Isolation and Characterization of 15 New Microsatellite Markers in Oncomelania hupensis, the Snail Intermediate Host of Schistosoma japonicum in Mainland China
National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention, Shanghai 200025, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2012, 13(5), 5844-5850; https://doi.org/10.3390/ijms13055844
Submission received: 27 March 2012
/
Revised: 19 April 2012
/
Accepted: 10 May 2012
/
Published: 15 May 2012
Abstract
:Oncomelania hupensis is the unique intermediate host of Schistosoma japonicum, which plays a key role during the transmission of schistosomiasis. It is mainly found in the Yangtze River valley and mountains or hills in southwest China. In this paper, we described 15 new microsatellite makers in O. hupensis. Polymorphism of each locus was assessed in 80 individuals from four wild populations (n = 20 per population). The number of alleles per locus ranged from 6 to 29, with an average of 15.8. The observed (HO) and expected (HE) heterozygosities varied from 0.397 to 0.851 and from 0.696 to 0.948, respectively. These microsatellite markers will be useful for population genetic studies and genome mapping in O. hupensis.
1. Introdution
Schistosomiasis, caused by Schistosoma japonicum, remains one of the most prevalent parasitic infections and raises significant socio-economic and public health consequences in China [1–4]. Oncomelania hupensis is the unique intermediate host of Schistosoma japonicum, which plays a key role during the transmission of schistosomiasis and mainly spread in the Yangtze River valley and mountains or hills in southwest China [5–7]. The O. hupensis has been found in four different ecological settings: the region of swamps and lakes in the Yangtze River basin (part of the Anhui, Hubei, Hunan, Jiangsu, Jiangxi and Zhejiang provinces), the mountainous region of the Sichuan and Yunnan provinces, the hilly, littoral part of the Fujian province, and the Karst landscape of Guangxi autonomous region. O. hupensis has caused a schistosomiasis endemic in mainland China [8,9]. The genetic diversity in the different geographical populations of the snail and the co-evolution between O. hupensis and S. japonicum are of great interest because the branching patterns of snail diversity could be a map to the patterns of parasite diversity [10–12]. However, microsatellite markers have not been used extensively for the snail genetic structure studies and genome mapping. There are only a few applications of SSR-PCR analysis of genetic variation in different populations [13,14].
2. Results and Discussion
A total of 292 positive clones were identified and sequenced. Out of the 292 sequences, 26 sequences did not contain microsatellite sequences. Sixty-one sequences were not used because the length was less than 100 bp or they were the same sequences. Therefore, in total, 205 unique sequences were obtained (GU204044- GU204248). From 30 chosen sequences, a total of 21 primer pairs produced successful and consistent amplification. These primers were further examined for polymorphism with O. hupensis from Fujian (FJF), Sihuan (SCH), Guangxi (GXY), and Anhui (AXH) populations, and 20 individuals were taken from each population. Fifteen microsatellite loci displayed polymorphisms (Table 1).
The number of alleles per locus ranged from 6 to 29, with an average of 15.8. However, three loci (T5-11, D11, T4-36) were monomorphic in the GXY population. The observed (HO) and expected (HE) heterozygosities varied from 0.397 to 0.851 and from 0.696 to 0.946, respectively. Significant deviation from Hardy–Weinberg equilibrium (HWE) was observed, 13 out of 60 (21.67%) possible single exact locus tests (P < 0.01). Analysis with MICROCHECKER indicated the possible occurrence of null alleles at six loci (T6-47, T5-21, T4-36, E3, E15, C23). The presence of null alleles can sometimes be detected as an excess of homozygotes leading to deviations from HWE. In addition, null alleles lower apparent genetic variability, they may erroneously inflate levels of genetic differentiation and affect population genetic analyses that rely on HWE [15,16]. A deviation from HWE may also be due to selection, population mixing, nonrandom mating, sampling strategies, and undetected sex-linkage. No significant linkage disequilibrium was found between all pairs of these 15 loci (Table 2) (P < 0.01), which indicated the independent behavior of all loci.
3. Experimental Section
3.1. Isolation of Microsatellite Loci
All the samples were bred in a laboratory for at least one week. Then, the samples negative to S. japonicum were selected. After removal of the gut and digestive glands from the soft parts of the snail, genomic DNA was extracted from the muscle tissues of the snail followed by the standard DNA extraction procedure using mollusk DNA Kit (Omega, Norcross, GA, USA) [17]. Then, we followed the protocol of Hammond for construction of a microsatellite enriched genomic library, with some minor modification [18]. Briefly, total genomic DNA was digested with restriction enzyme Sau3AI (Fermentas, Burlington, Ontario, Canada) and then ligated to Sau3AI AFLP adaptor followed by amplification with adaptor-specific primers (SauLA: 5′-GCG CTA CCC GGG AAG CTT GG-3′, and SauLB: 5′-ATC CCA AGC TTC CCG GGT ACC GC-3′).
