-S2	GAGCTTGTGGATAGAATCCTGCA
	2687-FI-S3	GAGCTTGTGGATAGAATCCTTCA
Reverse inner primer-R	2687-RI-R	TCACAAATCATTCGCTCTTTTAACC

Note: Red letter represents nucleotide at the SNP site of 2680 and 2687; Green letter represents mismatched nucleotide.

).

2.3. DNA Extraction and Marker Assay

Genomic DNA was isolated from the fresh leaves of each plant following the mini-preparation protocol of Zheng et al. [25].

PCR was performed using 2×Taq MasterMix (CWBIO, Beijing, China), 0.2 μM of each primer, and ~50 ng of template DNA in a 15-μL reaction volume. Reaction conditions were: initial denaturation at 94 °C for 2 min, followed by 30 cycles of denaturation at 94 °C for 30 s; annealing for 30 s; and extension at 72 °C for 30 with a final extension at 72 °C for 5 min. For screening primer pairs, gradient annealing temperatures were used and set to be 50 °C, 53 °C, 55 °C and 58 °C, respectively. For the final primer pair selected, the annealing temperature was optimized to 53 °C. PCR products were electrophoretically separated in 2% agarose, followed by staining with GelRed dye (Biotium, CA, USA) and photographing with Gel Doc XR⁺ system (BIO-RAD, CA, USA).

2.4. Rice Blast Resistance Evaluation

Seventeen breeding materials were planted in the blast nursery, Chadi town, Shanghang country, Longyan city, Fujian Province, China. Resistance to leaf blast and neck blast was investigated after the susceptible control variety was gotten susceptible at the seedling and maturity stages, respectively. The evaluation system was employed following the national standard NY/T2646-2014, which was finally divided into six resistance grades. The details are high resistance (HR), resistance (R), moderate resistance (MR), moderate susceptibility (MS), susceptibility (S) and high susceptibility (HS), respectively.

3. Results

3.1. Selection of Primer Pairs

For set A of primer pairs, R-specific fragment was generated in the length of 318 bp, whereas S-specific fragment was 193 bp in R1 and R2 and 196 bp in R3, respectively. For set B, R-specific and S-specific product was 196 bp and 320 bp in length, respectively. For both sets, a 469 bp-length fragment could be amplified as the common product (Figure 2).

Three expected products, including common fragment, R-specific fragment, and S-specific fragment, were all clearly visible at 50 °C except R2. When the annealing temperature was increased to 58 °C, amplicons appeared very weak or even invisible for all pairs. Furthermore, the bands of the R-specific fragment and S-specific fragment were all brighter in R3 than in R1 at 50 °C, 53 °C and 55 °C, respectively. On the other hand, the product of TTP was weak or even missing at 53 °C and 55 °C in F2 and F3, while the amplicon of GM2 was much weaker than Z156 and TTP at 50 °C, 53 °C and 55 °C in F1 (Figure 2).

Therefore, R3, comprising 2687-FO, 2687-RO, 2687-FI-R, and 2687-RI-S3, was selected as the final primer pair to conduct the next investigations. The marker was consequently named Pi25-2687R3. The common, R-specific, and S-specific fragment was 469 bp, 318 bp, and 196 bp in length, respectively. Considering the non-specific amplification at 50 °C, as well as weaker amplification at 55 °C, an optimal 53 °C was recommended in the PCR reaction.

3.2. Validation of Newly Developed Marker

To validate the accuracy of the newly developed marker, we performed genotyping using 10 varieties with known alleles at the Pi25 locus. As Wang’s report, only GM2, GM4, and C101A51 (the donor of Pi2) possessed the R allele, and others carried the S allele when they were genotyped by CAPS marker CAP3/Hpy 99I [9]. Using Pi25-2687R3, GM2, GM4, and IRBLz5-CA (a NIL of LTH carrying Pi2 allele) showed the R-specific band, and others showed the S-specific band (Figure 3). It proved that Pi25-2687R3 could obtain the identical result with CAP3/Hpy 99I.

