Figure 1.
Capillary electrophoresis IGS2-314 ribosomal DNA (rDNA) patterns for the investigated yeast strains Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; lower and upper internal marker are shown in green and purple.
Figure 1.
Capillary electrophoresis IGS2-314 ribosomal DNA (rDNA) patterns for the investigated yeast strains Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; lower and upper internal marker are shown in green and purple.
Figure 2.
Average of metabolized and free amino nitrogen (FAN) content in finished beers produced with the yeast strains Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
Figure 2.
Average of metabolized and free amino nitrogen (FAN) content in finished beers produced with the yeast strains Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
Figure 3.
Average of metabolized and total amino acid (AS) content in finished beers produced with yeast strains Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
Figure 3.
Average of metabolized and total amino acid (AS) content in finished beers produced with yeast strains Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
Figure 4.
Drop in specific gravity measured in a single reference vessel compared with the average in final gravity (marked with box) measured in triplicate in final beers for the tested yeast strains Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
Figure 4.
Drop in specific gravity measured in a single reference vessel compared with the average in final gravity (marked with box) measured in triplicate in final beers for the tested yeast strains Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
Figure 5.
Yeast cells in suspension during the main fermentation and maturing phase. The circle marks the specific final gravity (FG) of the investigated yeast strains Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®.
Figure 5.
Yeast cells in suspension during the main fermentation and maturing phase. The circle marks the specific final gravity (FG) of the investigated yeast strains Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®.
Figure 6.
Phenolic off-flavor ability of the investigated yeast strains; confidence level 95%.
Figure 6.
Phenolic off-flavor ability of the investigated yeast strains; confidence level 95%.
Figure 7.
Comparison of the flavors grouped according to the main categories and the respective main aroma attributes for the bottom-fermenting Saccharomyces pastorianus yeast strains Frisinga-TUM 34/70® and Securitas-TUM 193®.
Figure 7.
Comparison of the flavors grouped according to the main categories and the respective main aroma attributes for the bottom-fermenting Saccharomyces pastorianus yeast strains Frisinga-TUM 34/70® and Securitas-TUM 193®.
Figure 8.
Comparison of the flavors grouped according to the main categories and the respective main aroma attributes for the top-fermenting Saccharomyces cerevisiae yeast strains LeoBavaricus-TUM 68® and LunaBavaria-TUM 127®.
Figure 8.
Comparison of the flavors grouped according to the main categories and the respective main aroma attributes for the top-fermenting Saccharomyces cerevisiae yeast strains LeoBavaricus-TUM 68® and LunaBavaria-TUM 127®.
Figure 9.
Comparison of the flavors grouped according to the main categories and the respective main aroma attributes for top-fermenting Saccharomyces cerevisiae yeast strains Colonia-TUM 177® and Vetus-TUM 184®.
Figure 9.
Comparison of the flavors grouped according to the main categories and the respective main aroma attributes for top-fermenting Saccharomyces cerevisiae yeast strains Colonia-TUM 177® and Vetus-TUM 184®.
Figure 10.
Comparison of the flavors grouped according to the main categories and the respective main aroma attributes for top-fermenting Saccharomyces cerevisiae yeast strains Mel-TUM 211® and Monacus-TUM 381®.
Figure 10.
Comparison of the flavors grouped according to the main categories and the respective main aroma attributes for top-fermenting Saccharomyces cerevisiae yeast strains Mel-TUM 211® and Monacus-TUM 381®.
Figure 11.
Comparison of the flavors grouped according to the main categories and the respective main aroma attributes for top-fermenting Saccharomyces cerevisiae yeast strains Tropicus-TUM 506® and Harmonia-TUM 511®.
Figure 11.
Comparison of the flavors grouped according to the main categories and the respective main aroma attributes for top-fermenting Saccharomyces cerevisiae yeast strains Tropicus-TUM 506® and Harmonia-TUM 511®.
Table 1.
Technical University of Munich (TUM) culture yeast strains for industrial brewing.
Table 1.
Technical University of Munich (TUM) culture yeast strains for industrial brewing.
