Next Article in Journal
Carbapenem-Resistant NDM and OXA-48-like Producing K. pneumoniae: From Menacing Superbug to a Mundane Bacteria; A Retrospective Study in a Romanian Tertiary Hospital
Previous Article in Journal
Macrolide Resistance in the Aerococcus urinae Complex: Implications for Integrative and Conjugative Elements
Previous Article in Special Issue
In Vitro Antibiofilm Activity of Resveratrol against Aeromonas hydrophila
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 13
Issue 5
10.3390/antibiotics13050434
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Inhibition of Candida albicans Biofilm Formation and Attenuation of Its Virulence by Liriope muscari

by
Jeonghoon Lee
1,†,
Hyunchan Song
2,† and
Kiyoung Kim
2,*
1
Department of Medical Science of Meridian, College of Korean Medicine, Graduate School, Kyung Hee University, Kyungheedae-ro 6-gil, Dongdaemun-gu, Seoul 02447, Republic of Korea
2
Graduate School of Biotechnology, Kyung Hee University, 1732, Deogyeong-daero, Giheung-gu, Yongin-si 17104, Republic of Korea
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Antibiotics 2024, 13(5), 434; https://doi.org/10.3390/antibiotics13050434
Submission received: 29 March 2024 / Revised: 7 May 2024 / Accepted: 10 May 2024 / Published: 12 May 2024
(This article belongs to the Special Issue Antibiofilm Activity against Multidrug-Resistant Pathogens)
Browse Figures
Versions Notes

Abstract

:
(1) Background: Although Candida albicans accounts for the majority of fungal infections, therapeutic options are limited and require alternative antifungal agents with new targets; (2) Methods: A biofilm formation assay with RPMI1640 medium was performed with Liriope muscari extract. A combination antifungal assay, dimorphic transition assay, and adhesion assay were performed under the biofilm formation condition to determine the anti-biofilm formation effect. qRT-PCR analysis was accomplished to confirm changes in gene expression; (3) Results: L. muscari extract significantly reduces biofilm formation by 51.65% at 1.56 μg/mL use and therefore increases susceptibility to miconazole. L. muscari extract also inhibited the dimorphic transition of Candida; nearly 50% of the transition was inhibited when 1.56 μg/mL of the extract was treated. The extract of L. muscari inhibited the expression of genes related to hyphal development and extracellular matrix of 34.4% and 36.0%, respectively, as well as genes within the Ras1-cAMP-PKA, Cph2-Tec1, and MAP kinase signaling pathways of 25.58%, 7.1% and 15.8%, respectively, at 1.56 μg/mL of L. muscari extract treatment; (4) Conclusions: L. muscari extract significantly reduced Candida biofilm formation, which lead to induced antifungal susceptibility to miconazole. It suggests that L. muscari extract is a promising anti-biofilm candidate of Candida albicans since the biofilm formation of Candida albicans is an excellent target for candidiasis regulation.

1. Introduction

Candida albicans accounts for the majority of fungal pathogens found and has a mortality rate of 40–60% [1,2,3]. It is typically found in the mouth, skin, and intestines. Sometimes, it can invade the human body, causing infection in the blood, bones, brain, and heart [2]. The annual expenditure for the treatment of fungal diseases was $4.5 billion in the United States alone, that for Candida infections cost the most with $1.4 billion, while that for aspergillus infections cost $1.2 billion [2,3,4]. Additionally, there were 3,639,037 candidiasis outpatient visits, costing $1.6 billion out of the total outpatient costs of $2.6 billion. The second-highest outpatient cost was for patients with dermatophyte infections, amounting to $802 million [4].
Recently, efforts to discover alternative methods for eradicating biofilm-related infections have increased [5]. Early antibiotics caused an increased resistance of fungi [6]. One of the new therapeutic approaches to medication for fungal infections is combinational therapies [5]. It targets several aspects of micro-organisms to control infections. Biofilm formation of pathogenic fungi is now at the center of attention due to their increasing resistance to commercially available antifungal agents and environmental conditions [7,8,9].
C. albicans biofilm formation involves a complex developmental process. It begins with the attachment of planktonic cells to a substrate, followed by cell proliferation, hyphal growth, and extracellular matrix production [10,11,12]. Eventually, mature cells disperse from the biofilm into the surrounding environment [10]. Planktonic cells are mostly vulnerable to several agents since there are no defensive barriers between the cells and the environment [13]. The biofilm formation is a critical step in pathogenesis because C. albicans tends to exhibit reduced sensitivity or insensitivity to antifungal agents [14,15].
Natural substances significantly contribute to the discovery and development of drugs [16,17]. More than 75% of the treatment drugs used against infectious diseases are derived from nature [18]. It has advantages over synthetic medications in cost and the number of potential candidates [19]. Also, it may lead to shortcuts to study combinational therapies [5].
The genus Liriope has been pharmacologically used in several Asian countries. It was historically proven to treat various diseases [20]. With the advancement of technologies, recent studies analyzed the chemicals of genus Liriope involved in traditional use [20,21]. Liriope muscari, one of the genus Liriope plants, has been utilized in traditional Chinese medicine for the treatment of various ailments including pharyngitis, bronchitis, pneumonia, cough, and cardiovascular disease [22]. Previous studies found that they have novel bioactive compounds including steroidal saponins, flavonoids, and sesquiterpene glucoside [20]. For example, a novel steroidal saponin DT-13 isolated from L. muscari reduced the adhesion of human breast cancer cells and their migration under hypoxia [23,24]. However, neither the activities of the whole extract of L. muscari nor the compounds in them against C. albicans have been studied. It means that the inhibition of attachment to the animal cells or the surrounding area, transitions from yeast to hyphae, and biofilm formation of C. albicans using L. muscari remain largely unclear. The objectives of this study were to (i) evaluate the potential inhibition by L. muscari on biofilm formation of C. albicans and (ii) improve the understanding of L. muscari triggering anti-biofilm mechanisms.