Microsatellite enrichment involved three rounds of PCR amplification. The first enrichment PCR used SauLA sequence as primer and ligated DNA as template. The amplified DNA fragments were then denatured and hybridized with biotinylated oligonucleotides [(AAT)17, (GA)25, (CCT)17, (AC)25, (CAG)17, (CAC)5, (TC)10, (TG)18]. The target moleculars bond with complementary microsatellites in the genomic library. The genomic fragments with microsatellite were captured with Vectrex Avidin D through hybridization. Genomic DNA that contained microsatellite repeats were stripped from Vectrex Avidin D and concentrated by ultrafiltration using Amicon Ultra-4 (Millipore). The second enrichment was identical to the first enrichment procedure to further amplify genomic fragments with microsatellites. The third enrichment procedure contained PCR amplification only. The PCR used the SauLA sequence as primer and concentrated DNA from the second enrichment as template. The amplified fragments were cloned into a plasmid using TOPO TA Cloning Kit (Invitrogen), and a microsatellite-enriched genomic library was thus constructed.
3.2. Detection of Polymorphism
Thirty sequences were chosen and used to amplification. Primers were designed flanking each suitable microsatellite sequence, using the primer 3.0 computer program [19]. A total of 21 primer pairs produced successful and consistent amplification, and those primers were further examined for polymorphism with O. hupensis field snails. One of the two primers that were used to amplify each locus was labeled with a fluorescent dye such as HEX, NED and FAM. Polymorphisms of microsatellite loci were evaluated in 80 wild individuals O. hupensis from Fujian, Sichuan, Guangxi and Yunnan province. Microsatellites were amplified under the following conditions. The reaction mixtures (25 μL) total containing 1× Taq buffer, 0.15 mM dNTPs, 0.5 μM forward and reverse primers, 1.5 mM MgCl2, 1.0 U Taq polymerase (Tiangen, Beijing, China) and about 20 ng gemonic DNA. PCR amplification was carried out on a Thermal Cycler (PTC-100, BIO-RAD, USA). Conditions included the following steps: an initial denaturation at 95 °C for 5 min, 35 cycles of 95 °C for 1 min, annealing at a set temperature depending on each locus (Table 1) for 45 s and 72 °C for 1.5 min, and final extension at 72 °C for 5 min. PCR products were determined using the Genetic Analyser 3730 (Applied Biosystems, Carlsbad, CA, USA), and analyzed by genescan 3.7 and genotyper 3.7 (Applied Biosystems).
3.3. Data Analysis
Standard genetic diversity parameters of polymorphic loci, e.g., the number of alleles (NA), and expected (HE) and observed (HO) heterozygosity, and Hardy-Weinberg equilibrium (HWE) and linkage dis-equilibrium were tested using GENEPOP 4.0 [20]. Null allele frequencies were calculated using Micro-Checker 2.2.3 [21].
4. Conclusions
The 15 microsatellite markers developed in this study are the first set of such markers for O. hupensis. They should prove useful for further investigating the spatial genetic structure, genetic diversity, and levels of gene flow within and among populations of this species.
Acknowledgments
The research was Supported by the National Natural Science Foundation of China (Grant No. 81101280; 81101275; 30590373), National Project of Important Infectious Diseases (Grant No. 2008-ZX10004-011).