Meanwhile, we carried out genotyping using a previous marker developed by Zhou et al. [21]. Because Zhou’s marker was not given a name, here we temporarily named it Pi25-2566 due to its design based on SNP2566. It was as expected that all the varieties presented the same pattern between Pi25-2687R3 and Pi25-2566, except TTP (Figure 3). TTP displayed a distinct pattern, which corresponds to the fact that TTP presents the identical nucleotide of Z156 at SNP2687 and that of GM2 at SNP2566. The result indicated that Pi25-2687R3 could greatly promote the accuracy of characterizing the Pi25^GM2 allele compared to Pi25-2566.

Furthermore, 12 restorer lines and five hybrid varieties were employed to verify the effectiveness of Pi25-2687R3. Among 12 restorer lines, 10 were identified to carry the homozygous R allele, and two lines were homozygous S allele, whereas all hybrid varieties took the heterozygous allele (Figure 4). At the same time, the rice blast resistances of these lines/varieties were investigated in the blast nursery. Ten lines carrying the homozygous R allele, as well as five hybrids with heterozygous allele, displayed resistance grade “R” or “MR”, whereas two lines taking the homozygous S allele exhibited “S” or “MS” (

Table 3. Phenotype of rice breeding lines/varieties genotyped with Pi25-2687R3.

No. in Figure 4	Line/Variety	Type	Genotype	Phenotype
1	R173	Restorer line	+	R
2	R1909	Restorer line	+	R
3	R1913	Restorer line	+	R
4	R1925	Restorer line	+	MR
5	R1927	Restorer line	+	R
6	R1932	Restorer line	+	MR
7	R1933	Restorer line	+	MR
8	R1934	Restorer line	+	R
9	R1937	Restorer line	−	S
10	ZP174	Restorer line	+	R
11	ZP175	Restorer line	−	MS
12	ZP178	Restorer line	+	R
13	Maoxiangyou 61	Hybrid variety	+/−	R
14	Mixiangyou 153	Hybrid variety	+/−	R
15	Huangyou 153	Hybrid variety	+/−	R
16	Zhongxiangyou 173	Hybrid variety	+/−	R
17	Zhiliangyou 173	Hybrid variety	+/−	R

Note: +, homozygous resistant allele; −, homozygous susceptible allele; +/−, heterozygous allele; R, resistance; MR, moderate resistance; MS, moderate susceptibility; S, susceptibility.

). Results showed a perfect correlation between the Pi25-2687R3 genotype and the observed phenotype. The Pi25^GM2 presence is consistent with the resistance to rice blast, indicating Pi25-2687R3 could be a potential functional marker to predicate the presence of the Pi25^GM2 allele with resistance to rice blast.

3.3. Genotyping Germplasm Using Allele-Specific Markers

Ninety-four rice landraces from 23 countries worldwide were utilized to genotype alleles at the Pi25 locus. To compare the efficiency of a new marker, published markers CAP3/Hpy 99I and Pi25-2566 were also used.

A perfect consistency was revealed between Pi25-2687R3 and CAP3/Hpy 99I. Only two accessions were identified to carry the Pi25^GM2 allele. They were 5173 (No. 13) and PANAMA 1537 (No. 66), collected from Colombia and Panama, respectively (Figure 5, Table 1). It further proved that Pi25-2687R3 was as reliable as CAP3/Hpy 99I but with less workload and cost.

For Pi25-2566, a total of 10 accessions were observed to carry the same pattern as Pi25^GM2. Among 10 accessions, 5173 (No. 13) and PANAMA 1537 (No. 66) were stably identified. The others might be false-positive, which were MA HNAN THU KA (No. 7), C.CORTO 1 (No. 16), PADI SEGUTUK (No. 49), KHARA GANJA (No. 63), TAK RATIA (No. 65), CHAH NONG NGHE AN (No. 89), RE BAU (No. 93) and RE CHANH (No. 94), respectively (Figure 5, Table 1). Results supported that Pi25-2687R3 was superior to Pi25-2566 in the accuracy of characterizing the Pi25^GM2 allele.