2. Results

2.1. Anti-biofilm effect of L. muscari

L. muscari was treated for the purpose of determining its anti-biofilm activity. L. muscari significantly reduced biofilm density in the strains tested (Figure 1). The IC50 value of L. muscari for inhibition of biofilm formation was nearly 1.56 μg/mL against C. albicans (Figure 1). With only the use of 1.56 μg/mL, 51.65 ± 7.83% of biofilm formation was inhibited.

2.2. L. muscari Extract Increased the Susceptibility of Commercial Antibiotics to C. albicans

L. muscari extract was combined with antibiotics to investigate if inhibiting biofilm formation would influence antibiotic susceptibility. After 24 h of growth, Candida cultures were treated with the indicated concentrations of miconazole (MCZ) with or without L. muscari (LM) extract for an additional 24 h. L. muscari extract increased susceptibility to antifungal agents (Figure 2). When MCZ was treated alone, 58.53 ± 2.92% of viable fungus remained. However, when L. muscari was treated with MCZ, a reduced amount of MCZ use for C. albicans control was observed, which means L. muscari-induced susceptibility of C. albicans on MCZ had increased.

2.3. Inhibitory Activity of L. muscari on C. albicans Dimorphic Transition from Yeast to Hyphae

Inhibition of C. albicans dimorphic transition by L. muscari was determined. Since not only can nutrient-deficient spider medium but also liquid RPMI 1640 and mammalian serum trigger the formation of hyphae, we conducted the examination using both conditions [25]. At a low concentration of 1.56 μg/mL, L. muscari effectively interrupted hyphal formation in RPMI 1640 or 10% FBS YPD medium to 49.3 ± 2.4% and 51.3 ± 2.5%, respectively (Figure 3a–d). Therefore, these results suggest that L. muscari might have the ability to impede the transition from yeast to the hyphal form of C. albicans.

2.4. Suppression of the Gene Expression Related to Biofilm Formation Regulatory Proteins after L. muscari Treatment

To analyze the molecular background of L. muscari’s suppression of hyphal growth and cell attachment, qRT-PCR was conducted to determine the expression of genes involved in hyphal growth and cell attachment in C. albicans. The planktonic cells were included in the process to determine whether those changes were caused within the hyphal growth.
After treatment with 1.56–25 μg/mL of L. muscari, the expression levels of four genes (RAS1, EFG1, TEC1, and CDC35) associated with the Ras1-cAMP-Efg1 pathway [26] were significantly reduced (Figure 4a–d). Ras1p is a GTPase that acts to induce the formation of hyphae by activating both the MAPK cascade pathway and the Ras1-cAMP-Efg1 pathway [27]. Efg1p is a transcription factor of the Ras1-cAMP-Efg1 pathway, which is important in regulating the expression of certain hyphae-specific genes, including ECE1, HWP1, and ALS3 [28].
L. muscari caused alterations in the transcription level of 12 genes involved in biofilm formation which were evaluated by qRT-PCR. The degree of gene expression for each gene was analyzed in cells treated with L. muscari (1.56–12.5 μg/mL) for 24 h and compared to untreated cells and planktonic cells (Figure 5). Results showed that L. muscari significantly repressed the expression levels of the following genes: hypha essential genes (ALS3, ECE1, and HWP1), Ras1-cAMP-Efg1 pathway (CYR1, EFG1, and RAS1), extracellular matrix (ADH5, CSH1, GSC1, and ZAP1), Cph2-Tec1 pathway (TEC1), and MAP kinase pathway (HST7). The expression of the genes related to hyphal development were decreased by 34.4%, and those of the extracellular matrix were decreased by 36.0% at 1.56 μg/mL. Also, the genes within the Ras1-cAMP-PKA, Cph2-Tec1, and MAP kinase signaling pathways were downregulated by 25.58%, 7.1%, and 15.8%, respectively, in the same concentration.

2.5. L. muscari Had No Effect on Sum of Fungal Growth

To determine whether the inhibition of biofilm formation by L. muscari resulted from its antifungal activity, C. albicans was exposed to specified concentrations of L. muscari for 24 h. Surprisingly, there were no clear differences between the treatment and the control. Both groups exhibited the growth of C. albicans in a time-dependent manner, which means L. muscari only affects the biofilm formation of C. albicans while not affecting fungal growth (Figure 5).