TUM Yeast Strains |
---|
TUM Yeast Strain | Yeast Species | Industrial Application | Origin |
---|
Frisinga-TUM 34/70® | Saccharomyces pastorianus | lager beer production | Freising-Weihenstephan, Germany |
Securitas-TUM 193® | Saccharomyces pastorianus | lager beer production | Freising-Weihenstephan, Germany |
LeoBavaricus-TUM 68® | Saccharomyces cerevisiae | wheat beer production | Freising-Weihenstephan, Germany |
LunaBavara-TUM 127® | Saccharomyces cerevisiae | wheat beer production | Freising-Weihenstephan, Germany |
Colonia-TUM 177® | Saccharomyces cerevisiae | kölsch beer production | Krefeld, Germany |
Vetus-TUM 184® | Saccharomyces cerevisiae | alt beer production | Dusseldorf, Germany |
Mel-TUM 211® | Saccharomyces cerevisiae | ale and stout beer production | region unknown, Great Britain |
Monacus-TUM 381® | Saccharomyces cerevisiae | trappist beer production | region unknown, Germany |
Tropicus-TUM 506® | Saccharomyces cerevisiae | ale beer production | region unknown, Great Britain |
Harmonia-TUM 511® | Saccharomyces cerevisiae | ale beer production | region unknown, United States of America |
Table 2.
Qualitative real-time PCR systems for brewing yeast species differentiation [
30,
31].
Table 2.
Qualitative real-time PCR systems for brewing yeast species differentiation [
30,
31].
Real-Time PCR Systems, Primer and Probe Sequences (5´–3´) | System Name | Reference | S. cer. | S. cer. var. dia. | S. past. |
---|
Sbp-f CTTGCTATTCCAAACAGTGAGACT | Sbp | [32,33] | − | − | + |
Sbp-r1 TTGTTACCTCTGGGCGTCGA |
Sbp-r2 GTTTGTTACCTCTGGGCTCG |
Sbp ACTTTTGCAACTTTTTCTTTGGGTTTCGAGCA |
Sc-f CAAACGGTGAGAGATTTCTGTGC | Sce | [32,33] | + | + | + |
Sc-r GATAAAATTGTTTGTGTTTGTTACCTCTG |
Scer FAM-ACACTGTGGAATTTTCATATCTTTGCAACTT-BHQ1 |
Sc-GRC-f CACATCACTACGAGATGCATATGCA | Sc-GRC3 | [30] | + | + | + |
Sc-GRC-r GCCAGTATTTTGAATGTTCTCAGTTG |
Sc-GRC FAM-TCCAGCCCATAGTCTGAACCACACCTTATCT-BHQ1 |
TF-f TTCGTTGTAACAGCTGCTGATGT | TF-COXII | [30] | + | + | − |
TF-r ACCAGGAGTAGCATCAACTTTAATACC |
TF-MGB FAM-ATGATTTTGCTATCCCAAGTT-BHQ1 (MGB probe) |
BF300E CTCCTTGGCTTGTCGAA | BF-300 | [32] | − | − | + |
BF300M GGTTGTTGCTGAAGTTGAGA |
BF300 FAM-TGCTCCACATTTGATCAGCGCCA-BHQ1 |
BF-LRE-f ACTCGACATTCAACTACAAGAGTAAAATTT | BF-LRE1 | [30] | − | − | + |
BF-LRE-r TCTCCGGCATATCCTTCATCA |
BF-LRE FAM-ATCTCTACCGTTTTCGGTCACCGGC-BHQ1 |
Sd-f TTCCAACTGCACTAGTTCCTAGAGG | Sdia | [32] | − | + | − |
Sd-r GAGCTGAATGGAGTTGAAGATGG |
Sdia FAM-CCTCCTCTAGCAACATCACTTCCTCCG-BHQ1 |
Table 3.
Primer, probe and target DNA sequences of the internal amplification control system (IAC135) used for real-time PCR systems.
Table 3.
Primer, probe and target DNA sequences of the internal amplification control system (IAC135) used for real-time PCR systems.
