Isolation and Characterization of Sixteen Polymorphic Microsatellite Loci in the Golden Apple Snail Pomacea canaliculata
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. Isolation of Microsatellite Markers
3.2. Data Analysis
4. Conclusions
Acknowledgments
References
- Cowie, RH. Apple Snails (Ampullariidae) as Agricultural Pests: Their Biology, Impacts and Management. In Molluscs as Crop Pests; Barker, GM, Ed.; CAB International: Wallingford, UK, 2002; pp. 145–192. [Google Scholar]
- Martín, PR; Estebenet, AL; Cazzaniga, NJ. Factors affecting the distribution of Pomacea canaliculata (Gastropoda: Ampullariidae) along its southernmost natural limit. Malacologia 2001, 43, 13–23. [Google Scholar]
- Brand, E; Yokosawa, T; Fujio, Y. Chromosome Analysis of apple snail Pomacea canallculata. Tohoku J Agric Res 1990, 40, 81–89. [Google Scholar]
- Hayes, KA; Joshi, RC; Thiengo, SC; Cowie, RH. Out of South America: Multiple origins of non-native apple snails in Asia. Divers Distrib 2008, 14, 701–712. [Google Scholar]
- Lowe, S; Browne, M; Boudjelas, S; De Poorter, M. 100 of the world’s worst invasive alien species. Aliens 2000, 12, S1–S12. [Google Scholar]
- Yang, YX; Hu, YC; Li, XH; Wang, XJ; Mu, XD; Song, HM; Wang, PX; Liu, C; Luo, JR. Historical invasion, expansion process and harm investigation of Pomacea canaliculate in China. Chin Agric Sci Bull 2010, 26, 245–250. [Google Scholar]
- Rawlings, TA; Hayes, KA; Cowie, RH; Collins, TM. The identity, distribution, and impacts of non-native apple snails in the continental United States. BMC Evol Biol 2007, 7. [Google Scholar] [CrossRef]
- Rice, WR. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
- Van Oosterhout, C; Hutchinson, WF; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes 2004, 4, 535–538. [Google Scholar]
- Dakin, EE; Avise, JC. Microsatellite null alleles in parentage analysis. Heredity 2004, 93, 504–509. [Google Scholar]
- Chapuis, MP; Loiseau, A; Michalakis, Y; Lecoq, M; Estoup, A. Characterization and PCR multiplexing of polymorphic microsatellite loci for the locust Locusta migratoria. Mol Ecol Notes 2005, 5, 554–557. [Google Scholar]
- Brownlow, RJ; Dawson, DA; Horsburgh, GJ; Bell, JJ; Fish, J. A method for genotype validation and primer assessment in heterozygote-deficient species, as demonstrated in the prosobranch mollusc Hydrobia ulvae. BMC Genet 2008, 9, 55–63. [Google Scholar]
- Carlsson, J; Morrison, CL; Reece, KS. Wild and aquaculture populations of the eastern oyster compared using microsatellites. J Hered 2006, 97, 595–598. [Google Scholar]
- Reece, KS; Ribeiro, WL; Gaffney, PM; Carnegie, RB; Allen, SK, Jr. Microsatellite marker development and analysis in the eastern oyster, Crassostrea virginica: Confirmation of null alleles and non-Mendelian segregation ratios. J Hered 2004, 95, 355–361. [Google Scholar]
- de Sousa, SN; Finkeldey, R; Gailing, O. Experimental verification of microsatellite null alleles in Norway spruce (Picea abies [L.] Karst.): Implications for population genetic studies. Plant Mol Biol Rep 2005, 23, 113–119. [Google Scholar]
- Chapuis, MP; Estoup, A. Microsatellite null alleles and estimation of population differentiation. Mol Biol Evol 2007, 24, 621–631. [Google Scholar]
- Carlsson, J. Effects of microsatellite null alleles on assignment testing. J Hered 2008, 99, 616–623. [Google Scholar]
- Rousset, F; Raymond, M. Testing heterozygote excess and deficiency. Genetics 1995, 140, 1413–1419. [Google Scholar]
- Vos, P; Hogers, R; Bleeker, M. AFLP: A new technique for DNA fingerprinting. Nucleic Acids Res 1995, 23, 4407–4414. [Google Scholar]