References
- Utzinger, J.; Zhou, X.N.; Chen, M.G.; Berqquist, R. Conquering schistosomiasis in China: The long march. Acta Trop 2005, 96, 69–96. [Google Scholar]
- Wang, L.D.; Utzinger, J.; Zhou, X.N. Schistosomiasis control: Experiences and lessons from China. Lancet 2008, 372, 1793–1795. [Google Scholar]
- Wang, L.D.; Chen, H.G.; Guo, J.G.; Zeng, X.L.; Hong, X.L.; Xiong, J.J.; Wu, X.H.; Wang, X.H.; Wang, L.Y.; Xia, G.; et al. A strategy to control transmission of Schistosoma japonicum in China. N. Engl. J. Med 2009, 360, 121–128. [Google Scholar]
- Li, S.Z.; Luz, A.; Wang, X.H.; Xu, L.L.; Wang, Q.; Qian, Y.J.; Wu, X.H.; Guo, J.G.; Xia, G.; Wang, L.Y.; et al. Schistosomiasis in China: Acute infections during 2005–2008. Chin. Med. J. (Engl.) 2009, 122, 1009–1014. [Google Scholar]
- Attwood, S.W.; Upatham, E.S.; Zhang, Y.P.; Yang, Z.Q.; Southgate, V.R. A DNA-sequence based phylogeny for triculine snails (Gastropoda: Pomatiopsidae: Triculinae), intermediate hosts for Schistosoma (Trematoda: Digenea): Phylogeography and the origin of Neotricula. J. Zool. Lond 2004, 262, 47–56. [Google Scholar]
- Davis, G.M.; Wilke, T.; Zhang, Y.; Xu, X.J.; Qiu, C.P.; Spolsky, C.; Qiu, D.C.; Li, S.Z.; Xia, M.Y.; Feng, Z. Snail-schistosoma, paragonimus interactions in China: Population ecology, genetic diversity, coevolution and emerging diseases. Malacologia 1999, 41, 355–377. [Google Scholar]
- Zhou, Y.B.; Zhao, G.M.; Peng, W.X. Spatial genetic correlation analyses of Schistosome japonicum intermediate hosts within Oncomelania hupensis (Gastropoda: Rissooidea) from mainland China based on amplified fragment length polymorphisms. Fudan Univ. J. Med. Sci 2007, 34, 207–212. [Google Scholar]
- Li, S.Z.; Wang, Y.X.; Yang, K.; Liu, Q.; Wang, Q.; Zhang, Y.; Wu, X.H.; Guo, J.G.; Bergquist, R.; Zhou, X.N. Landscape genetics: The correlation of spatial and genetic distances of Oncomelania hupensis, the intermediate host snail of Schistosoma japonicum in mainland China. Geospat. Health 2009, 3, 221–231. [Google Scholar]
- Zhou, X.N.; Guo, J.G.; Wu, X.H.; Jiang, Q.W.; Zheng, J.; Dang, H.; Wang, X.H.; Xu, J.; Zhu, H.Q.; Wu, G.L.; et al. Epidemiology of schistosomiasis in the People’s Republic of China, 2004. Emerg. Infect. Dis 2007, 13, 1470–1476. [Google Scholar]
- Davis, G.M.; Zhang, Y.; Guo, Y.H. Systematic status of Oncomelania Hupensis (Gastropoda: Pomatiopsidae) throughout China. Stud. Mar. Sin 1997, 39, 89–95. [Google Scholar]
- Davis, G.M.; Wilke, T.; Zhang, Y.; Xu, X.J.; Qiu, C.P.; Spolsky, C.; Qiu, D.C.; Li, Y.; Xia, M.Y.; Feng, Z. Snail-Schistosoma, paragonimus interactions in China: Population ecology, genetic diversity, coevolution and emerging diseases. Malacologia 1999, 41, 355–377. [Google Scholar]
- Zhou, X.N.; Yang, G.J.; Yang, K.; Wang, X.H.; Hong, Q.B.; Sun, L.P.; Malone, J.B.; Kristensen, T.K.; Bergquist, N.R.; Utzinger, J. Potential impact of climate change on schistosomiasis transmission in China. Am. J. Trop. Med. Hyg 2008, 78, 188–194. [Google Scholar]
- Niu, A.O.; Xiong, Y.W. Studies on the genetic variation of Oncomelania hupensis with SSR-PCR. Chin. J. Parasitic. Dis. Control 2002, 15, 230–233. [Google Scholar]