Real-Time PCR Internal Amplification Control (IAC135) |
---|
System Name | Primer | Primer Sequence (5′–3′) |
---|
IAC135 | IAC135-f | TGGATAGATTCGATGACCCTAGAAC |
IAC135-r | TGAGTCCATTTTCGCAGATAACTT |
Probe | Probe Sequence (5′–3′) |
IAC135-S | HEX-TGGGAGGATGCATTAGGAGCATTGTAAGAGAG-BHQ1 |
Target DNA | DNA Sequence (5′–3′) |
IAC135 | TGCTAGAGAATGGATAGATTCGATGACCCTAGAACTAGTGGGAGGATGCATTAGGAGCATTGTAAGAGAGTCGGAAGTTATCTGCGAAAATGGACTCATTCGAGTGGCCTATTGACGGTCGCCCAAGGTGTCGCA |
IAC135-rev | TGCGACACCTTGGGCGACCGTCAATAGGCCACTCGAATGAGTCCATTTTCGCAGATAACTTCCGACTCTCTTACAATGCTCCTAATGCATCCTCCCACTAGTTCTAGGGTCATCGAATCTATCCATTCTCTAGCA |
Table 4.
Starting wort composition used for propagation and brewing trials (12.4 °P wort).
Table 4.
Starting wort composition used for propagation and brewing trials (12.4 °P wort).
Wort composition |
---|
Parameter | Amount |
---|
Original gravity (°P) | 12.40 |
pH | 5.19 |
Spec. weight SL 20/20 °C | 1.05 |
Zinc (mg/L) | 0.15 |
Free amino nitrogen (FAN) (mg/100 mL) | 25.00 |
Total amino acid content (AS) (mg/100 mL) | 203.22 |
Total sugar (g/L) | 83.78 |
EBC-Bittering units | 20.20 |
Glucose (g/L) | 11.46 |
Fructose (g/L) | 2.57 |
Saccharose (g/L) | 1.12 |
Maltose (g/L) | 53.65 |
Maltotriose (g/L) | 14.98 |
Table 5.
Qualitative results of the real-time PCR systems used for the investigated yeast strains and the reference strains to differentiate Saccharomyces sensu stricto species.
Table 5.
Qualitative results of the real-time PCR systems used for the investigated yeast strains and the reference strains to differentiate Saccharomyces sensu stricto species.
RT-PCR-System |
---|
Species Confirmation | TUM Yeast Strain | Sc-GRC3 | Sce | TF-COXII | Sbp | BF-LRE1 | BF-300 | Sdia |
---|
S. pastorianus (S. cerevisiae hybrid strain) | Frisinga-TUM 34/70® | + | + | − | + | + | + | − |
Securitas-TUM 193® | + | + | − | + | + | + | − |
S. cerevisiae | LeoBavaricus-TUM 68® | + | + | + | − | − | − | − |
LunaBavaricus-TUM 127® | + | + | + | − | − | − | − |
Colonia-TUM 177® | + | + | + | − | − | − | − |
Vetus-TUM 184® | + | + | + | − | − | − | − |
Mel-TUM 211® | + | + | + | − | − | − | − |
Monacus-TUM 381® | + | + | + | − | − | − | − |
Tropicus-TUM 506® | + | + | + | − | − | − | − |
Harmonia-TUM 511® | + | + | + | − | − | − | − |
Table 6.
Mean percentage of total wort sugar utilization in beer, measured in triplicate after lagering; confidence level 95%.
Table 6.
Mean percentage of total wort sugar utilization in beer, measured in triplicate after lagering; confidence level 95%.