- Zane, L; Bargelloni, L; Patarnello, T. Strategies for microsatellite isolation: A review. Mol Ecol 2002, 11, 1–16. [Google Scholar]
- Rozen, S; Skaletsky, HJ. Krawetz, S, Misener, S, Eds.; PRIMER 3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Marshall, TC; Slate, J; Kruuk, LEB; Pemberton, JM. Statistical confidence for likelihood— based paternity inference in natural populations. Mol Ecol 1998, 7, 639–655. [Google Scholar]
- Rousset, F. GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Mol Ecol Resour 2008, 8, 103–106. [Google Scholar]
Locus | Primer sequence (5′-3′) | Repeat motif | Allele size range (bp) | Ta(°C) | Na | HO | HE | Accession No. |
---|---|---|---|---|---|---|---|---|
Pc46 | F: (HEX)CTGCTCACTCAGCCATTC R: GCTTACCACACCCTTAGA | (CA)14 | 141–165 | 55 | 13 | 0.86 | 0.90 | JN129127 |
Pc51 | F: (6FAM)AGCATCTGTGGGAAAGGTGAC R: GCCAGCAGCAAGTAATGTGAG | (CA)9CG(CA)6 | 164–176 | 55 | 7 | 0.55 | 0.75 | JN129128 |
Pc59 | F: (TAMRA)GCGATACTTTACGGACTTG R: CAAAATATGCTTTCATCTGC | (CA)24 | 131–173 | 55 | 6 | 0.31 | 0.80 | JN129129 |
Pc69 | F: (6FAM)TGGTAAAGGGTTTGGGTCGTC R: GGGAATAGGGACAGTTGAGAGG | (CA)8AA(CA)7 | 117–129 | 55 | 5 | 0.45 | 0.52 | JN129130 |
Pc82 | F: (6FAM)CAAGCGAGTATTTCAGT R: ACCTCAATGTAATCACG | (CA)6CGCCTA(CA)9 | 204–218 | 50 | 6 | 0.69 | 0.77 | JN129131 |
Pc83 | F: (HEX)CACTGTATCATCCCCTG R: TCTGGTTGAGTTTCTACG | (CA)13 | 187–199 | 50 | 6 | 0.83 | 0.78 * | JN129132 |
Pc88 | F: (HEX)GATGTAAGTGTGCTTTCAAC R: AGGGTTCGGAGACAGAC | (CA)12 | 170–184 | 55 | 5 | 0.90 | 0.64 * | JN129133 |
Pc97 | F: (HEX)TTCCACAACCATCATCACG R: CTCGGGGTCACACTTCTG | (CA)13 | 129–145 | 55 | 6 | 0.45 | 0.81 * | JN129134 |
Pc102 | F: (HEX)ACGGCTTCCAACTCAGA R: TGCTTTCCTTTAGTCCAG | (CA)14 | 166–196 | 55 | 6 | 0.41 | 0.74 * | JN129135 |
Pc113 | F: (6FAM)TGCGTTTACTGGGAGAAG R: GCATAATCGGGGAAGAAG | (CA)13CT(CA)12 | 208–256 | 55 | 7 | 0.76 | 0.81 | JN129136 |
Pc140 | F: (6FAM)ACACCTTTTCCGACACG R: GAGACGCTTTGACCACAT | (CA)6CT(CA)5 | 195–217 | 52 | 6 | 0.31 | 0.73 * | JN129137 |
Pc156 | F: (TAMRA)ACCTTGTCCAGTTCTTC R: GAAATAGTCCTAAGTCCTC | (CA)18CG(CA)23 | 170–190 | 52 | 9 | 0.97 | 0.79 * | JN129138 |
Pc205 | F: (6FAM)CCTCTTCAGTGTTTGGAC R: ATACAGCAGGGTGGGAT | (CA)7-(CA)11 | 110–128 | 52 | 8 | 0.79 | 0.76 | JN129139 |
Pc216 | F: (6FAM)TGCCCCAGCTTTGTAAA R: CTCTCCTCCCTGCTCTATG | (CA)5AGCA AA(CA)11AGCAAA(CA)7 | 123–129 | 52 | 3 | 0.45 | 0.53 | JN129140 |
Pc221 | F: (HEX)ATGGCGAACACCAACTC R: TACTTCACGCATGCTTTG | (CA)29AA(CA)8 | 172–194 | 55 | 10 | 0.93 | 0.87 * | JN129141 |
Pc235 | F: (TAMRA)AACCAACTAACAAACTCG R: GCAAAGGTAGTGTCCAT | (CA)30 | 175–199 | 50 | 9 | 0.93 | 0.73 * | JN129142 |
© 2011 by the authors; licensee MDPI, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Chen, L.; Xu, H.; Li, H.; Wu, J.; Ding, H.; Liu, Y. Isolation and Characterization of Sixteen Polymorphic Microsatellite Loci in the Golden Apple Snail Pomacea canaliculata. Int. J. Mol. Sci. 2011, 12, 5993-5998. https://doi.org/10.3390/ijms12095993
Chen L, Xu H, Li H, Wu J, Ding H, Liu Y. Isolation and Characterization of Sixteen Polymorphic Microsatellite Loci in the Golden Apple Snail Pomacea canaliculata. International Journal of Molecular Sciences. 2011; 12(9):5993-5998. https://doi.org/10.3390/ijms12095993
Chicago/Turabian StyleChen, Lian, Haigen Xu, Hong Li, Jun Wu, Hui Ding, and Yan Liu. 2011. "Isolation and Characterization of Sixteen Polymorphic Microsatellite Loci in the Golden Apple Snail Pomacea canaliculata" International Journal of Molecular Sciences 12, no. 9: 5993-5998. https://doi.org/10.3390/ijms12095993