- Guo, J.T.; Zhou, Y.B.; Wei, J.G. Sequencing on products of Oncomelania hupensis through simple sequence repeat achored polymerase chain reaction amplification. Chin. J. Epidemiol 2008, 29, 1119–1122. [Google Scholar]
- de Sousa, S.N.; Finkeldey, R.; Gailing, O. Experimental verification of microsatellite null alleles in Norway spruce (Picea abies L. Karst.): Implications for population genetic studies. Plant Mol. Biol. Rep 2005, 23, 113–119. [Google Scholar]
- Chapuis, M.P.; Estoup, A. Microsatellite null alleles and estimation of population differentiation. Mol. Biol. Evol 2007, 24, 621–631. [Google Scholar]
- Parayre, S.; Falentin, H.; Madec, M.N. Easy DNA extraction method and optimisation of PCR-temporal temperature gel electrophoresis to identify the predominant high and low GC-content bacteria from dairy products. J. Microbiol. Methods 2007, 69, 431–441. [Google Scholar]
- Chen, T.; Zhou, R.C.; Ge, X.J.; Shi, S.H. Development and characterization of microsatellite markers for a mangrove tree species Sonneratia caseolaris (L.) Engler (Lythraceae sensu lato). Conserv. Genet 2008, 9, 957–959. [Google Scholar]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Raymond, M.; Rousset, F. Genepop (version 1.2): Population genetics software for exact test and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. Micro-checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
| Locus | GenBank Accession No. | Primer Sequence (5′→3′) | Repeat Motif | Ta (°C) | Allele Size from Field Snails (bp) |
|---|---|---|---|---|---|
| P82 | GU204045 | Pf: AAGAACTGCTCATACTGGAAAG Pr: GTGGTGCCCCTACGACCT | (GGA)4(GAA)12 | 51 | 176–242 |
| T4-22 | GU204083 | Pf: TATCCAAGAAGCCGAAAC Pr: GAGGAAAGCGAGGTAAGA | (CA)10CC(CA)4 | 50 | 224–256 |
| T5-11 | GU204092 | Pf: ACGCCAGTCTTGGTGTCA Pr: TACTTGGGCAGAAGGGTT | (TG)14TA(TG)4 | 55 | 137–165 |
| D11 | GU204223 | Pf: AGCTTGGGATCAGAATGTCGTTTGT Pr: TATGTAGATGTTCACTGGTTTGTCC | (TG)17 | 55 | 172–192 |
| T6-27 | GU204213 | Pf: AATGACACCCCGAACAAA Pr: CACTTCTCAACTCCAACCT | (TG)6G(GT)6..(GT)12 | 55 | 178–210 |
| T6-17 | GU204108 | Pf: GGCCTGCCTTGGTTTTTTCACGTAG Pr: AGCTTGGGATCATCTCCAGGTC | (AC)8 | 55 | 230–248 |
| B14 | GU204050 | Pf: CAGTCACAGCGCAGCCTACGA Pr: TCAAGCGACCTGATGTCAAATACC | (AG)33 | 55 | 151–259 |
| T4-33 | GU204086 | Pf: GTCAAAACAACGAGGGCTGT Pr: CTGAGTGGAATGGGAGTTGG | (AC)19 | 60 | 135–173 |
| C22 | GU204145 | Pf: TGGGATCGGTACATCTGGATAGTGG Pr: GGGATCAATGAAAGTTCTTGCGTTC | (CA)21 | 62 | 210–263 |
| T6-47 | GU204215 | Pf: CCGAAGTGATAGAAACCG Pr: AGGCAGAAATGGGCAGAC | (TG)7...(GT)9 | 55 | 172–202 |
| T5-21 | GU204196 | Pf: ATAAGTTTAGCCAGTCACCC Pr: ACACGCAGTCCACGCACA | (GT)16GG(GT)4T T(GT)7TT(GT)4 | 55 | 155–185 |
| E3 | GU204069 | Pf: GATTTGTGAAAGTGAGGGTA Pr: TAGCAGGCGTCAAGGTAA | (CA)33 | 55 | 201–229 |
| E15 | GU204173 | Pf: AAAGAACCGAATCAGGAC Pr: TACCAGCCGATGAATAAA | (AC)22CC(AC)13 AT(AC)8 | 55 | 123–225 |
| C23 | GU204058 | Pf: CTGGACCTAAAGCAATAAC Pr: GAGCCAATCACCTAAACTA | (GT)14 | 55 | 144–188 |
| T4-36 | GU204088 | Pf: CGGGTTACGGGAAAGGAT Pr: AGGGACGAACTCACGAAG | (CA)17 | 55 | 192–250 |