TUM Yeast Strain | Glucose | Fructose | Sucrose | Maltose | Maltotriose |
---|
Frisinga-TUM 34/70® | 98.61 ± 0.00 | 96.15 ± 0.00 | 100.00 ± 0.00 | 99.02 ± 0.12 | 94.06 ± 0.91 |
Securitas-TUM 193® | 98.70 ± 0.14 | 96.15 ± 0.00 | 100.00 ± 0.00 | 96.89 ± 0.12 | 86.60 ± 0.52 |
LeoBavaricus-TUM 68® | 100.00 ± 0.00 | 100.00 ± 0.00 | 100.00 ± 0.00 | 99.92 ± 0.02 | 99.65 ± 0.28 |
LunaBavaria-TUM 127® | 100.00 ± 0.00 | 100.00 ± 0.00 | 100.00 ± 0.00 | 99.07 ± 0.10 | 01.05 ± 2.89 |
Colonia-TUM 177® | 100.00 ± 0.00 | 100.00 ± 0.00 | 100.00 ± 0.00 | 99.85 ± 0.02 | 94.80 ± 0.78 |
Vetus-TUM 184® | 100.00 ± 0.00 | 100.00 ± 0.00 | 100.00 ± 0.00 | 98.00 ± 0.53 | 60.92 ± 5.87 |
Mel-TUM 211® | 98.55 ± 0.47 | 98.57 ± 0.21 | 98.51 ± 0.48 | 87.23 ± 0.82 | 26.66 ± 0.26 |
Monacus-TUM 381® | 100.00 ± 0.00 | 100.00 ± 0.00 | 100.00 ± 0.00 | 99.65 ± 0.14 | 97.75 ± 0.09 |
Tropicus-TUM 506® | 98.23 ± 0.12 | 98.05 ± 0.36 | 99.11 ± 0.00 | 98.48 ± 0.93 | 59.28 ± 0.81 |
Harmonia-TUM 511® | 99.42 ± 0.12 | 98.05 ± 0.00 | 95.54 ± 0.00 | 99.28 ± 0.09 | 83.91 ± 0.71 |
Table 7.
Apparent attenuation (AA%) of the final beer compared with specific time for primary fermentation for the investigated yeast strains Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
Table 7.
Apparent attenuation (AA%) of the final beer compared with specific time for primary fermentation for the investigated yeast strains Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
Apparent attenuation (AA %) of the final beer |
---|
TUM Yeast Strain | AA (%) | Fermentation time (hours) |
---|
Frisinga-TUM 34/70® | 81.63 ± 0.51 | 216 |
Securitas-TUM 193® | 79.30 ± 0.51 | 216 |
LeoBavaricus-TUM 68® | 86.17 ± 0.05 | 96 |
LunaBavaria-TUM 127® | 76.20 ± 1.76 | 144 |
Colonia-TUM 177® | 84.93 ± 0.37 | 96 |
Vetus-TUM 184® | 80.97 ± 3.02 | 264 |
Mel-TUM 211® | 66.13 ± 0.51 | 240 |
Monacus-TUM 381® | 86.17 ± 0.11 | 168 |
Tropicus-TUM 506® | 77.37 ± 1.34 | 216 |
Harmonia-TUM 511® | 82.70 ± 0.42 | 144 |
Table 8.
Difference in maximum yeast cell concentration during primary fermentation and yeast cell concentration by reaching the specific final gravity (FG) and the flocculation behavior of Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®.
Table 8.
Difference in maximum yeast cell concentration during primary fermentation and yeast cell concentration by reaching the specific final gravity (FG) and the flocculation behavior of Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®.
Yeast Cell Sedimentation at the end of Primary Fermentation |
---|
TUM Yeast Strain | Max. Cell Conc. | Cell Conc. FG | Difference | Flocculation Behavior |
---|
Frisinga-TUM 34/70® | 35.90 | 1.80 | −34.10 | flocculent |
Securitas-TUM 193® | 48.80 | 1.30 | −47.50 | flocculent |
LeoBavaricus-TUM 68® | 62.81 | 32.29 | −30.52 | powdery |
LunaBavara-TUM 127® | 39.38 | 7.50 | −31.88 | flocculent |
Colonia-TUM 177® | 23.00 | 17.20 | −5.8 | powdery |
Vetus-TUM 184® | 17.83 | 0.50 | −17.33 | flocculent |
Mel-TUM 211® | 34.30 | 17.80 | −16.50 | powdery |
Monacus-TUM 381® | 57.65 | 18.12 | −39.53 | powdery |
Tropicus-TUM 506® | 36.45 | 19.36 | −17.09 | powdery |
Harmonia-TUM 511® | 61.30 | 43.07 | −18.23 | powdery |
Table 9.
Change in pH value during primary fermentation, after the maturation and lagering phase, rounded to two decimal figures, for Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
Table 9.
