Hydrogen-Rich Water (HRW) Reduces Fatty Acid-Induced Lipid Accumulation and Oxidative Stress Damage through Activating AMP-Activated Protein Kinase in HepG2 Cells
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Antibodies
2.2. Generation of HRW and Determination of H2 Content and Oxidation–Reduction Potential (ORP)
2.3. Cell Culture and Viability Assay
2.4. Lipid Accumulation Assay
2.5. Cholesterol and Triglyceride Measurements
2.6. Nile Red Staining and High-Content Analysis
2.7. Reactive Oxygen Species (ROS) Measurement
2.8. Mitochondrial Membrane Potential Analysis
2.9. Lipid Peroxidation Measurement
2.10. Western Blot Analysis
2.11. mRNA Expression Analysis by Reverse-Transcription Quantitative PCR (qRT-PCR)
2.12. Statistical Analysis
3. Results
3.1. Attenuation of High-FFA-Induced Lipid Accumulation in HepG2 Cells by HRW
3.2. Reduction in LD Size by HRW in FFA-Induced HepG2 Cells
3.3. HRW Attenuates FFA-Induced Oxidative Stress and Reduces Lipid Peroxidation in HepG2 Cells
3.4. AMPK Is Essential for Protective Capabilities of HRW
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yanai, H.; Adachi, H.; Hakoshima, M.; Iida, S.; Katsuyama, H. Metabolic-Dysfunction-Associated Steatotic Liver Disease-Its Pathophysiology, Association with Atherosclerosis and Cardiovascular Disease, and Treatments. Int. J. Mol. Sci. 2023, 24, 5473. [Google Scholar] [CrossRef]
- Godoy-Matos, A.F.; Silva Júnior, W.S.; Valerio, C.M. NAFLD as a continuum: From obesity to metabolic syndrome and diabetes. Diabetol. Metab. Syndr. 2020, 12, 60. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Wu, L.; Zhu, X.; Bian, H.; Gao, X.; Xia, M. Advances in management of metabolic dysfunction-associated steatotic liver disease: From mechanisms to therapeutics. Lipids Health Dis. 2024, 23, 95. [Google Scholar] [CrossRef]
- Loomba, R.; Friedman, S.L.; Shulman, G.I. Mechanisms and disease consequences of nonalcoholic fatty liver disease. Cell 2021, 184, 2537–2564. [Google Scholar] [CrossRef]
- Carvalho-Gontijo, R.; Han, C.; Zhang, L.; Zhang, V.; Hosseini, M.; Mekeel, K.; Schnabl, B.; Loomba, R.; Karin, M.; Brenner, D.A.; et al. Metabolic Injury of Hepatocytes Promotes Progression of NAFLD and AALD. Semin. Liver Dis. 2022, 42, 233–249. [Google Scholar] [CrossRef] [PubMed]
- Scorletti, E.; Carr, R.M. A new perspective on NAFLD: Focusing on lipid droplets. J. Hepatol. 2022, 76, 934–945. [Google Scholar] [CrossRef] [PubMed]
- Hliwa, A.; Ramos-Molina, B.; Laski, D.; Mika, A.; Sledzinski, T. The Role of Fatty Acids in Non-Alcoholic Fatty Liver Disease Progression: An Update. Int. J. Mol. Sci. 2021, 22, 6900. [Google Scholar] [CrossRef] [PubMed]
- Rada, P.; González-Rodríguez, Á.; García-Monzón, C.; Valverde, Á.M. Understanding lipotoxicity in NAFLD pathogenesis: Is CD36 a key driver? Cell Death Dis. 2020, 11, 802. [Google Scholar] [CrossRef]
- Ma, Y.; Lee, G.; Heo, S.Y.; Roh, Y.S. Oxidative Stress Is a Key Modulator in the Development of Nonalcoholic Fatty Liver Disease. Antioxidants 2021, 11, 91. [Google Scholar] [CrossRef]
- Vesković, M.; Šutulović, N.; Hrnčić, D.; Stanojlović, O.; Macut, D.; Mladenović, D. The Interconnection between Hepatic Insulin Resistance and Metabolic Dysfunction-Associated Steatotic Liver Disease-The Transition from an Adipocentric to Liver-Centric Approach. Curr. Issues Mol. Biol. 2023, 45, 9084–9102. [Google Scholar] [CrossRef]
- Karkucinska-Wieckowska, A.; Simoes, I.C.M.; Kalinowski, P.; Lebiedzinska-Arciszewska, M.; Zieniewicz, K.; Milkiewicz, P.; Górska-Ponikowska, M.; Pinton, P.; Malik, A.N.; Krawczyk, M.; et al. Mitochondria, oxidative stress and nonalcoholic fatty liver disease: A complex relationship. Eur. J. Clin. Investig. 2022, 52, e13622. [Google Scholar] [CrossRef] [PubMed]