3. Discussion

C. albicans is a yeast that opportunistically causes systemic infections in individuals with compromised immune systems [2]. Nosocomial C. albicans infections are frequently associated with their capacity to produce biofilms on mucosal surfaces and medical devices [3,29,30]. The formation of biofilms is a finely regulated process, governed by multiple interconnected signaling pathways [25], resulting in structured microbial communities attached to surfaces and enclosed in an exopolymeric extracellular matrix [3,29,31].
The formation of biofilms is a critical stage in pathogenesis, as C. albicans within biofilm are generally less susceptible or resistant to antifungal agents [32]. Consequently, the development of new antifungal agents with inhibitory activity on the attachment of C. albicans attachment, the transition of yeast-to-hyphae, and biofilm formation should be an important strategy.
In this study, L. muscari was examined for an inhibitor of biofilm formation by C. albicans. L. muscari also increased antifungal activity by inhibiting biofilm formation (Figure 2). Since infections caused by micro-organisms are hard to cure due to their adaptations to antibiotics and their rapid mutations [33], L. muscari can be useful as a great adjuvant when used with the usual antibiotics as we found in this study. Additionally, we discovered that L. muscari could potentially make C. albicans more susceptible to other chemicals by inhibiting biofilm formation. This is expected to enhance the cost-effectiveness of the currently used treatment.
L. muscari at 6.25 μg/mL inhibited the transformation of hyphal morphology in liquid RPMI 1640 and 10% FBS YPD medium (Figure 3). This indicates the potential application of L. muscari as an agent to counteract the virulence of C. albicans.
In an effort to understand the mechanisms responsible for the anti-biofilm effects of L. muscari on C. albicans, we analyzed the gene expression profiles related to cell adhesion, hyphal development, and extracellular matrix synthesis under conditions that promote biofilm formation. The major signaling pathways directing hyphal guidance and biofilm construction are the Ras1-cAMP-Efg1 and MAP kinase pathways [25,34,35]. Interestingly, L. muscari significantly reduced the expression levels of RAS1, CYR1, and EFG1, which are part of the Ras1-cAMP-Efg1 pathway. The Ras1p GTPase activates Cyr1p adenylate cyclase to produce cAMP, leading to the activation of the Efg1p transcription factor. This factor significantly influences the regulation of several gene expressions related to hyphae, such as ALS3, HWP1, and ECE1, which are crucial for C. albicans adherence [36] and biofilm formation [35,37,38,39]. Consequently, the transcription of ALS3, HWP1, and ECE1 was also repressed.
In contrast, L. muscari did not alter the expression levels of HST7 and TEC1 genes. HST7 is responsible for encoding a protein kinase within the MAP kinase pathway, whereas TEC1 encodes a transcription factor that independently enhances the expression of genes specific to hyphal formation, separate from the two pathways described above [40].
While the exact components of the extracellular matrix in C. albicans biofilms remain not fully characterized, its known components include carbohydrates, proteins, and nucleic acids as previously described [41]. The major extracellular carbohydrate, β-1,3-glucan, produced by the enzyme β-1,3-glucan synthase (Gsc1p), led to the inclusion of the GSC1 transcript as a marker for matrix production [42]. As expected, L. muscari downregulated GSC1 gene expression. The protein Zap1p (zinc-responsive activator protein) in C. albicans, which responds to zinc levels, promotes cell dispersal by downregulating matrix production. Zap1p directly activates the expression of CSH1 and IFD6, which suppresses substrate accumulation and indirectly inhibits the expression of other alcohol dehydrogenase genes, such as ADH5, which are involved in substrate generation [43]. L. muscari reduced the expression of ZAP1 and CSH1 yet had no impact on ADH5 expression. It is worth noting that ZAP1is also essential for the proper morphogenesis of C. albicans, aligning with observations that C. albicans ZAP1 mutants predominantly exhibit yeast growth in biofilms [43,44]. Consistently, microscopic examination showed that C. albicans cells treated with L. muscari predominantly exhibited yeast growth after 24 h of incubation.
The identification of chemical components in L. muscari that possess anti-biofilm activity is a subject of our future research. Previous studies have indicated that the extract of L. muscari, particularly the ethanol extract, exhibits antioxidant, anticancer, and anti-thrombotic properties [22,45,46]. Historically, these extracts have been used as medicinal remedies in East Asia, even before the identification of their effective chemicals. With the advancements in scientific instruments, the bioactive chemical compositions of these extracts have been recently reported. For instance, DT-13 (25 (R, S)-ruscogenin-1-O-[β-d-glucopyranosyl—(1→2)] [β-d-xylopyranosyl-(1→3)]-β-d-fucopyranoside), the most extensively examined chemical in L. muscari, has been reported to exhibit all three aforementioned activities and is known to downregulate matrix metalloproteinases and p38 activation in cancer cells. Two other compounds, norcurlignan ((2S,3R)-methyl-7-hydroxy-2-(4-hydroxy-3-methoxy-phenyl)-3-(hydroxymethyl)-2,3-dihydrobenzofuran-5-carboxylate) and limlactone ((4R,5S)-5-(3-hydroxy-2,6-dimethylphenyl)-4-isopropyldihydrofuran-2-one) were also identified in the 80% ethanol extract of L. muscari and both demonstrated antioxidant activities. However, none of the of L. muscari have been reported to inhibit the biofilm formation of C. albicans. Given the increasing number of reported cases of antifungal-resistant C. albicans, it is worthwhile to investigate the potential anti-biofilm components of L. muscari [47].
These findings suggest that L. muscari represses the formation of C. albicans biofilms by influencing the yeast–hyphal transition. Consequently, L. muscari shows promise as a potential coating agent for prosthetic medical devices as other antifungal treatments similarly do. Additionally, preclinical in vivo animal experiments should be performed to verify the possibility that L. muscari can be used as an agent to increase antifungal activity. To optimize the use of L. muscari in clinical application, studies should also be undertaken to identify a suitable solvent substitute with adequate solvency.

4. Materials and Methods

4.1. Strains

The C. albicans used in this study, KCTC 7965, was obtained from the Korean Collection for Type Cultures (Korean Collection for Type Cultures, Daejeon, Republic of Korea). The strain was preserved in 20% glycerol (BD Difco, NJ, USA) at −70 °C and cultured on YPD plates [peptone 20 g/L (BD Difco, Franklin Lakes, NJ, USA), yeast extract 10 g/L (BD Difco, NJ, USA), and 2% glucose (w/v) (Daejung, Siheung, Republic of Korea)].

4.2. Sample Preparation

The leaves of L. muscari were collected in Jeju, Republic of Korea (GPS: 33.3617° N, 126.5292° E). These leaves were thoroughly rinsed with distilled water and subsequently freeze-dried in preparation for extraction. A total of 100 g of the freeze-dried leaves of L. muscari were subjected to extraction in 1 L of 80% ethanol for 24 h. The resulting extracts were concentrated using a rotary evaporator (EYELA, Tokyo, Japan) which was connected to a refrigerated circulating bath (Jeio Tech, Seoul, Republic of Korea). This concentrated extract was then filtered using NO.2 filter paper (WHATMAN, Buckinghamshire, UK). The filtered products were once again freeze-dried and subsequently dissolved in 99.0% DMSO (Junsei, Tokyo, Japan) to achieve a concentration of 10 mg/mL. It is important to note that for all the negative controls utilized in this study, an equivalent volume of 99.0% DMSO was used since the influence of DMSO on C. albicans was previously reported [48]. The final DMSO concentration for each sample was 0.25%.

