Analysis of VEGF, IGF1/2 and the Long Noncoding RNA (lncRNA) H19 Expression in Polish Women with Endometriosis
Abstract
:1. Introduction
2. Results
Expression Analysis of the VEGF, IGF1, IGF2 and H19 Genes
3. Discussion
4. Materials and Methods
4.1. Patients
4.2. RNA Isolation
4.3. Quantitative Real Time Polymerase Chain Reaction (qRT-PCR)
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pašalić, E.; Tambuwala, M.M.; Hromić-Jahjefendić, A. Endometriosis: Classification, pathophysiology, and treatmentoptions. Pathol. Res. Pract. 2023, 251, 154847. [Google Scholar] [CrossRef] [PubMed]
- Smolarz, B.; Szyłło, K.; Romanowicz, H. Endometriosis: Epidemiology, Classification, Pathogenesis, Treatment and Genetics (Review of Literature). Int. J. Mol. Sci. 2021, 22, 10554. [Google Scholar] [CrossRef] [PubMed]
- Kapoor, R.; Stratopoulou, C.A.; Dolmans, M.M. Pathogenesis of Endometriosis: New Insights into Prospective Therapies. Int. J. Mol. Sci. 2021, 22, 11700. [Google Scholar] [CrossRef]
- Signorile, P.G.; Viceconte, R.; Vincenzi, B.; Baldi, A. Differential Expression in Endometriosis Tissue versus Endometrium of the Uterine Adenogenesis Factors PRL-R, GH, IGF1, and IGF2. Crit. Rev. Eukaryot. Gene Expr. 2023, 33, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Piau, T.B.; de Queiroz Rodrigues, A.; Paulini, F. Insulin-like growth factor (IGF) performance in ovarian function and applications in reproductive biotechnologies. Growth Horm. IGF Res. 2023, 72–73, 101561. [Google Scholar] [CrossRef] [PubMed]
- Tesone, M.; Bilotas, M.; Barañao, R.I.; Meresman, G. The role of GnRH analogues in endometriosis-associated apoptosis and angiogenesis. Gynecol. Obstet. Investig. 2008, 66, 10–18. [Google Scholar] [CrossRef] [PubMed]
- Uemura, A.; Fruttiger, M.; D’Amore, P.A.; De Falco, S.; Joussen, A.M.; Sennlaub, F.; Brunck, L.R.; Johnson, K.T.; Lambrou, G.N.; Rittenhouse, K.D.; et al. VEGFR1 signaling in retinal angiogenesis and microinflammation. Prog. Retin. Eye Res. 2021, 84, 100954. [Google Scholar] [CrossRef] [PubMed]
- Kianpour, M.; Nematbakhsh, M.; Ahmadi, S.M.; Jafarzadeh, M.; Hajjarian, M.; Pezeshki, Z.; Safari, T.; Eshraghi-Jazi, F. Serum and peritoneal fluid levels of vascular endothelial growth factor in women with endometriosis. Int. J. Fertil. Steril. 2013, 7, 96–99. [Google Scholar] [PubMed]
- Mattick, J.S.; Amaral, P.P.; Carninci, P.; Carpenter, S.; Chang, H.Y.; Chen, L.L.; Chen, R.; Dean, C.; Dinger, M.E.; Fitzgerald, K.A.; et al. Long non-coding RNAs: Definitions, functions, challenges and recommendations. Nat. Rev. Mol. Cell Biol. 2023, 24, 430–447. [Google Scholar] [CrossRef]
- Hernández-Lemus, E.; Reyes-Gopar, H.; Espinal-Enríquez, J.; Ochoa, S. The Many Faces of Gene Regulation in Cancer: A Computational Oncogenomics Outlook. Genes 2019, 10, 865. [Google Scholar] [CrossRef]
- Yang, J.; Qi, M.; Fei, X.; Wang, X.; Wang, K. LncRNA H19: A novel oncogene in multiple cancers. Int. J. Biol. Sci. 2021, 17, 3188–3208. [Google Scholar] [CrossRef] [PubMed]
- Xia, Y.; Pei, T.; Zhao, J.; Wang, Z.; Shen, Y.; Yang, Y.; Liang, J. Long noncoding RNA H19: Functions and mechanisms in regulating programmed cell death in cancer. Cell Death Discov. 2024, 10, 76. [Google Scholar] [CrossRef]