| Population | Index | Microatellite Locus | Total | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| P82 | T4-22 | T5-11 | T6-27 | T6-17 | D11 | B14 | T4-33 | C22 | T6-47 | T5-21 | T4-36 | E3 | E15 | C23 | |||
| FJF | Na | 5 | 6 | 6 | 7 | 8 | 3 | 11 | 5 | 4 | 8 | 5 | 5 | 7 | 4 | 8 | 6.13 |
| HO | 0.563 | 0.733 | 1 | 0.563 | 0.75 | 0.75 | 0.813 | 0.882 | 0.722 | 0.611 * | 0.667 | 0.5 | 0.611 | 0.722 | 0.778 * | 0.727 | |
| HE | 0.752 | 0.779 | 0.845 | 0.802 | 0.821 | 0.605 | 0.895 | 0.791 | 0.751 | 0.889 | 0.765 | 0.818 | 0.737 | 0.751 | 0.8 | 0.711 | |
| SCH | Na | 9 | 4 | 10 | 5 | 10 | 5 | 12 | 5 | 6 | 9 | 4 | 10 | 4 | 6 | 4 | 6.87 |
| HO | 0.667 | 0.556 | 0.889 | 0.75 | 0.889 | 0.684 | 0.722 | 0.842 | 0.944 | 0.722 * | 0.563 | 0.611 * | 0.556 | 0.5 * | 0.444 | 0.689 | |
| HE | 0.833 | 0.684 | 0.886 | 0.792 | 0.864 | 0.721 | 0.914 | 0.794 | 0.795 | 0.886 | 0.77 | 0.883 | 0.706 | 0.802 | 0.751 | 0.805 | |
| GXY | Na | 8 | 8 | 6 | 6 | 1 | 10 | 3 | 5 | 7 | 7 | 1 | 7 | 4 | 3 | 5.13 | |
| HO | 0.526 | 0.737 | 1 | 0.632 | 0.895 | 0 | 0.737 | 1 * | 0.833 | 0.556 * | 0.5 * | 0 | 0.333 * | 0.444 | 0.4 | 0.506 | |
| HE | 0.743 | 0.741 | 0 | 0.828 | 0.657 | 0 | 0.862 | 0.539 | 0.697 | 0.846 | 0.822 | 0 | 0.718 | 0.614 | 0.481 | 0.57 | |
| AHX | Na | 8 | 0 | 6 | 11 | 9 | 4 | 8 | 8 | 8 | 9 | 8 | 6 | 4 | 9 | 8 | 7.06 |
| HO | 0.722 | 0.882 * | 0.526 | 0.778 | 0.684 | 0.526 | 0.889 | 0.684 | 0.684 | 0.737 * | 0.611 * | 0.474 | 0.444 | 0.579 | 0.5 * | 0.624 | |
| HE | 0.776 | 0.758 | 0.797 | 0.895 | 0.859 | 0.627 | 0.819 | 0.841 | 0.788 | 0.838 | 0.854 | 0.812 | 0.687 | 0.865 | 0.806 | 0.801 | |
| Total | Na | 18 | 13 | 13 | 23 | 19 | 6 | 29 | 13 | 16 | 16 | 15 | 18 | 10 | 14 | 14 | 15.80 |
| HO | 0.62 | 0.725 | 0.583 | 0.681 | 0.806 | 0.479 | 0.789 | 0.851 | 0.794 | 0.658 | 0.586 | 0.397 | 0.486 | 0.562 | 0.536 | 0.637 | |
| HE | 0.893 | 0.796 | 0.871 | 0.948 | 0.907 | 0.696 | 0.939 | 0.893 | 0.9 | 0.903 | 0.902 | 0.895 | 0.739 | 0.864 | 0.873 | 0.868 | |
NA, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity;
*Statistically significant deviation from Hardy–Weinberg equilibrium (P < 0.01).
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
MDPI and ACS Style
Zhang, L.; Li, S.; Wang, Q.; Qian, Y.; Liu, Q.; Yang, P.; Zhou, X. Isolation and Characterization of 15 New Microsatellite Markers in Oncomelania hupensis, the Snail Intermediate Host of Schistosoma japonicum in Mainland China. Int. J. Mol. Sci. 2012, 13, 5844-5850. https://doi.org/10.3390/ijms13055844
AMA Style
Zhang L, Li S, Wang Q, Qian Y, Liu Q, Yang P, Zhou X. Isolation and Characterization of 15 New Microsatellite Markers in Oncomelania hupensis, the Snail Intermediate Host of Schistosoma japonicum in Mainland China. International Journal of Molecular Sciences. 2012; 13(5):5844-5850. https://doi.org/10.3390/ijms13055844
Chicago/Turabian StyleZhang, Li, Shizhu Li, Qiang Wang, Yingjun Qian, Qin Liu, Pin Yang, and Xiaonong Zhou. 2012. "Isolation and Characterization of 15 New Microsatellite Markers in Oncomelania hupensis, the Snail Intermediate Host of Schistosoma japonicum in Mainland China" International Journal of Molecular Sciences 13, no. 5: 5844-5850. https://doi.org/10.3390/ijms13055844