4.3. Inhibition of Biofilm Formation

The formation of biofilm was detected using the crystal violet assay [49]. C. albicans at a concentration of 5 × 105 CFU/mL was added to the wells of a 96-well plate (SPL, Pocheon, Republic of Korea), mixed in RPMI 1640 medium (Welgene, Gyeongsan, Republic of Korea), and L. muscari extract, ranging from 1.56 to 25 μg/mL, was added, and the mixture was cultured at 37 °C for 24 h. The plates were then incubated at 30 °C for 24 h. Each experiment included growth control and sterilized media control wells. After three washes with 200 μL of PBS, 100 μL of 1% aqueous crystal violet solution was added and incubated for 30 min. After staining, each well was washed three times with 200 μL of PBS and immediately destained with 150 μL of 30% acetic acid (Daejung, Siheung, Republic of Korea) for 15 min. The absorbance at 595 nm was measured using a microplate reader (BioTek Instruments, Seoul, Republic of Korea). Biofilm formation was normalized to the control using the following formula: [(1 − (OD595DMSO − OD595 compound)/OD595DMSO) × 100%] (Figure 1).

4.4. Combined Antifungal Effect of L. muscari Extract and Antifungal Agent

The combined antifungal effect of the extract and antifungal agent was measured according to previous work [50]. C. albicans was cultured overnight in YPD and then diluted to 1 × 106 cells/mL with fresh YPD in 96-well plates (SPL, Pocheon, Republic of Korea) prior to combinational treatment for biofilm formation. A total of 1 mL of Candida suspension was exposed to various concentrations of L. muscari, in combination with miconazole at a concentration of 3.125 μg/mL. The indicated concentrations of L. muscari and miconazole alone were also applied for comparison.
Biofilms were positioned at the bottom of the well and incubated at 30 °C for 24 h. After washing with PBS to remove planktonic cells, the cells were sonicated to break up clumps. The counts of biofilm fungal CFU were determined by plating serial dilutions on YPD agar.

4.5. Morphological Transition Using RPMI 1640 and 10% FBS YPD Liquid Medium

C. albicans was cultured overnight in a YPD medium. A concentration of 1 × 106 cells/mL with or without L. muscari extract was cultured in RPMI 1640 medium or 10% FBS YPD medium for 4 h at 37 °C. The inhibition of the transition from yeast to hyphal morphology was quantified by counting the number of individual budding cells relative to the number of hyphae in the population, as previously described [51]. At least 100 cells were counted in triplicate for each well, and all analyses were repeated five times. Images of the cells were captured using a microscope.

4.6. Quantitative RT-PCR Analysis

C. albicans was cultured on YPD agar. A single colony was selected, stirred at 30 °C, and inoculated into YPD. The following day, cultures at 1 × 106 cells/mL were diluted with YPD. Aliquots of the diluted suspension were treated with L. muscari extract at concentrations ranging from 1.56 to 25 μg/mL and incubated at 30 °C on an orbital shaker. Total RNA extraction was performed using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. Reverse transcription was carried out with 1 μg of RNA using reverse transcriptase (NanoHelix, Daejeon, Republic of Korea) to obtain cDNA. Quantitative real-time PCR (qRT-PCR) was conducted using 2X SybrGreen qPCR Master Mix (CellSafe, Suwon, Republic of Korea). Primer sequences used for the amplification of genes including GSP1, RAS1, EFG1, TEC1, CDC35, ALS3, HWP1, and ECE1 are listed in Table 1, which were used in the previous paper [52].

4.7. C. albicans Growth Test

The growth curve was obtained with some modifications [53]. Fungal cultures were set up at 1 × 106 cells/mL using fresh YPD broth. After adding L. muscari extract, it was cultured at 30 °C. The growth was evaluated by measuring OD600 with a microplate reader at intervals of 0, 1, 2, 4, 8, 12, and 24 h.

4.8. Statistical Analysis

All experiments were performed at least three times, and data were presented as the ± mean standard deviation (S.D). Statistical analysis was performed using Microsoft Excel 2021 (Microsoft, Redmond, WA, USA) and Statistical Package for the Social Sciences (SPSS) 28.0 (IBM Corp, New York, NY, USA). All graphs except microscopic images were analyzed by Microsoft Excel 2021. Statistical significance was defined at a p-value less than 0.05.

5. Conclusions

L. muscari should be a good candidate for anti-virulence agents against Candida infections because it inhibits biofilm formation and hyphal transition and increases antifungal susceptibility. This antifungal efficacy of L. muscari could suggest the direction for the development of new antifungal strategies with a lower virulence of C. albicans.

Author Contributions

Conceptualization, J.L. and K.K.; methodology, H.S., J.L. and K.K.; validation, H.S., J.L. and K.K.; formal analysis, H.S. and K.K.; investigation, H.S. and J.L.; resources, K.K.; data curation, K.K.; writing—original draft preparation, K.K.; writing—review and editing, K.K.; visualization, H.S.; supervision, K.K.; project administration, K.K.; funding acquisition, K.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the GRRC Program of Gyeonggi province [GRRC-KyungHee2020(B04)], Republic of Korea. This work was supported by the National R&D Program through the National Research Foundation of Korea (NRF) funded by the Korea government (Ministry of Science and ICT) (2021R1A6A3A13046056).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in article.