- Kvaskoff, M.; Mahamat-Saleh, Y.; Farland, L.V.; Shigesi, N.; Terry, K.L.; Harris, H.R.; Roman, H.; Becker, C.M.; As-Sanie, S.; Zondervan, K.T.; et al. Endometriosis and cancer: A systematic review and meta-analysis. Hum. Reprod. Update 2021, 27, 393–420. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Li, Z.; Chen, W.; Zhai, W.; Pan, J.; Pang, H.; Li, X. H19 promotes endometrial cancer progression by modulating epithelial-mesenchymal transition. Oncol. Lett. 2017, 13, 363–369. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Liu, L.; Zhong, Y.; Cai, M.; Gao, J.; Tan, C.; Han, X.; Guo, R.; Han, L. LncRNA H19 over-expression inhibited Th17 cell differentiation to relieve endometriosis through miR-342-3p/IER3 pathway. Cell Biosci. 2019, 9, 84. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Zhang, L.; Yu, Q.; Zhang, Y.; Yan, L.; Chen, Z. The estrogen-regulated lncRNA H19/miR-216a-5p axis alters stromal cell invasion and migration via ACTA2 in endometriosis. Mol. Hum. Reprod. 2019, 25, 550–561. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Xin, W.; Lu, Q.; Tang, X.; Wang, F.; Shao, W.; Zhang, Y.; Qiu, J.; Hua, K. Knockdown of lncRNA H19 suppresses endometriosis in vivo. Braz. J. Med. Biol. Res. 2021, 54, e10117. [Google Scholar] [CrossRef]
- Liu, S.; Qiu, J.; Tang, X.; Li, Q.; Shao, W. Estrogen regulates the expression and function of lncRNA-H19 in ectopic endometrium. Int. J. Women’s Health 2022, 14, 821. [Google Scholar] [CrossRef] [PubMed]
- Ghazal, S.; McKinnon, B.; Zhou, J.; Mueller, M.; Men, Y.; Yang, L.; Mueller, M.; Flannery, C.; Huang, Y.; Taylor, H.S. H19 lnc RNA alters stromal cell growth via IGF signaling in the endometrium of women with endometriosis. EMBO Mol. Med. 2015, 7, 996–1003. [Google Scholar] [CrossRef]
- Kamrani, S.; Amirchaghmaghi, E.; Ghaffari, F.; Shahhoseini, M.; Ghaedi, K. Altered gene expression of VEGF, IGFs and H19 lncRNA and epigenetic profile of H19-DMR region in endometrial tissues of women with endometriosis. Reprod. Health 2022, 19, 100. [Google Scholar] [CrossRef]
- Korucuoglu, U.; Biri, A.A.; Konac, E.; Alp, E.; Onen, I.H.; Ilhan, M.N.; Turkyilmaz, E.; Erdem, A.; Erdem, M.; Menevse, S. Expression of the imprinted IGF2 and H19 genes in the endometrium of cases with unexplained infertility. Eur. J. Obst. Gynecol. Reprod. Biol. 2010, 149, 77–81. [Google Scholar] [CrossRef]
- Bougie, O.; Nwosu, I.; Warshafsky, C. Revisiting the impact of race/ethnicity in endometriosis. Reprod. Fertil. 2022, 3, R34–R41. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, Y.; Tayama, C.; Tomikawa, J.; Akaishi, R.; Kamura, H.; Matsuoka, K.; Wake, N.; Minakami, H.; Kato, K.; Yamada, T.; et al. Placenta-specific epimutation at H19-DMR among common pregnancy complications: Its frequency and effect on the expression patterns of H19 and IGF2. Clin. Epigenetics 2019, 11, 113. [Google Scholar] [CrossRef] [PubMed]
- Hu, S.; Zheng, J.; Du, Z.; Wu, G. Knock down of lncRNA H19 promotes axon sprouting and functional recovery after cerebral ischemic stroke. Brain Res. 2020, 1732, 146681. [Google Scholar] [CrossRef] [PubMed]