Change in pH value during primary fermentation, after the maturation and lagering phase, rounded to two decimal figures, for Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
pH Value Decrease during Primary Fermentation |
---|
TUM Yeast Strain | 0 h | 24 h | 48 h | 72 h | 96 h | After primary fermentation | After maturation | Final beer (after lagering) | ∆pH |
Frisinga-TUM 34/70® | 5.2 | 4.6 | 4.5 | 4.5 | 4.5 | 4.5 | 4.5 | 4.4 ± 0.04 | 0.8 |
Securitas-TUM 193® | 5.2 | 4.6 | 4.5 | 4.5 | 4.5 | 4.5 | 4.5 | 4.5 ± 0.01 | 0.7 |
LeoBavaricus-TUM 68® | 5.2 | 4.8 | 4.3 | 4.3 | 4.2 | 4.2 | 4.2 | 4.4 ± 0.01 | 0.8 |
LunaBavaria-TUM 127® | 5.2 | 4.6 | 4.5 | 4.5 | 4.4 | 4.4 | 4.4 | 4.6 ± 0.01 | 0.6 |
Colonia-TUM 177® | 5.2 | 5 | 4.8 | 4.8 | 4.7 | 4.7 | 4.7 | 4.6 ± 0.02 | 0.6 |
Vetus-TUM 184® | 5.2 | 4.7 | 4.6 | 4.6 | 4.5 | 4.5 | 4.6 | 4.5 ± 0.04 | 0.7 |
Mel-TUM 211® | 5.2 | 4.5 | 4.4 | 4.4 | 4.4 | 4.4 | 4.5 | 4.7 ± 0.01 | 0.5 |
Monacus-TUM 381® | 5.2 | 4.6 | 4.5 | 4.5 | 4.5 | 4.5 | 4.5 | 4.5 ± 0.01 | 0.7 |
Tropicus-TUM 506® | 5.2 | 4.6 | 4.5 | 4.5 | 4.5 | 4.5 | 4.6 | 4.7 ± 0.01 | 0.5 |
Harmonia-TUM 511® | 5.2 | 4.6 | 4.4 | 4.4 | 4.4 | 4.4 | 4.4 | 4.4 ± 0.01 | 0.8 |
Table 10.
Phenolic off-flavor (POF) test results for the investigated yeast strains.
Table 10.
Phenolic off-flavor (POF) test results for the investigated yeast strains.
POF-Test/Sniffing Perception of: |
---|
TUM Yeast Strain | 4-Vinylguajacol/ Ferulic Acid | 4-Vinylphenol/ Coumaric Acid | 4-Vinylstyrene/ Cinnamic Acid |
---|
Frisinga - TUM 3470® | − | − | − |
Securitas-TUM 193® | − | − | − |
LeoBavaricus-TUM 68® | + | + | + |
LunaBavaria-TUM 127® | + | + | + |
Colonia-TUM 177® | − | − | − |
Vetus-TUM 184® | − | − | − |
Mel-TUM 211® | − | − | − |
Monacus-TUM 381® | + | + | + |
Tropicus-TUM 506® | − | − | − |
Harmonia-TUM 511® | + | + | + |
Table 11.
Average of important fermentation by-products (FBP) measured in triplicate of the final beers produced with Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127® and Colonia-TUM 177®; confidence level 95%.
Table 11.
Average of important fermentation by-products (FBP) measured in triplicate of the final beers produced with Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127® and Colonia-TUM 177®; confidence level 95%.
Fermentation by-Products (mg/L) |
---|
FBP | Frisinga-TUM 3470® | Securitas-TUM 193® | LeoBavaricus-TUM 68® | LunaBavaria-TUM 127® | Colonia-TUM 177® |
---|
Isoamyl acetate | 0.63 ± 0.19 | 1.38 ± 0.05 | 4.07 ± 0.46 | 3.97 ± 2.30 | 2.40 ± 0.16 |
Ethyl acetate | 19.77 ± 2.50 | 26.07 ± 1.89 | 32.50 ± 2.97 | 36.97 ± 2.93 | 32.87 ± 1.68 |
∑ Ester (E) | 20.40 ± 2.69 | 27.90 ± 1.94 | 36.57 ± .3.43 | 40.93 ± 3.16 | 35.27 ± 1.83 |
n-Propanol | 11.23 ± 0.77 | 13.43 ± 0.72 | 22.77 ± 2.37 | 15.93 ± 0.70 | 21.30 ± 1.25 |
i-Butanol | 10.63 ± 0.71 | 14.27 ± 0.47 | 62.30 ± 3.51 | 43.70 ± 3.42 | 10.53 ± 0.11 |
Amyl alcohols | 60.53 ± 3.31 | 82.60 ± 2.68 | 127.00 ± 7.33 | 91.60 ± 3.34 | 80.77 ± 1.06 |
∑ Higher alcohols (HE) | 82.40 ± 4.76 | 110.30 ± 3.86 | 212.07 ± 13.15 | 151.23 ± 6.25 | 112.60 ± 2.32 |
4-Vinylguajacol | 0.10 ± 0.00 | 0.10 ± 0.00 | 3.10 ± 0.40 | 1.23 ± 0.30 | 0.10 ± 0.00 |
Diacetyl | 0.18 ± 0.07 | 0.10 ± 0 01 | 0.11 ± 0.01 | 0.17 ± 0.03 | 0.14 ± 0 03 |
2,3-Pentandione | 0.00 ± 0.01 | 0.03 ± 0.00 | 0.01 ± 0.00 | 0.02 ± 0.00 | 0.01 ± 0.01 |
∑ Vicinal diketones | 0.18 ± 0.07 | 0.12 ± 0.02 | 0.12 ± 0.01 | 0.19 ± 0.03 | 0.15 ± 0.04 |
Acetaldehyde | 1.33 ± 0.47 | 11.17 ± 1.46 | 7.27 ± 1.80 | 2.80 ± 0.94 | 8.23 ± 2.02 |
Ratio (∑E:∑HE) | 4.04 | 3.95 | 5.80 | 3.69 | 3.19 |
Table 12.
Average of important fermentation by-products (FBP) measured in triplicate of the final beers produced with Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
Table 12.
Average of important fermentation by-products (FBP) measured in triplicate of the final beers produced with Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
Fermentation by-Products (mg/L) |
---|
FBP | Vetus- TUM 184® | Mel- TUM 211® | Monacus- TUM 381® | Tropicus- TUM 506® | Harmonia- TUM 511® |
---|
Isoamyl acetate | 1.80 ± 0.09 | 2.03 ± 0.05 | 4.33 ± 0.05 | 1.53 ± 0.11 | 2.93 ± 0.05 |
Ethyl acetate | 37.40 ± 0.58 | 37.93 ± 0.11 | 50.60 ± 0.85 | 22.57 ± 1.31 | 54.40 ± 0.61 |
∑ Ester (E) | 39.20 ± 0.61 | 39.97 ± 0.14 | 54.93 ± 0.84 | 24.10 ± 1.36 | 57.33 ± 0.65 |
n-Propanol | 15.40 ± 0.46 | 18.30 ± 0.16 | 18.30 ± 0.16 | 20.67 ± 1.01 | 20.77 ± 0.53 |
i-Butanol | 11.37 ± 0.14 | 16.20 ± 0.37 | 24.17 ± 0.66 | 20.90 ± 1.40 | 13.13 ± 0.28 |
Amyl alcohols | 67.37 ± 0.91 | 59.27 ± 1.32 | 101.00 ± 4.23 | 88.50 ± 5.90 | 74.97 ± 1.24 |
∑ Higher alcohols (HE) | 94.13 ± 1.43 | 93.77 ± 1.83 | 142.23 ± 5.26 | 130.07 ± 8.12 | 108.87 ± 1.23 |
4-Vinylguajacol | 0.10 ± 0.00 | 0.10 ± 0.00 | 3.27 ± 0.05 | 0.10 ± 0.00 | 3.33 ± 0.05 |
Diacetyl | 0.06 ± 0.01 | 0.10 ± 0.01 | 0.07 ± 0.01 | 0.12 ± 0.01 | 0.06 ± 0.00 |
2,3-Pentandione | 0.01 ± 0.00 | 0.02 ± 0.00 | 0.01 ± 0.00 | 0.02 ± 0.00 | 0.01 ± 0.00 |
∑ Vicinal diketones | 0.06 ± 0.01 | 0.12 ± 0.01 | 0.08 ± 0.01 | 0.14 ± 0.01 | 0.07 ± 0.00 |
Acetaldehyde | 6.80 ± 0.80 | 4.60 ± 0.48 | 6.23 ± 0.77 | 5.93 ± 0.93 | 4.03 ± 0.46 |
Ratio (∑E:∑HE) | 2.40 | 2.35 | 2.59 | 5.40 | 1.90 |
Table 13.
SO2 concentration of the final beers produced using Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
Table 13.
SO2 concentration of the final beers produced using Frisinga-TUM 34/70®, Securitas-TUM 193®, LeoBavaricus-TUM 68®, LunaBavaria-TUM 127®, Colonia-TUM 177®, Vetus-TUM 184®, Mel-TUM 211®, Monacus-TUM 381®, Tropicus-TUM 506® and Harmonia-TUM 511®; confidence level 95%.
SO2 Concentration of the Finished Beers |
---|
TUM Yeast Strain | SO2 (mg/L) |
---|
Frisinga-TUM 34/70® | 6.03 ± 0.30 |
Securitas-TUM 193® | 9.47 ± 0.68 |
LeoBavaricus-TUM 68® | 2.87 ± 0.30 |
LunaBavaria-TUM 127® | 1.63 ± 0.51 |
Colonia-TUM 177® | 3.80 ± 0.79 |
Vetus-TUM 184® | 3.10 ± 0.16 |
Mel-TUM 211® | 2.60 ± 0.98 |
Monacus-TUM 381® | 0.50 ± 0.00 |
Tropicus-TUM 506® | 2.23 ± 1.02 |
Harmonia-TUM 511® | 0.50 ± 0.00 |
Table 14.
Comparison of the investigated 10 TUM yeast strains with the focus on recommended beer style, POF, flocculation behavior, maltotriose utilization, pH drop, SO2, apparent attenuation and time to reach the final gravity (red=weak, yellow=normal, green=strong).
Table 14.
Comparison of the investigated 10 TUM yeast strains with the focus on recommended beer style, POF, flocculation behavior, maltotriose utilization, pH drop, SO2, apparent attenuation and time to reach the final gravity (red=weak, yellow=normal, green=strong).
TUM Yeast Strains |
---|
TUM Yeast Strain | Yeast Species | Recommended Main Beer Style | Phenolic Off-Flavor | Flocculation Behavior | Maltotriose-Utilization (%) | ∆pH | SO2(mg/L) | AA(%) | Fermentation Time (days) |
---|
Frisinga-TUM 34/70® | S. pastorianus | lager beer | − | flocculent | 94.06 ± 0.91 | 0.8 | 6.03 ± 0.30 | 81.63 ± 0.51 | 9 |
Securitas-TUM 193® | S. pastorianus | lager bee | − | flocculent | 86.60 ± 0.52 | 0.7 | 9.47 ± 0.68 | 79.30 ± 0.51 | 9 |
LeoBavaricus-TUM 68® | S. cerevisiae | wheat beer | + | powdery | 99.65 ± 0.28 | 0.8 | 2.87 ± 0.30 | 86.17 ± 0.05 | 4 |
LunaBavaria-TUM 127® | S. cerevisiae | wheat beer | + | flocculent | 01.05 ± 2.89 | 0.6 | 1.63 ± 0.51 | 76.20 ± 1.76 | 6 |
Colonia-TUM 177® | S. cerevisiae | kölsch and alt beer | − | powdery | 94.80 ± 0.78 | 0.6 | 3.80 ± 0.79 | 84.93 ± 0.37 | 4 |
Vetus-TUM 184® | S. cerevisiae | alt beer | − | flocculent | 60.92 ± 5.87 | 0.7 | 3.10 ± 0.16 | 80.97 ± 3.02 | 11 |
Mel-TUM 211® | S. cerevisiae | ale beer | − | powdery | 26.66 ± 0.26 | 0.5 | 2.60 ± 0.98 | 66.13 ± 0.51 | 10 |
Monacus-TUM 381® | S. cerevisiae | wheat beer | + | powdery | 97.75 ± 0.09 | 0.7 | 0.50 ± 0.00 | 86.17 ± 0.11 | 7 |
Tropicus-TUM 506® | S. cerevisiae | ale beer | − | powdery | 59.28 ± 0.81 | 0.5 | 2.23 ± 1.02 | 77.37 ± 1.34 | 9 |
Harmonia-TUM 511® | S. cerevisiae | ale and wheat beer | + | powdery | 83.91 ± 0.71 | 0.8 | 0.50 ± 0.00 | 82.70 ± 0.42 | 6 |