Acknowledgments

The authors thank all the participants involved in this research.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Atriwal, T.; Chawla, M.; Hussain, A.; Alajmi, M.F.; Abid, M. Reactive oxygen mediated apoptosis as a therapeutic approach against opportunistic Candida albicans. Adv. Protein Chem. Struct. Biol. 2021, 155, 25–49. [Google Scholar] [CrossRef] [PubMed]
  2. Pfaller, M.A.; Diekema, D.J. Epidemiology of invasive candidiasis: A persistent public health problem. Clin. Microbiol. Rev. 2007, 20, 133–163. [Google Scholar] [CrossRef] [PubMed]
  3. Chandra, J.; Kuhn, D.M.; Mukherjee, P.K.; Hoyer, L.L.; McCormick, T.; Ghannoum, M.A. Biofilm formation by the fungal pathogen Candida albicans: Development, architecture, and drug resistance. J. Bacteriol. 2001, 183, 5385–5394. [Google Scholar] [CrossRef] [PubMed]
  4. Benedict, K.; Jackson, B.R.; Chiller, T.; Beer, K.D. Estimation of direct healthcare costs of fungal diseases in the United States. Clin. Infect. Dis. 2019, 68, 1791–1797. [Google Scholar] [CrossRef] [PubMed]
  5. Koo, H.; Allan, R.N.; Howlin, R.P.; Stoodley, P.; Hall-Stoodley, L. Targeting microbial biofilms: Current and prospective therapeutic strategies. Nat. Rev. Microbiol. 2017, 15, 740–755. [Google Scholar] [CrossRef] [PubMed]
  6. Woappi, Y.; Gabani, P.; Singh, A.; Singh, O.V. Antibiotrophs: The complexity of antibiotic-subsisting and antibiotic-resistant microorganisms. Crit. Rev. Microbiol. 2016, 42, 17–30. [Google Scholar] [CrossRef] [PubMed]
  7. Costa-Orlandi, C.B.; Sardi, J.C.O.; Pitangui, N.S.; de Oliveira, H.C.; Scorzoni, L.; Galeane, M.C.; Medina-Alarcón, K.P.; Melo, W.C.M.A.; Marcelino, M.Y.; Braz, J.D.; et al. Fungal Biofilms and Polymicrobial Diseases. J. Fungi 2017, 3, 22. [Google Scholar] [CrossRef] [PubMed]
  8. Fanning, S.; Mitchell, A.P. Fungal biofilms. PLoS Pathog. 2012, 8, e1002585. [Google Scholar] [CrossRef] [PubMed]
  9. Mowat, E.; Butcher, J.; Lang, S.; Williams, C.; Ramage, G. Development of a simple model for studying the effects of antifungal agents on multicellular communities of Aspergillus fumigatus. J. Med. Microbiol. 2007, 56, 1205–1212. [Google Scholar] [CrossRef]
  10. Blankenship, J.R.; Mitchell, A.P. How to build a biofilm: A fungal perspective. Curr. Opin. Microbiol. 2006, 9, 588–594. [Google Scholar] [CrossRef]
  11. Finkel, J.S.; Mitchell, A.P. Genetic control of Candida albicans biofilm development. Nat. Rev. Microbiol. 2011, 9, 109–118. [Google Scholar] [CrossRef] [PubMed]
  12. Lopez-Ribot, J.L. Candida albicans biofilms: More than filamentation. Curr. Biol. 2005, 15, 453–455. [Google Scholar] [CrossRef] [PubMed]
  13. Tobudic, S.; Kratzer, C.; Lassnigg, A.; Presterl, E. Antifungal susceptibility of Candida albicans in biofilms. Mycoses 2012, 55, 199–204. [Google Scholar] [CrossRef] [PubMed]
  14. Inigo, M.; Peman, J.; Del, P.J. Antifungal activity against Candida biofilms. Int. J. Artif. Organs. 2012, 35, 780–791. [Google Scholar] [CrossRef] [PubMed]
  15. Kim, C.; Kim, J.; Kim, K.Y. Anti-Candida Potential of Sclareol in Inhibiting Growth, Biofilm Formation, and Yeast–Hyphal Transition. J. Fungi 2023, 9, 98. [Google Scholar] [CrossRef] [PubMed]
  16. Hancock, R.E.W.; Sahl, H.-G. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies. Nat. Biotechnol. 2006, 24, 1551–1557. [Google Scholar] [CrossRef]
  17. Fox, J.L. Antimicrobial peptides stage a comeback. Nat. Biotechnol. 2013, 31, 379–382. [Google Scholar] [CrossRef] [PubMed]
  18. Nuijens, J.H.; van Berkel, P.H.; Schanbacher, F.L. Structure and biological actions of lactoferrin. J. Mammary Gland. Biol. Neoplasia 1996, 1, 285–295. [Google Scholar] [CrossRef]
  19. Harvey, A.L. Natural products in drug discovery. Drug Discov. Today 2008, 13, 894–901. [Google Scholar] [CrossRef]
  20. Shang, Z.P.; Wang, F.; Zhang, J.Y.; Wang, Z.J.; Lu, J.Q.; Wang, H.Y.; Li, N. The genus Liriope: Phytochemistry and pharmacology. Chin. J. Nat. Med. 2017, 15, 801–815. [Google Scholar] [CrossRef]
  21. Li, W.J.; Cheng, X.L.; Liu, J.; Lin, R.C.; Wang, G.L.; Du, S.S.; Liu, Z.L. Phenolic compounds and antioxidant activities of Liriope muscari. Molecules 2012, 17, 1797–1808. [Google Scholar] [CrossRef] [PubMed]
  22. Tian, Y.; Ma, S.; Lin, B.; Kou, J.; Yu, B. Anti-thrombotic activity of DT-13, a saponin isolated from the root tuber of Liripo muscrai. India J. Pharmacol. 2013, 45, 283–285. [Google Scholar] [CrossRef] [PubMed]