4. Discussion

The ability to quickly and reliably select desirable materials and to eliminate individuals that contain favorable alleles is critical to the success of a plant breeding program [26]. With the progress of cloning of blast resistance genes, new gene-target markers or functional markers showed more accuracy than linked markers due to gene/functional markers being complete co-segregation and non-recombination with the target gene. For rice blast resistance gene Pi25, several gene/functional markers have been developed [9,22]. However, they were deficiently efficient due to either an additional process of restriction enzyme digestion for CAPS markers or the risk of false-positive error in identifying susceptible Pi25^TTP for Pi25-2566. In the present study, we provided a new functional marker, Pi25-2687R3, which can specifically identify Pi25^GM2 and efficiently distinguish it from Pi25^TTP. The investigations demonstrated that Pi25-2687 was accurate and reliable.

Pi25^GM2 has been successfully utilized in modern breeding to improve the blast resistance of elite rice parents, hybrids, and conventional varieties [10,11,12,13,14,15,16,22,27]; a low frequency of the R allele was found in the germplasm in China [9,17,18,19,20,21], implying Pi25^GM2 is rare. Furthermore, little is known about the distribution of Pi25^GM2 abroad, which would largely limit the utilization of this important gene. In this work, we employed Pi25-2687 to genotype 94 rice landraces from 23 countries worldwide. Only two accessions were identified to possess Pi25^GM2, indicating a similar low frequency was also found in other countries. The two landraces were 5173 and PANAMA 1537, from Colombia and Panama, respectively. It was known that 5173 was also the donor of the resistant Pi2 allele, and the favorable Pi2 allele of C101A51 was originally introduced from 5173 [28]. Thus, it could be understandable that 5173 carries the resistant allele Pi25^GM2. Geographically, Panama is situated in the south of Central America, and Colombia is located in the north of South America. Two countries are adjacent to each other, indicating 5173 and PANAMA 1537 might possibly have a close relationship. The exploitation of two rice landraces would provide a valuable resource for the utilization of the R allele of the Pi25 gene.

Tetra-primer ARMS-PCR marker, a SNP-based allelic-specific marker, is simple and cost-effective [29]. Hence, it has been successfully utilized in rice MAS breeding, such as rice blast resistance, herbicide resistance, and rice quality [30,31,32]. However, the usual tetra-primer ARMS-PCR has a laborious process for optimization [33]. In this study, we conducted various examinations using six combinations of primer pairs and optimized the annealing temperature. In this process, two phenomena were observed.

(1) When the annealing temperature was increased from 50 °C to 58 °C, the amplified products were changed from brighter to weaker or even invisible. We finally chose 53 °C as the annealing temperature for the Pi25-2687R3 marker because of the non-specific amplification at 50 °C and weaker amplification at 55 °C. However, it does not mean that other primer pairs could not be used. For example, primer pairs of F2 and F3 could also produce bright bands at 50 °C (Figure 2). Anyway, R3 and 53 °C would be the most optimal choice and recommended.

(2) Different mismatches resulted in diverse outcomes. For instance, distinct amplifications were displayed in F1 and F2, which differ only in the mutation of “a/c” and “a/g” at position -2 from the 3′ terminus of primer 2687-FI-S1 and 2687-FI-S2, respectively (Figure 1, Table 2). Based on Ye’s report, “a/c” belongs to a “weak” mismatch, and “a/g” belongs to a “strong” mismatch [23]. Accordingly, F1 contained two “weak” mismatches, whereas F2 included a “weak” mismatch plus a “strong” one. Because there was an additional SNP2680 (g/a, a strong mismatch) located in the middle of the primer, an over-mismatch could probably have happened in F2, resulting in no product. For F3, “a/t” belongs to the “medium” mismatch, and a weak band was appeared. In short, bright, weak, and invisible band was demonstrated in F1, F3, and F2 due to “two weak and a strong” mismatches, “a weak, a medium and a strong” mismatches, and “a weak and two strong” mismatches, respectively.

5. Conclusions

In this study, a novel tetra-primer ARMS-PCR marker for quick and reliable identification of Pi25 was developed. Compared to previous gene-targeted markers, it could promote the accuracy in the identification of genotypes or could achieve the same result with less workload and cost. The newly developed marker would be a valuable tool for genotypic assay and rice molecular breeding of blast resistance.