- Neuschwander-Tetri, B.A. Therapeutic Landscape for NAFLD in 2020. Gastroenterology 2020, 158, 1984–1998.e3. [Google Scholar] [CrossRef] [PubMed]
- Fang, H.; Ye, F.; Yang, R.; Huang, D.; Chen, X.; Wang, C.; Liao, W. Hydrogen gas: A new fresh keeping agent of perishable horticultural products. Food Chem. 2024, 451, 139476. [Google Scholar] [CrossRef] [PubMed]
- Ohno, K.; Ito, M.; Ichihara, M.; Ito, M. Molecular hydrogen as an emerging therapeutic medical gas for neurodegenerative and other diseases. Oxid. Med. Cell. Longev. 2012, 2012, 353152. [Google Scholar] [CrossRef] [PubMed]
- Li, S.W.; Takahara, T.; Que, W.; Fujino, M.; Guo, W.Z.; Hirano, S.I.; Ye, L.P.; Li, X.K. Hydrogen-rich water protects against liver injury in nonalcoholic steatohepatitis through HO-1 enhancement via IL-10 and Sirt 1 signaling. Am. J. Physiol. Gastrointest. Liver Physiol. 2021, 320, G450–G463. [Google Scholar] [CrossRef]
- Tao, G.; Zhang, G.; Chen, W.; Yang, C.; Xue, Y.; Song, G.; Qin, S. A randomized, placebo-controlled clinical trial of hydrogen/oxygen inhalation for non-alcoholic fatty liver disease. J. Cell. Mol. Med. 2022, 26, 4113–4123. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, T.T.P.; Nguyen, P.L.; Park, S.H.; Jung, C.H.; Jeon, T.I. Hydrogen Sulfide and Liver Health: Insights into Liver Diseases. Antioxid. Redox Signal. 2024, 40, 122–144. [Google Scholar] [CrossRef]
- Yin, Z.; Xu, W.; Ling, J.; Ma, L.; Zhang, H.; Wang, P. Hydrogen-rich solution alleviates acute radiation pneumonitis by regulating oxidative stress and macrophages polarization. J. Radiat. Res. 2024, 65, 291–302. [Google Scholar] [CrossRef]
- Lin, C.L.; Huang, W.N.; Li, H.H.; Huang, C.N.; Hsieh, S.; Lai, C.; Lu, F.J. Hydrogen-rich water attenuates amyloid beta-induced cytotoxicity through upregulation of Sirt1-FoxO3a by stimulation of AMP-activated protein kinase in SK-N-MC cells. Chem. Biol. Interact. 2015, 240, 12–21. [Google Scholar] [CrossRef]
- Kornelius, E.; Tsou, S.H.; Chang, C.C.; Ho, Y.J.; Lin, S.C.; Chen, W.L.; Huang, C.N.; Lin, C.L. Liraglutide Attenuates Glucolipotoxicity-Induced RSC96 Schwann Cells’ Inflammation and Dysfunction. Biomolecules 2022, 12, 1338. [Google Scholar] [CrossRef]
- Lee, J.; Homma, T.; Kurahashi, T.; Kang, E.S.; Fujii, J. Oxidative stress triggers lipid droplet accumulation in primary cultured hepatocytes by activating fatty acid synthesis. Biochem. Biophys. Res. Commun. 2015, 464, 229–235. [Google Scholar] [CrossRef] [PubMed]
- Mashek, D.G. Hepatic lipid droplets: A balancing act between energy storage and metabolic dysfunction in NAFLD. Mol. Metab. 2021, 50, 101115. [Google Scholar] [CrossRef] [PubMed]
- Liang, Z.; Li, T.; Jiang, S.; Xu, J.; Di, W.; Yang, Z.; Hu, W.; Yang, Y. AMPK: A novel target for treating hepatic fibrosis. Oncotarget 2017, 8, 62780–62792. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.; Duncan, B.; Kuang, X. Hydrogen treatment: A novel option in liver diseases. Clin. Med. 2021, 21, e223–e227. [Google Scholar] [CrossRef]
- Johnsen, H.M.; Hiorth, M.; Klaveness, J. Molecular Hydrogen Therapy-A Review on Clinical Studies and Outcomes. Molecules 2023, 28, 7785. [Google Scholar] [CrossRef] [PubMed]
- Xie, F.; Song, Y.; Yi, Y.; Jiang, X.; Ma, S.; Ma, C.; Li, J.; Zhanghuang, Z.; Liu, M.; Zhao, P.; et al. Therapeutic Potential of Molecular Hydrogen in Metabolic Diseases from Bench to Bedside. Pharmaceuticals 2023, 16, 541. [Google Scholar] [CrossRef] [PubMed]
- Sumbalová, Z.; Kucharská, J.; Rausová, Z.; Gvozdjáková, A.; Szántová, M.; Kura, B.; Mojto, V.; Slezák, J. The Effect of Adjuvant Therapy with Molecular Hydrogen on Endogenous Coenzyme Q(10) Levels and Platelet Mitochondrial Bioenergetics in Patients with Non-Alcoholic Fatty Liver Disease. Int. J. Mol. Sci. 2023, 24, 2477. [Google Scholar] [CrossRef]