  23. Ma, S.; Kou, J.; Yu, B. Safety evaluation of steroidal saponin DT-13 isolated from the tuber of Liriope muscari (Decne.) Baily. Food Chem. Toxicol. 2011, 49, 2243–2251. [Google Scholar] [CrossRef] [PubMed]
  24. Zhang, Y.Y.; Liu, J.H.; Kou, J.P.; Yu, J.; Yu, B.Y. DT-13, a steroidal saponin from Liriope muscari LH Bailey, suppresses A549 cells adhesion and invasion by inhibiting MMP-2/9. Chin. J. Nat. Med. 2012, 10, 436–440. [Google Scholar] [CrossRef]
  25. Biswas, S.; Van Dijck, P.; Datta, A. Environmental Sensing and Signal Transduction Pathways Regulating Morphopathogenic Determinants of Candida albicans. Microbiol. Mol. Biol. Rev. 2007, 71, 348–376. [Google Scholar] [CrossRef] [PubMed]
  26. Jadhav, A.K.; Bhan, A.; Jangid, P.; Patil, R.; Gade, W.; Karuppayil, S.M. Modulation of Genes Involved in Yeast to Hyphal form Signal Transduction in Candida albicans by Indole and Isatin. Curr. Signal Transduct. Ther. 2017, 12, 116–123. [Google Scholar] [CrossRef]
  27. Sun, L.; Liao, K.; Wang, D. Effects of magnolol and honokiol on adhesion, yeast-hyphal transition, and formation of biofilm by Candida albicans. PLoS ONE 2015, 10, e0117695. [Google Scholar] [CrossRef]
  28. Wu, J.; Wu, D.; Zhao, Y.; Si, Y.; Mei, L.; Shao, J.; Wang, C. Sodium new houttuyfonate inhibits Candida albicans biofilm formation by inhibiting the Ras1-cAMP-Efg1 pathway revealed by RNA-seq. Front. Microbiol. 2020, 11, 2075. [Google Scholar] [CrossRef]
  29. Douglas, L.J. Candida biofilms and their role in infection. Trends Microbiol. 2003, 11, 30–36. [Google Scholar] [CrossRef]
  30. Hasan, F.; Xess, I.; Wang, X.; Jain, N.; Fries, B.C. Biofilm formation in clinical Candida isolates and its association with virulence. Microbes Infect. 2009, 11, 753–761. [Google Scholar] [CrossRef]
  31. Donlan, R.M.; Costerton, J.W. Biofilms: Survival mechanisms of clinically relevant microorganisms. Clin. Microbiol. Rev. 2002, 15, 167–193. [Google Scholar] [CrossRef] [PubMed]
  32. Viudes, A.; Peman, J.; Canton, E.; Ubeda, P.; Lopez-Ribot, J.L.; Gobernado, M. Candidemia at a tertiary-care hospital: Epidemiology, treatment, clinical outcome and risk factors for death. Eur. J. Clin. Microbiol. Infect. Dis. 2002, 21, 767–774. [Google Scholar] [CrossRef] [PubMed]
  33. Woodford, N.; Ellington, M.J. The emergence of antibiotic resistance by mutation. Clin. Microbiol. Infect. 2007, 13, 5–18. [Google Scholar] [CrossRef] [PubMed]
  34. Ramage, G.; VandeWalle, K.; Lopez-Ribot, J.L.; Wickes, B.L. The filamentation pathway controlled by the Efg1 regulator protein is required for normal biofilm formation and development in Candida albicans. FEMS Microbiol. Lett. 2002, 214, 95–100. [Google Scholar] [CrossRef] [PubMed]
  35. Leberer, E.; Harcus, D.; Dignard, D.; Johnson, L.; Ushinsky, S.; Thomas, D.Y. Ras links cellular morphogenesis to virulence by regulation of the MAP kinase and cAMP signalling pathways in the pathogenic fungus Candida albicans. Mol. Microbiol. 2001, 42, 673–687. [Google Scholar] [CrossRef] [PubMed]
  36. Tronchin, G.; Pihet, M.; Lopes-Bezerra, L.M.; Bouchara, J.-P. Adherence mechanisms in human pathogenic fungi. Med. Mycol. 2008, 46, 749–772. [Google Scholar] [CrossRef] [PubMed]
  37. Staab, J.F.; Bradway, S.D.; Fidel, P.L.; Sundstrom, P. Adhesive and mammalian transglutaminase substrate properties of Candida albicans Hwp1. Science 1999, 283, 1535–1538. [Google Scholar] [CrossRef]
  38. Nobile, C.J.; Nett, J.E.; Andes, D.R.; Mitchell, A.P. Function of Candida albicans adhesin hwp1 in biofilm formation. Eukaryot. Cell 2006, 5, 1604–1610. [Google Scholar] [CrossRef] [PubMed]
  39. Hogan, D.A.; Sundstrom, P. The Ras/cAMP/PKA signaling pathway and virulence in Candida albicans. Future Microbiol. 2009, 4, 1263–1270. [Google Scholar] [CrossRef]
  40. Lane, S.; Zhou, S.; Pan, T.; Dai, Q.; Liu, H. The basic helix-loop-helix transcription factor Cph2 regulates hyphal development in Candida albicans partly via TEC1. Mol. Cell. Biol. 2001, 21, 6418–6428. [Google Scholar] [CrossRef]
  41. Al Fattani, M.A.; Douglas, L.J. Biofilm matrix of Candida albicans and Candida tropicalis: Chemical composition and role in drug resistance. J. Med. Microbiol. 2006, 55, 999–1008. [Google Scholar] [CrossRef] [PubMed]
  42. Taff, H.T.; Nett, J.E.; Zarnowski, R.; Ross, K.M.; Sanchez, H.; Cain, M.T. A Candida Biofilm-Induced Pathway for Matrix Glucan Delivery: Implications for Drug Resistance. PLoS Pathog. 2012, 8, e1002848. [Google Scholar] [CrossRef] [PubMed]