- Ghanipoor-Samami, M.; Javadmanesh, A.; Burns, B.M.; Thomsen, D.A.; Nattrass, G.S.; Estrella, C.A.; Kind, K.L.; Hiendleder, S. Atlas of tissue-and developmental stage specific gene expression for the bovine insulin-like growth factor (IGF) system. PLoS ONE 2018, 13, e0200466. [Google Scholar] [CrossRef] [PubMed]
- Lei, Q.; Pan, Q.; Li, N.; Zhou, Z.; Zhang, J.; He, X.; Peng, S.; Li, G.; Sidhu, K.; Chen, S.; et al. H19 regulates the proliferation of bovine male germline stem cells via IGF-1 signaling pathway. J. Cell. Physiol. 2019, 234, 915–926. [Google Scholar] [CrossRef] [PubMed]
- Sparago, A.; Cerrato, F.; Vernucci, M.; Ferrero, G.B.; Silengo, M.C.; Riccio, A. Microdeletions in the human H19 DMR result in loss of IGF2 imprinting and Beckwith–Wiedemann syndrome. Nat. Genet. 2004, 36, 958–960. [Google Scholar] [CrossRef] [PubMed]
- Honda, S.; Arai, Y.; Haruta, M.; Sasaki, F.; Ohira, M.; Yamaoka, H.; Horie, H.; Nakagawara, A.; Hiyama, E.; Todo, S.; et al. Loss of imprinting of IGF2 correlates with hypermethylation of the H19 differentially methylated region in hepatoblastoma. Br. J. Cancer 2008, 99, 1891–1899. [Google Scholar] [CrossRef]
- Barcz, E.; Milewski, Ł.; Dziunycz, P. Peritoneal cytokines and adhesions formation in endometriosis: An inverse association with vascular endothelial growth factor concentration. Fertil. Steril. 2012, 97, 1380–1386. [Google Scholar] [CrossRef]
- Bisht, M.; Dhasmana, D.C.; Bist, S.S. Angiogenesis: Future of pharmacological modulation. Indian J. Pharmacol. 2010, 42, 2–8. [Google Scholar] [CrossRef]
- Bourlev, V.; Iljasova, N.; Adamyan, L.; Larsson, A.; Olovsson, M. Signs of reduced angiogenic activity after surgical removal of deeply infiltrating endometriosis. Fertil. Steril. 2010, 94, 52–57. [Google Scholar] [CrossRef] [PubMed]
- Altinkaya, S.; Ugur, M.; Ceylaner, G.; Ozat, M.; Gungor, T.; Ceylaner, S. Vascular endothelial growth factor +405 C/G polimorphism is highly associated with an increased risk of endometriosis in Turkish women. Arch. Gynecol. Obstet. 2011, 283, 267–272. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.H.; Huang, C.W.; Lien, H.T.; Hsiao, Y.Y.; Weng, P.L.; Chang, Y.C.; Cheng, J.H.; Lan, K.C. A Preliminary Investigation of the Roles of Endometrial Cells in Endometriosis Development via In Vitro and In Vivo Analyses. Int. J. Mol. Sci. 2024, 25, 3873. [Google Scholar] [CrossRef] [PubMed]
- Fang, X. The expression of hepatocyte growth factor (HGF) and vascular epithelial growth factor (VEGF) in peritoneal fluid of patients with endometriosis. J. Clin. Res. 2007, 1, 1. [Google Scholar]
- Sel’kov, S.A.; Solodovnikova, N.G.; Pavlov, O.V.; Niauri, D.A. Local production of interleukins and growth factors in external genital endometriosis. Bull. Experim. Biol. Med. 2005, 139, 444–447. [Google Scholar] [CrossRef]
- Machado, D.E.; Berardo, P.T.; Palmero, C.Y.; Nasciutti, L.E. Higher expression of vascular endothelial growth factor (VEGF) and its receptor VEGFR-2 (Flk-1) and metalloproteinase-9 (MMP-9) in a rat model of peritoneal endometriosis is similar to cancer diseases. J. Experim. Clin. Cancer Res. 2010, 29, 1. [Google Scholar] [CrossRef]
- Yerlikaya, G.; Balendran, S.; Pröstling, K.; Reischer, T.; Birner, P.; Wenzl, R.; Kuessel, L.; Streubel, B.; Husslein, H. Comprehensive study of angiogenic factors in women with endometriosis compared to women without endometriosis. Eur. J. Obst. Gynecol. Reprod. Biol. 2016, 204, 88–98. [Google Scholar] [CrossRef] [PubMed]
- Arablou, T.; Aryaeian, N.; Khodaverdi, S.; Kolahdouz-Mohammadi, R.; Moradi, Z.; Rashidi, N.; Delbandi, A.A. The effects of resveratrol on the expression of VEGF, TGF-β, and MMP-9 in endometrial stromal cells of women with endometriosis. Sci. Rep. 2021, 11, 6054. [Google Scholar] [CrossRef] [PubMed]
- Cardoso, J.V.; Abrão, M.S.; Vianna-Jorge, R.; Ferrari, R.; Berardo, P.T.; Machado, D.E.; Perini, J.A. Combined effect of vascular endothelial growth factor and its receptor polymorphisms in endometriosis: A case-control study. Eur. J. Obstet. Gynecol. Reprod. Biol. 2017, 209, 25–33. [Google Scholar] [CrossRef]
- Kim, J.G.; Suh, C.S.; Kim, S.H.; Choi, Y.M.; Moon, S.Y.; Lee, J.Y. Insulin-like growth factors (IGFs), IGF-binding proteins (IGFBPs), and IGFBP-3 protease activity in the peritoneal fluid of patients with and without endometriosis. Fertil. Steril. 2000, 73, 996–1000. [Google Scholar] [CrossRef]
- Khan, K.N.; Kitajima, M.; Hiraki, K.; Fujishita, A.; Sekine, I.; Ishimaru, T.; Masuzaki, H. Immunopathogenesis of pelvic endometriosis: Role of hepatocyte growth factor, macrophages and ovarian steroids. Am. J. Reprod. Immunol. 2008, 60, 383–404. [Google Scholar] [CrossRef] [PubMed]
- Forster, R.; Sarginson, A.; Velichkova, A.; Hogg, C.; Dorning, A.; Horne, A.W.; Saunders, P.T.K.; Greaves, E. Macrophage-derived insulin-like growth factor-1 is a key neurotrophic and nerve-sensitizing factor in pain associated with endometriosis. FASEB J. 2019, 33, 11210–11222. [Google Scholar] [CrossRef] [PubMed]
- Blontzos, N.; Mavrogianni, D.; Ntzeros, K.; Kathopoulis, N.; Moustogiannis, A.; Philippou, A.; Koutsilieris, M.; Protopapas, A. Differential Expression of Insulin Growth Factor 1 (IGF-1) Isoforms in Different Types of Endometriosis: Preliminary Results of a Single-Center Study. Biomolecules 2023, 14, 7. [Google Scholar] [CrossRef] [PubMed]
- Heidari, S.; Kolahdouz-Mohammadi, R.; Khodaverdi, S.; Tajik, N.; Delbandi, A.A. Expression levels of MCP-1, HGF, and IGF-1 in endometriotic patients compared with non-endometriotic controls. BMC Womens Health 2021, 21, 422. [Google Scholar] [CrossRef] [PubMed]
- Sbracia, M.; Scarpellini, F.; Zupi, E.; Manna, C.; Marconi, D.; Romanini, C.; Alo, P.; Di Tondo, U.; Grasso, J.A. Diferential expression of IGF-I and IGF-II in eutopic and ectopic endometria of women with endometriosis and in women without endometriosis. Am. J. Reprod. Immunol. 1997, 37, 326–329. [Google Scholar] [CrossRef] [PubMed]
- Milingos, D.; Katopodis, H.; Milingos, S.; Protopapas, A.; Creatsas, G.; Michalas, S.; Antsaklis, A.; Koutsilieris, M. Insulin-like growth factor-1 isoform mRNA expression in women with endometriosis: Eutopic endometrium versus endometriotic cyst. Ann. N. Y. Acad. Sci. 2006, 1092, 434–439. [Google Scholar] [CrossRef] [PubMed]