- Ruan, G.; Wu, F.; Shi, D.; Sun, H.; Wang, F.; Xu, C. Metformin: Update on mechanisms of action on liver diseases. Front. Nutr. 2023, 10, 1327814. [Google Scholar] [CrossRef] [PubMed]
- Filali-Mouncef, Y.; Hunter, C.; Roccio, F.; Zagkou, S.; Dupont, N.; Primard, C.; Proikas-Cezanne, T.; Reggiori, F. The ménage à trois of autophagy, lipid droplets and liver disease. Autophagy 2022, 18, 50–72. [Google Scholar] [CrossRef]
- Lee, H.I.; Yun, K.W.; Seo, K.I.; Kim, M.J.; Lee, M.K. Scopoletin prevents alcohol-induced hepatic lipid accumulation by modulating the AMPK-SREBP pathway in diet-induced obese mice. Metabolism 2014, 63, 593–601. [Google Scholar] [CrossRef]
- Zhang, J.; Xu, D.; Nie, J.; Han, R.; Zhai, Y.; Shi, Y. Comparative gene identification-58 (CGI-58) promotes autophagy as a putative lysophosphatidylglycerol acyltransferase. J. Biol. Chem. 2014, 289, 33044–33053. [Google Scholar] [CrossRef] [PubMed]
- Nakao, A.; Toyoda, Y.; Sharma, P.; Evans, M.; Guthrie, N. Effectiveness of hydrogen rich water on antioxidant status of subjects with potential metabolic syndrome-an open label pilot study. J. Clin. Biochem. Nutr. 2010, 46, 140–149. [Google Scholar] [CrossRef] [PubMed]
- Kamimura, N.; Nishimaki, K.; Ohsawa, I.; Ohta, S. Molecular hydrogen improves obesity and diabetes by inducing hepatic FGF21 and stimulating energy metabolism in db/db mice. Obesity 2011, 19, 1396–1403. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.; Zhao, K.; Ju, Y.; Mani, S.; Cao, Q.; Puukila, S.; Khaper, N.; Wu, L.; Wang, R. Hydrogen sulfide protects against cellular senescence via S-sulfhydration of Keap1 and activation of Nrf2. Antioxid. Redox Signal. 2013, 18, 1906–1919. [Google Scholar] [CrossRef] [PubMed]
- Ngo, V.; Duennwald, M.L. Nrf2 and Oxidative Stress: A General Overview of Mechanisms and Implications in Human Disease. Antioxidants 2022, 11, 2345. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Xie, F.; Ma, S.; Ma, C.; Jiang, X.; Yi, Y.; Song, Y.; Liu, M.; Zhao, P.; Ma, X. Mitochondria: One of the vital hubs for molecular hydrogen’s biological functions. Front. Cell Dev. Biol. 2023, 11, 1283820. [Google Scholar] [CrossRef]
Genes | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
αSMA | TGCTCCAGCTATGTGTGAAGA | AGGTCGGATGCTCCTCTG |
Collagen I | TGAGCCAGCAGATTGAGAACA | GGGTCGATCCAGTACTCTCCG |
IL-1β | CACCTCTCAAGCAGAGCACAG | GGGTTCCATGGTGAAGTCAAC |
IL-6 | TCTGGAGTTCCGTTTCTACCTGG | CATAGCACACTAGGTTTGCCGAG |
TNFα | AAATGGGCTCCCTCTCATCAGTTC | TCTGCTTGGTGGTTT GCTACGAC |
GAPDH | TGGTATCGTGGAAGGACTCATGAC | ATGCCAGTGAGCTTCCCGTTCAGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tsou, S.-H.; Lin, S.-C.; Chen, W.-J.; Hung, H.-C.; Liao, C.-C.; Kornelius, E.; Huang, C.-N.; Lin, C.-L.; Yang, Y.-S. Hydrogen-Rich Water (HRW) Reduces Fatty Acid-Induced Lipid Accumulation and Oxidative Stress Damage through Activating AMP-Activated Protein Kinase in HepG2 Cells. Biomedicines 2024, 12, 1444. https://doi.org/10.3390/biomedicines12071444
Tsou S-H, Lin S-C, Chen W-J, Hung H-C, Liao C-C, Kornelius E, Huang C-N, Lin C-L, Yang Y-S. Hydrogen-Rich Water (HRW) Reduces Fatty Acid-Induced Lipid Accumulation and Oxidative Stress Damage through Activating AMP-Activated Protein Kinase in HepG2 Cells. Biomedicines. 2024; 12(7):1444. https://doi.org/10.3390/biomedicines12071444
Chicago/Turabian StyleTsou, Sing-Hua, Sheng-Chieh Lin, Wei-Jen Chen, Hui-Chih Hung, Chun-Cheng Liao, Edy Kornelius, Chien-Ning Huang, Chih-Li Lin, and Yi-Sun Yang. 2024. "Hydrogen-Rich Water (HRW) Reduces Fatty Acid-Induced Lipid Accumulation and Oxidative Stress Damage through Activating AMP-Activated Protein Kinase in HepG2 Cells" Biomedicines 12, no. 7: 1444. https://doi.org/10.3390/biomedicines12071444