  43. Nobile, C.J.; Nett, J.E.; Hernday, A.D.; Homann, O.R.; Deneault, J.S.; Nantel, A. Biofilm matrix regulation by Candida albicans Zap1. PLoS Biol. 2009, 7, e1000133. [Google Scholar] [CrossRef] [PubMed]
  44. Kim, M.J.; Kil, M.; Jung, J.H.; Kim, J. Roles of zinc-responsive transcription factor Csr1 in filamentous growth of the pathogenic yeast Candida albicans. J. Microbiol. Biotechnol. 2008, 18, 242–247. [Google Scholar] [PubMed]
  45. Wang, Z. Antioxidant Activities of Extracts from Ophiopogon japonicus. Food Ferment Ind. 2007, 33, 57. [Google Scholar]
  46. Li, Y.W.; Qi, J.; Zhang, Y.Y.; Huang, Z.; Kou, J.P.; Zhou, S.P.; Yu, B.Y. Novel cytotoxic steroidal glycosides from the roots of Liriope muscari. Chin. J. Nat. Med. 2015, 13, 461–466. [Google Scholar] [CrossRef] [PubMed]
  47. Richardson, J.P. Candida albicans: A major fungal pathogen of humans. Pathogens 2022, 11, 459. [Google Scholar] [CrossRef] [PubMed]
  48. Hazen, K.C. Influence of DMSO on antifungal activity during susceptibility testing in vitro. Diagn. Microbiol. Infect. Dis. 2013, 75, 60–63. [Google Scholar] [CrossRef]
  49. Dhale, R.P.; Ghorpade, M.V.; Dharmadhikari, C.A. Comparison of various methods used to detect biofilm production of Candida species. J. Clin. Diagn. Res. 2014, 8, DC18–DC20. [Google Scholar] [CrossRef]
  50. Kim, D.; Kim, K.Y. Adenophora triphylla var. japonica inhibits Candida biofilm formation, increases susceptibility to antifungal agents and reduces infection. Int. J. Mol. Sci. 2021, 22, 12523. [Google Scholar] [CrossRef]
  51. Toenjes, K.A.; Munsee, S.M.; Ibrahim, A.S.; Jeffrey, R.; Edwards, J.J. Small-molecule inhibitors of the budded-to-hyphal-form transition in the pathogenic yeast Candida albicans. Antimicrob. Agents Chemother. 2005, 49, 963–972. [Google Scholar] [CrossRef] [PubMed]
  52. Kim, D.; Kim, K.Y. Hedera rhombea inhibits the biofilm formation of Candida, thereby increases the susceptibility to antifungal agent, and reduces infection. PLoS ONE 2021, 16, e0258108. [Google Scholar] [CrossRef] [PubMed]
  53. Kim, J.; Bao, T.H.Q.; Shin, Y.K.; Kim, K.Y. Antifungal activity of magnoflorine against Candida strains. World J. Microbiol. Biotechnol. 2018, 34, 167. [Google Scholar] [CrossRef]
Antibiotics 13 00434 g001
Figure 1. L. muscari extract inhibited biofilm formation. (***: p-value < 0.001).
Figure 1. L. muscari extract inhibited biofilm formation. (***: p-value < 0.001).
Antibiotics 13 00434 g001
Antibiotics 13 00434 g002
Figure 2. L. muscari increased the susceptibility of MCZ to C. albicans. Biofilms of C. albicans were formed after 24 h of incubation in YPD followed by 24 h of treatment with MCZ (3.125 μg/mL) alone or in combination with L. muscari (1.56 and 6.25 μg/mL). MCZ: Miconazole, LM: L. muscari extract. (***: p-value < 0.001).
Figure 2. L. muscari increased the susceptibility of MCZ to C. albicans. Biofilms of C. albicans were formed after 24 h of incubation in YPD followed by 24 h of treatment with MCZ (3.125 μg/mL) alone or in combination with L. muscari (1.56 and 6.25 μg/mL). MCZ: Miconazole, LM: L. muscari extract. (***: p-value < 0.001).
Antibiotics 13 00434 g002
Antibiotics 13 00434 g003aAntibiotics 13 00434 g003b
Figure 3. L. muscari inhibited the transition of C. albicans from yeast to hyphae. (a) L. muscari inhibited C. albicans filamentation induced in RPMI 1640. C. albicans (1 × 106 cells/mL) and L. muscari (1.56, 6.25, and 25 μg/mL) were incubated at 37 °C for 4 h. (b) Images of C. albicans cells grown in RPMI 1640. L. muscari was added at concentrations of 1.56, 6.25, and 25 μg/mL. A: RPMI 1640 control, B: L. muscari 1.56 μg/mL, C: L. muscari 6.25 μg/mL, D: L. muscari 25 μg/mL. (c) L. muscari inhibited C. albicans filamentation induced in 10% FBS YPD medium. C. albicans (1 × 106 cells/mL) and L. muscari (1.56, 6.25, and 25 μg/mL) were incubated at 37 °C for 4 h. (d) Images of C. albicans cells incubated in 10% FBS YPD medium. L. muscari was added at concentrations of 1.56, 6.25, and 25 μg/mL. A: 10% FBS YPD control, B: L. muscari 1.56 μg/mL, C: L. muscari 6.25 μg/mL, D: L. muscari 25 μg/mL. Scale bar: 200 μm. (***: p-value < 0.001).