- Arablou, T.; Delbandi, A.A.; Khodaverdi, S.; Aref, S.; Kolahdouz-Mohammadi, R.; Heidari, S.; Mohammadi, T.; Aryaeian, N. Resveratrol reduces the expression of insulin-like growth factor-1 and hepatocyte growth factor in stromal cells of women with endometriosis compared with nonendometriotic women. Phytother. Res. 2019, 33, 1044–1054. [Google Scholar] [CrossRef] [PubMed]
- Gao, L.M.; Xu, S.F.; Zheng, Y.; Wang, P.; Zhang, L.; Shi, S.S.; Wu, T.; Li, Y.; Zhao, J.; Tian, Q.; et al. Long non-coding RNA H19 is responsible for the progression of lung adenocarcinoma by mediating methylation-dependent repression of CDH1 promoter. J. Cell. Mol. Med. 2019, 23, 6411–6428. [Google Scholar] [CrossRef]
- Peng, F.; Li, T.T.; Wang, K.L.; Xiao, G.Q.; Wang, J.H.; Zhao, H.D.; Kang, Z.J.; Fan, W.J.; Zhu, L.L.; Li, M.; et al. H19/let-7/LIN28 reciprocal negative regulatory circuit promotes breast cancer stem cell maintenance. Cell Death Dis. 2017, 8, e2569. [Google Scholar] [CrossRef]
- Banz, C.; Ungethuem, U.; Kuban, R.J.; Diedrich, K.; Lengyel, E.; Hornung, D. The molecular signature of endometriosis-associated endometrioid ovarian cancer differs significantly from endometriosis-independent endometrioid ovarian cancer. Fertil. Steril. 2010, 94, 1212–1217. [Google Scholar] [CrossRef]
- Liu, S.P.; Tian, X.; Cui, H.; Zhang, Q.; Hua, K. The messenger RNA and long non-coding RNA expression profiles in ectopic and eutopic endometrium provide novel insights into endometriosis. Reprod. Dev. Med. 2019, 3, 11–17. [Google Scholar] [CrossRef]
- Liu, S.; Qiu, J.; Tang, X.; Cui, H.; Zhang, Q.; Yang, Q. LncRNA-H19 regulates cell proliferation and invasion of ectopic endometrium by targeting ITGB3 via modulating miR-124-3p. Exp. Cell Res. 2019, 381, 215–222. [Google Scholar] [CrossRef]
- Kallen, A.N.; Zhou, X.B.; Xu, J.; Qiao, C.; Ma, J.; Yan, L.; Lu, L.; Liu, C.; Yi, J.S.; Zhang, H.; et al. The imprinted H19 lncRNA antagonizes let-7 microRNAs. Mol. Cell 2013, 52, 101–112. [Google Scholar] [CrossRef] [PubMed]
- Fabian, M.R.; Sonenberg, N. The mechanics of miRNA-mediated gene silencing: A look under the hood of miRISC. Nat. Struct. Mol. Biol. 2012, 19, 586–593. [Google Scholar] [CrossRef]
- Zhu, H.; Shyh-Chang, N.; Segre, A.V.; Shinoda, G.; Shah, S.P.; Einhorn, W.S.; Takeuchi, A.; Engreitz, J.M.; Hagan, J.P.; Kharas, M.G.; et al. The Lin28/let-7 axis regulates glucose metabolism. Cell 2011, 147, 81–94. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.Y.; Koo, Y.J.; Lee, D.H. Classification of endometriosis. Yeungnam Univ. J. Med. 2021, 38, 10–18. [Google Scholar] [CrossRef] [PubMed]
- Szaflik, T.; Romanowicz, H.; Szyłło, K.; Smolarz, B. Long Non-Coding RNA SNHG4 Expression in Women with Endometriosis: A Pilot Study. Genes 2023, 14, 152. [Google Scholar] [CrossRef]
- Szaflik, T.; Romanowicz, H.; Szyłło, K.; Kołaciński, R.; Michalska, M.M.; Samulak, D.; Smolarz, B. Analysis of Long Non-Coding RNA (lncRNA) UCA1, MALAT1, TC0101441, and H19 Expression in Endometriosis. Int. J. Mol. Sci. 2022, 23, 11583. [Google Scholar] [CrossRef]
Patients (n = 100) | Control (n = 100) |
---|---|
Spearman’s rank correlation | |
Age | |
VEGF | |
r = 0.11, p = 0.24 | r = 0.32, p = 0.47 |
IGF1 | |
r = 0.08, p = 0.33 | r = 0.15, p = 0.28 |
IGF2 | |
r = −0.16, p = 0.71 | r = 0.31, p = 0.49 |
H19 | |
r = −0.61, p = 0.018 | r = −0.12, p = 0.41 |
BMI | |
VEGF | |
r = 0.52, p = 0.19 | r = 0.15, p = 0.33 |
IGF1 | |
r = 0.53, p = 0.18 | r = 0.28, p = 0.09 |
IGF2 | |
r = 0.83, p = 0.13 | r = 0.73, p = 0.23 |
H19 | |
r = 0.32, p = 0.67 | r = 0.48, p = 0.11 |
Kruskal–Wallis test | |
Deliveries | |
VEGF | |
p = 0.1572 | |
C0 vs. C1 C1 vs. C ≥ 2 C0 vs. C ≥ 2 P0 vs. P1 P0 vs. P ≥ 2 P1 vs. P ≥ 2 | ns ns ns ns ns ns |
IGF1 | |
p = 0.071 | |
C0 vs. C1 C1 vs. C ≥ 2 C0 vs. C ≥ 2 P0 vs. P1 P0 vs. P ≥ 2 P1 vs. P ≥ 2 | ns ns ns ns ns ns |
IGF2 | |
p = 0.35 | |
C0 vs. C1 C1 vs. C ≥ 2 C0 vs. C ≥ 2 P0 vs. P1 P0 vs. P ≥ 2 P1 vs. P ≥ 2 | ns ns ns ns ns ns |
H19 | |
p = 0.09 | |
C0 vs. C1 C1 vs. C ≥ 2 C0 vs. C ≥ 2 P0 vs. P1 P0 vs. P ≥ 2 P1 vs. P ≥ 2 | ns ns ns ns ns ns |
The U Mann–Whitney test | |
VEGF | |
C yes vs. C no | p = 0.39 |
P yes vs. P no | p = 0.18 |
IGF1 | |
C yes vs. C no | p = 0.56 |
P yes vs. P no | p = 0.08 |
IGF2 | |
C yes vs. C no | p = 0.17 |
P yes vs. P no | p = 0.36 |
H19 | |
C yes vs. C no | p = 0.11 |
P yes vs. P no | p = 0.15 |
Patients (n = 100) | Control (n = 100) | ||
---|---|---|---|
Age (Range) 21–53 Years Age (Mean) 34.89 ± 7.49 | Age (Range) 26–67 Years Age (Mean) 37.93 ± 6.01 | ||
BMI, n (%) <25 kg/m2 25 ≤ BMI < 30 kg/m2 ≥30 kg/m2 | The number (%) 68 (68%) 22 (22%) 10 (10%) | BMI, n (%) <25 kg/m2 25 ≤ BMI < 30 kg/m2 ≥30 kg/m2 | The number (%) 29 (29%) 43 (43%) 28 (28%) |
Deliveries 0 1 ≥2 | The number (%) 53 (53%) 21 (21%) 26 (26%) | Deliveries 0 1 ≥2 | The number (%) 7 (7%) 36 (36%) 57 (57%) |
Spontaneous abortion Yes No | The number (%) 5 (5%) 95 (95%) | Spontaneous abortion Yes No | The number (%) 9 (9%) 91 (91%) |
Clinical stage I II III IV | The number (%) 26 (26%) 25 (25%) 17 (17%) 32 (32%) |
Genes | Primer Sequences (5′–3′) | Product Length (bp) |
---|---|---|
VEGF | F: ACCCACCCACATACATAC | 151 |
R: CAGCAGTCAAATACATCCAG | ||
IGF1 | ATGCTCTTCAGTTCGTGTG | 148 |
CAATACATCTCCAGCCTCCT | ||
IGF2 | F: CCTCTATCCTTG ATACAACAGC | 121 |
R: AATTCGTCTGATTGTCCAGG | ||
H19 | F: GTGACAAGCAGGACATGAC | 121 |
R: GAAGTAAAGAAACAGACCCGC | ||
HPRT1 | F: CCTGGCGTCGTGATTAGTGAT | 91 |
R: ACACCCTTTCCAAATCCTCAGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Smolarz, B.; Szaflik, T.; Romanowicz, H.; Bryś, M.; Forma, E.; Szyłło, K. Analysis of VEGF, IGF1/2 and the Long Noncoding RNA (lncRNA) H19 Expression in Polish Women with Endometriosis. Int. J. Mol. Sci. 2024, 25, 5271. https://doi.org/10.3390/ijms25105271
Smolarz B, Szaflik T, Romanowicz H, Bryś M, Forma E, Szyłło K. Analysis of VEGF, IGF1/2 and the Long Noncoding RNA (lncRNA) H19 Expression in Polish Women with Endometriosis. International Journal of Molecular Sciences. 2024; 25(10):5271. https://doi.org/10.3390/ijms25105271
Chicago/Turabian StyleSmolarz, Beata, Tomasz Szaflik, Hanna Romanowicz, Magdalena Bryś, Ewa Forma, and Krzysztof Szyłło. 2024. "Analysis of VEGF, IGF1/2 and the Long Noncoding RNA (lncRNA) H19 Expression in Polish Women with Endometriosis" International Journal of Molecular Sciences 25, no. 10: 5271. https://doi.org/10.3390/ijms25105271