Figure 3. L. muscari inhibited the transition of C. albicans from yeast to hyphae. (a) L. muscari inhibited C. albicans filamentation induced in RPMI 1640. C. albicans (1 × 106 cells/mL) and L. muscari (1.56, 6.25, and 25 μg/mL) were incubated at 37 °C for 4 h. (b) Images of C. albicans cells grown in RPMI 1640. L. muscari was added at concentrations of 1.56, 6.25, and 25 μg/mL. A: RPMI 1640 control, B: L. muscari 1.56 μg/mL, C: L. muscari 6.25 μg/mL, D: L. muscari 25 μg/mL. (c) L. muscari inhibited C. albicans filamentation induced in 10% FBS YPD medium. C. albicans (1 × 106 cells/mL) and L. muscari (1.56, 6.25, and 25 μg/mL) were incubated at 37 °C for 4 h. (d) Images of C. albicans cells incubated in 10% FBS YPD medium. L. muscari was added at concentrations of 1.56, 6.25, and 25 μg/mL. A: 10% FBS YPD control, B: L. muscari 1.56 μg/mL, C: L. muscari 6.25 μg/mL, D: L. muscari 25 μg/mL. Scale bar: 200 μm. (***: p-value < 0.001).
Antibiotics 13 00434 g003aAntibiotics 13 00434 g003b
Antibiotics 13 00434 g004aAntibiotics 13 00434 g004b
Figure 4. L. muscari decreased the expression of genes for hyphae-specific regulation, extracellular matrix, Ras1-cAMP-Efg1, MAP kinase, and Cph2-Tec1 in C. albicans. (a) Relative expression of genes regulating hyphae-specific genes. (b) Relative expression of genes regulated by the Ras1-cAMP-Efg1 pathway. (c) Relative expression of genes regulating extracellular matrix genes. (d) Relative expression of genes related to the Cph2-Tec1 pathway and the MAP kinase pathway. Total RNA was extracted from C. albicans, including control and biofilms treated with the indicated concentrations of L. muscari, synthesized cDNA, and examined by qPCR using the corresponding primers. (*: p-value <0.05, ***: p-value < 0.001).
Figure 4. L. muscari decreased the expression of genes for hyphae-specific regulation, extracellular matrix, Ras1-cAMP-Efg1, MAP kinase, and Cph2-Tec1 in C. albicans. (a) Relative expression of genes regulating hyphae-specific genes. (b) Relative expression of genes regulated by the Ras1-cAMP-Efg1 pathway. (c) Relative expression of genes regulating extracellular matrix genes. (d) Relative expression of genes related to the Cph2-Tec1 pathway and the MAP kinase pathway. Total RNA was extracted from C. albicans, including control and biofilms treated with the indicated concentrations of L. muscari, synthesized cDNA, and examined by qPCR using the corresponding primers. (*: p-value <0.05, ***: p-value < 0.001).
Antibiotics 13 00434 g004aAntibiotics 13 00434 g004b
Antibiotics 13 00434 g005
Figure 5. L. muscari lacks the ability to inhibit the growth of C. albicans.
Figure 5. L. muscari lacks the ability to inhibit the growth of C. albicans.
Antibiotics 13 00434 g005
Table 1. Primer list used in this paper.
Table 1. Primer list used in this paper.
PrimersPrimer SequenceGene Function
ACT 1F: TAGGTTTGGAAGCTGCTGG
R: CCTGGGAACATGGTAGTAC		Control
ALS 3F: GGTTATCGTCCATTTGTTG
R: TTCTGTATCCAGTCCATCT		Hyphal-specific genes
CYR 1F: GTTTCCCCCACCACTCA
R: TTGCGGTAATGACACAACAG		Ras-cAMP-Efg1 pathway
ECE 1F: ACAGTTTCCAGGACGCCAT
R: ATTGTTGCTCGTGTTGCCA		Hyphal-specific genes
EFG 1F: TTGAGATGTTGCGGCAGGAT
R: ACTGGACAGACAGCAGGAC		Ras-cAMP-Efg1 pathway
GSC 1F: CCCATTCTCTAGGCACGA
R: ATCAACAACCACTTGCTTCG		Extracellular matrix
HST 7F: GCCAGTATGGTCGGAGGAT
R: ACATAGGCATCGTCTTCGTC		MAP kinases pathway
HWP 1F: ACAGGTAGACGGTCAAGG
R: GGGTAATCATCACATGGTTC		Ras-cAMP-Efg1 pathway
RAS 1F: GAGGTGGTGGTGTTGGTA
R: TCTTCTTGTCCAGCAGTATC		Cph2-Tec1 pathway
TEC 1F: GCACTGGCTTCAAGCTCAAA
R: GCTGCTGCACTCAAGTTCTG		Extracellular matrix
ZAP 1F: ATCTGTCCAGTGTTGTTTGTA
R: AGGTCTCTTTGAAAGTTGTG		Extracellular matrix
ADH 5F: ACCTGCAAGGGCTCATTCTG
R: CGGCTCTCAACTTCTCCATA		Extracellular matrix
CSH 1F: CGTGAGGACGAGAGAGAAT
R: CGAATGGACGACACAAAACA		Extracellular matrix
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lee, J.; Song, H.; Kim, K. Inhibition of Candida albicans Biofilm Formation and Attenuation of Its Virulence by Liriope muscari. Antibiotics 2024, 13, 434. https://doi.org/10.3390/antibiotics13050434

AMA Style

Lee J, Song H, Kim K. Inhibition of Candida albicans Biofilm Formation and Attenuation of Its Virulence by Liriope muscari. Antibiotics. 2024; 13(5):434. https://doi.org/10.3390/antibiotics13050434

Chicago/Turabian Style

Lee, Jeonghoon, Hyunchan Song, and Kiyoung Kim. 2024. "Inhibition of Candida albicans Biofilm Formation and Attenuation of Its Virulence by Liriope muscari" Antibiotics 13, no. 5: 434. https://doi.org/10.3390/antibiotics13050434

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop