Next Article in Journal
The Role of Glial Cells in Neurobiology and Prion Neuropathology
Previous Article in Journal
Generation of Rhesus Macaque Embryos with Expanded CAG Trinucleotide Repeats in the Huntingtin Gene
Previous Article in Special Issue
Recent Insights into the Role of PPARs in Disease
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 13
Issue 10
10.3390/cells13100831
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CBFA2T3 Is PPARA Sensitive and Attenuates Fasting-Induced Lipid Accumulation in Mouse Liver

by
Donghwan Kim
1,2,*,
Sang Keun Ha
1,3 and
Frank J. Gonzalez
2
1
Division of Functional Food Research, Korea Food Research Institute, Wanju-gun 55365, Republic of Korea
2
Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892, USA
3
Division of Food Biotechnology, University of Science and Technology, Daejeon 34113, Republic of Korea
*
Author to whom correspondence should be addressed.
Cells 2024, 13(10), 831; https://doi.org/10.3390/cells13100831
Submission received: 9 April 2024 / Revised: 10 May 2024 / Accepted: 10 May 2024 / Published: 13 May 2024
(This article belongs to the Special Issue The Role of PPARs in Disease - Volume III)
Browse Figures
Versions Notes

Abstract

:
Peroxisome proliferator-activated receptor alpha (PPARA) is a ligand-activated transcription factor that is a key mediator of lipid metabolism and metabolic stress in the liver. Accumulating evidence shows that PPARA regulates the expression of various protein coding and non-coding genes that modulate metabolic stress in the liver. CBFA2/RUNX1 partner transcriptional co-repressor 3 (CBFA2T3) is a DNA-binding transcription factor that belongs to the myeloid translocation gene family. Many studies have shown that CBFA2T3 is associated with acute myeloid leukemia. Especially, CBFA2T3–GLIS2 fusion is a chimeric oncogene associated with a poor survival rate in pediatric acute megakaryocytic leukemia. A previous study identified that PPARA activation promoted Cbfa2t3 induction in liver and that Cbfa2t3 may have a modulatory role in metabolic stress. However, the effect of CBFA2T3 gene expression on metabolic stress is not understood. In this study, the PPARA ligand WY14643 activated Cbfa2t3 expression in mouse liver. Glucose tolerance test and insulin tolerance test data showed that insulin resistance is increased in Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice. Hepatic CBFA2T3 modulates heat shock protein family A member 1b and carbonic anhydrase 5a expression. Histology analysis revealed lipid droplet and lipid accumulation in the liver of fasting Cbfa2t3−/− mice but not Cbfa2t3+/+ mice. The expression of lipid accumulation-related genes, such as Cd36, Cidea, and Fabp1, was increased in the liver of fasting Cbfa2t3−/− mice. Especially, basal expression levels of Cidea mRNA were elevated in the liver of Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice. Much higher induction of Cidea mRNA was seen in the liver of Cbfa2t3−/− mice after WY14643 administration. These results indicate that hepatic CBFA2T3 is a PPARA-sensitive gene that may modulate metabolic stress in mouse liver.

1. Introduction

CBFA2/RUNX1 partner transcriptional corepressor 3 (CBFA2T3) belongs to the CBFA family, which consists of CBFA2T1 (also known as RUNX1T1), CBFA2T2, and CBFA2T3 [1]. CBFA2T3, also known as MTG16 or ETO2, belongs to the myeloid translocation gene family, which binds to DNA-bound transcription factors and recruits corepressors to facilitate transcriptional repression [2]. Cbfa2t3−/− mice have no anatomical or developmental abnormalities suggesting possible functional redundancy between CBFA2T3 family members [3]. However, CBFA2T3 is important for the regulation of hematopoietic stem/progenitor cell proliferation and differentiation [2]. CBFA2T3 expression levels are elevated in lymphoid and myeloid based cell lines, and genetic CBFA2T3 fusion with RUNX1 or GLIS2 accelerates acute myeloid leukemia and megakaryoblastic leukemia [4]. Especially, CBFA2T3–GLIS2 fusion is a most common phenotype in pediatric (not adult) acute myeloid leukemia that is associated with a poor clinical outcome [5]. Therefore, many studies about AML in pediatrics have focused on the CBFA2T3–GLIS2 fusion [6].
Cbfa2t3−/− mice have a lower number of B-lymphocytes and megakaryocytic erythroid progenitors concurrent with an increased proportion of granulocytic monocytic progenitors compared with Cbfa2t3+/+ mice [2]. A recent study showed that CBFA2T3 is a key factor for cell fate decisions under colonic homeostasis, which modulates colitis and colon tumorigenesis by inhibiting E protein transcription factors [7]. CBFA2T3 suppresses hypoxia-inducible factor 1 alpha (HIF1A) through proteasome pathway activation by directly interacting with HIF1A in B-lymphoblastic Raji cells [8]. CBFA2T3 gene expression is elevated in lung adenocarcinoma cell lines A549 and H2122, and CBFA2T3 has been identified as potential tumor antigens for mRNA vaccine development in lung adenocarcinoma [9,10]. CBFA2T3 overexpression suppresses MED19 levels and inhibits breast cancer cell proliferation in MCF-7 and MDA-MB-231 cells [11].
Peroxisome proliferation activated receptor α (PPARA) is a key mediator of hepatic lipid metabolism through activation of genes involved in lipid catabolism and transport [12]. PPARA activation modulates fatty acid oxidation and protects the liver from fasting-induced metabolic stress [13]. WY14632 is an exogenous PPARA ligand that modulates inflammation, lipid metabolism, cell proliferation and signaling pathways [14]. RNA sequencing analysis from the liver of PPARA ligand WY14643 treated mice revealed many potential PPARA target genes transcribed in response to PPARA activation [15]. Highly liver specific PPARA target long non-coding RNA GM15441 and G23RIK expression were elevated by PPARA activation, which modulated the metabolic stress induced by WY14643 and fasting in liver [16,17]. Especially, PPARA activation suppressed fasting-induced metabolic stress through its target gene activation [13,16,17].
Interestingly, Cbfa2t3 expression was elevated by PPARA activation by WY14643 administration and Cbfa2t3 may play a role in metabolic remodeling [16]. However, the modulation of metabolic stress by CBFA2T3 is unknown. In the present study, the basal expression level of hepatic CBFA2T3 was low but highly induced by WY14643; this induction did not occur in Ppara−/− mice. In wild-type mice, PPARA induced mRNAs encoding heat shock protein family A member 1B (HSPA1B) and carbonic anhydrase 5a (CAR5A) mRNA expression while Hspa1b and Car5a mRNA expression remained at a control state in Cbfa2t3−/− mice. Fasting significantly induced hepatic Cbfa2t3 mRNA expression and this was not observed in Ppara−/− mice. Lipid accumulation was increased in Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice along with lipid accumulation-related gene activation such as cell death-inducing DNA fragmentation factor alpha subunit-like effector A (Cidea), cluster of differentiation 36 (Cd36) and fatty acid binding protein 1 (Fabp1) mRNAs. Especially, the basal expression level of Cidea mRNA was elevated in the liver of Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice, and the induction of Cidea mRNA expression in the liver by WY14643 administration was highly elevated in Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice. CBFA2T3 is a PPARA-sensitive gene that modulates metabolic stress in mouse liver.

2. Materials and Methods

2.1. In Vivo Models

Male 8-to-12-weeks old mice on the C57BL/6J background were used for all studies. Ppara+/+ male mice and conventional Ppara−/− male mice used in this study were previously reported [18]. For WY14643 administration, the mice were supplied a NIH-31 diet or matched WY14643-containing NIH-31 diet (0.1%) for 2 days. For monitoring the gene response to PPARA activation in liver, WY14643 (50 mg/kg in 200 µL) dissolved in 1% carboxymethyl cellulose (CMC) was administered by gavage at the indicated time points. At the indicated time points, mice were euthanized by CO2 asphyxiation and then their tissues were harvested. The Cbfa2t3+/+ male mice and Cbfa2t3−/− male mice used in this study were reported previously [2]. Mice were housed in light (12 h light: 12 h darkness cycle) and temperature-controlled rooms (humidity 40–60%) and were provided with water and pelleted chow ad libitum. Mice were euthanized by CO2 and tissue samples were harvested. Blood was collected by venipuncture of the caudal vena cava. All animal experiments were performed in accordance with Assessment and Accreditation of Laboratory Animal Care International Guidelines Association and approved by the National Cancer Institute Animal Care and Use Committee (LM-085).

2.2. Blood Serum Biochemistry

BD Microtainer Serum Separator Tubes were used to collect blood from mice (Becton Dickinson, Franklin Lakes, NJ, USA). Blood serum analysis for total cholesterol (CHOL), triglycerides (TG), and non-esterified fatty acids (NEFA) was performed using Wako Clinical Diagnostics kits (WakoUSA, Richmond, VA, USA). Catachem VETSPEC Kits were used to analyze serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels according to the manufacturer’s recommended instructions (Catachem, Oxford, CT, USA).

2.3. Histological Analysis

Fresh liver tissue was fixed in 10% phosphate-buffered formalin for 1 day and then processed in paraffin blocks. Sections of 4 μm were used for hematoxylin and eosin (H&E) staining. For Oil Red O (ORO) staining, fresh liver pieces were placed in a standard cryomold and covered with OCT Compound (Tissue-Tek, Sakura Finetek, Torrance, CA, USA), then stored at −80 °C. Sectioning and staining were performed by HistoServ, Inc. (Germantown, MD, USA). Slide imaging was analyzed using a Keyence BZ-X700 microscope (Keyence, Osaka, Japan) with 20× objectives, 200× magnification. The quantified lipid droplet area was analyzed using ImageJ software 1.54g (NIH, Bethesda, MD, USA).

2.4. Gene Expression Analysis by qRT-PCR

Fresh liver tissues were homogenized and total RNA extracted using TRIzol (Thermo Fisher Scientific, Waltham, MA, USA). Total RNA was quantified using a NanoDrop Spectrophotometer (NanoDrop Products, Wilmington, DE, USA), then 2 μg of RNA was reverse transcribed by All-in-One cDNA Synthesis SuperMix (BioTool, Houston, TX, USA). SYBR Green qPCR Master Mix (BioTool) was used for the qRT-PCR analysis. Primer-BLAST was used to design specific mRNA primers (www.ncbi.nlm.nih.gov/tools/primer-blast/) and they were purchased from IDT DNA Technologies (Coralville, IA, USA) (Table 1). The qRT-PCR results were normalized to Gapdh. Values given are fold over control or relative expression value, where appropriate, calculated using the 2−ΔΔCt qRT-PCR calculation method [19].

2.5. Metabolic Analysis

For the glucose tolerance tests (GTT), mice were fasted for 16 h. For the insulin tolerance tests (ITT), the mice were fasted for 4 h. Glucose at 2 g/kg or insulin (Eli Lilly, Washington, DC, USA) at 0.8 U/kg in saline were intraperitoneally injected and blood glucose measured from tail bleeds using a Contour Glucometer (Bayer, Mishawaka, IN, USA). Blood glucose was measured before the injection and at intervals of 15 min up to 2 h post injection using the glucometer.

2.6. Statistical Analysis

All data are expressed as mean ± standard deviation. Significance was tested by t-tests using Prism 10.0 software (GraphPad Software, La Jolla, CA, USA). Differences were considered statistically significant at a p value less than 0.05. * p < 0.05; ** p < 0.01; *** p < 0.001.

3. Results

3.1. Hepatic Cbfa2t3 Is Induced by PPARA

Basal expression of Cbfa2t3 mRNA was most highly elevated in lung, heart, and brown adipose tissue (BAT) (Figure 1A). To verify the effect of PPARA activation on Cbfa2t3 expression and its tissue specificity, Ppara+/+ and Ppara−/− mice were given WY14643 for 2 days, and seven tissues were harvested. Cbfa2t3 mRNA was significantly induced in the liver by WY14643 while no induction was found in Ppara−/− mice (Figure 1B). No significant activation was identified in the six other tissues, suggesting that Cbfa2t3 expression is consistent with the tissue specificity of PPARA expression and activity (Figure 1B).
To monitor the Cbfa2t3 gene response to PPARA activation, a single dose of WY14643 was given to mice by gavage. In the liver, Cbfa2t3 induction was rapidly detected at 1.5 h and maximum expression of Cbfa2t3 mRNA was identified 12 h after WY14632 administration (Figure 1C). RNA-seq analysis showed that heat shock protein family A member 1b (Hspa1b) and carbonic anhydrase 5a (Car5a) transcript levels were modulated by PPARA activation [16]. qRT-PCR results showed that PPARA also activated the expression of Hspa1b mRNA and repressed Car5a mRNA in liver (Figure 1D). These data indicate that hepatic Cbfa2t3 is a PPARA-sensitive gene, indicating that Cbfa2t3 may play a role in metabolic remodeling.

3.2. Cbfa2t3 Modulates Glucose Metabolism and Insulin Sensitivity

PPARA is a major regulator of lipid homeostasis and its target genes encode enzymes and transporters that have a critical regulatory role in controlling lipid and glucose homeostasis [16,17]. Previous data showed that Cbfa2t3 induction was seen after PPARA activation, suggesting Cbfa2t3 may have a modulatory role on metabolic stress in liver (Figure 1B,C).
To explore the role of Cbfa2t3 in glucose metabolism and insulin sensitivity, GTT and ITT were performed in Cbfa2t3+/+ and Cbfa2t3−/− mice. GTT results showed that blood glucose levels were increased in Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice (Figure 2A). ITT results also showed that blood glucose levels were increased after injection of 0.8 U/kg insulin, which was clearly marked in Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice (Figure 2B). These data suggest that Cbfa2t3 modulates metabolic stress (Figure 2A,B).

3.3. Impact of Cbfa2t3 Deficiency in the Liver

GTT and ITT results showed that higher glucose tolerance and insulin sensitivity were seen in Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice. To explore the role of Cbfa2t3 in metabolic stress in liver, WY14643 was administrated for 2 days and then the phenotype and gene expression response in Cbfa2t3+/+ mice and Cbfa2t3−/− mice was verified. A discernable difference regarding the liver index (mg liver/g total body mass) and total body weight loss was not observed between Cbfa2t3+/+ and Cbfa2t3−/− mice with and without WY14643 treatment (Figure 3A). Levels of triglyceride (TG) and cholesterol (CHOL) in liver were decreased by WY14643 administration, but no differences in TG and CHOL were observed between the Cbfa2t3+/+ and Cbfa2t3−/− mice (Figure 3B). Hepatic Cbfa2t3 mRNA expression was significantly increased in Cbfa2t3+/+ mice after WY14643 administration while no induction was observed in Cbfa2t3−/− liver; expression of Cyp4a14 mRNA, a classic PPARA target gene, was elevated in both Cbfa2t3+/+ and Cbfa2t3−/− mouse lines (Figure 3C). Hspa1b mRNA expression was increased in Cbfa2t3+/+ livers but not in livers of Cbfa2t3−/− mice (Figure 3D). In contrast, Car5a mRNA levels were repressed by WY14643 and repressed Car5a levels were recovered in WY14643-treated Cbfa2t3−/− mice (Figure 3D). These data suggest that PPARA is differentially regulated by Hspa1b and Car5a and regulated by CBFA2T3.

3.4. Cbfa2t3 Attenuates Fasting-Induced Lipid Accumulation

PPARA activation during fasting promotes metabolic remodeling that accelerates the use of lipids as an alternate energy source with hepatosteatosis reduction [13]. To investigate whether CBFA2T3 attenuates the fasting-induced liver stress response, Cbfa2t3+/+ and Cbfa2t3−/− mice were fasted for 24 h. A discernable difference in the liver index and body weight were not observed between fasted Cbfa2t3+/+ and Cbfa2t3−/− mice (Figure 4A). Hepatic Cbfa2t3 mRNA was significantly elevated in fasting Cbfa2t3+/+ mice and not detected in Cbfa2t3−/− mice (Figure 4B). Additionally, lower expression of Cbfa2t3 mRNA was identified following WY14643 administration (c.f., Figure 3C). Cy4a14 is a classic PPARA target and its mRNA expression was increased in liver of fasted Cbfa2t3+/+ and Cbfa2t3−/− mice (Figure 4B). Interestingly induction of Cyp4a14 mRNA expression was seen in Cbfa2t3−/− mice (Figure 4B). The fasting responses of Hspa1b and Car5a mRNA expression were similar after WY14643 treatment (Figure 4B c.f., Figure 1D).
Liver lipid droplets as revealed by H&E were widespread in fasted Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice (Figure 4C). Oil Red O staining revealed a greater lipid accumulation response to fasting liver in Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice (Figure 4C). CHOL levels were elevated in Cbfa2t3−/− serum and liver and increased in fasted Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice (Figure 4D). NEFA levels in serum and liver were increased in Cbfa2t3−/−, while no difference between fasting Cbfa2t3+/+ and Cbfa2t3−/− mice was observed (Figure 4D). TG levels in serum were elevated in Cbfa2t3−/− mice. Liver TG levels were elevated in Cbfa2t3−/−, fasted Cbfa2t3+/+ and Cbfa2t3−/− mice (Figure 4D).
Furthermore, induction of Cd36, Cidea, and Fabp1 mRNAs were identified in 24 h fasted Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice (Figure 4E). Induction of lipid accumulation-related genes such as diacylglycerol O-acyltransferase 2 (Dgat2), fatty acid binding protein 4 (Fabp4), apolipoprotein B (ApoB) and microsomal triglyceride transfer protein (Mttp) [16] was not observed in Cbfa2t3−/− mice compared to Cbfa2t3+/+ (Figure 4E). Cd36 and Cidea mRNA expression levels were increased by WY14643 administration in the liver of Ppara+/+ and completely abolished in the liver of Ppara−/− mice (Figure 4F). However, basal expression levels of Cidea mRNA were increased in Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice (Figure 4F). Interestingly, induction of Cidea mRNA expression was significantly elevated in Cbfa2t3−/− liver compared to Cbfa2t3+/+ liver, suggesting Cbfa2t3 might modulate lipid accumulation though Cidea regulation under metabolic stress in liver (Figure 4F). These results suggest that Cbfa2t3 may have a modulatory role in the hepatic fasting response mediated by PPARA.

4. Discussion

CBFA2T3 is a member of a transcriptional corepressor family that modulates progenitor cell self-renewal, lineage commitment, and T-cell development [20]. Fusion genes with CBFA2T3–RUNX1 or GBFA2T3–GLIS2 results in an extremely aggressive leukemia phenotype [21]. In cancer studies, CBFA2T3 has anti-cancer properties in azoxymethane/dextran sulfate sodium-induced colon tumorigenesis and anti-proliferative activity in human breast cancer cells [7,11]. Pharmacological and physiological PPARA activation by WY14643 and fasting are important regulatory mechanisms of lipid and glucose homeostasis [16]. PPARA regulates metabolic remodeling, inflammation, and hepatocyte proliferation by modulating various target gene’s expression [15]. Prolonged PPARA activation promotes hepatocyte proliferation by activation of keratin 23, a PPARA-dependent MYC-amplified oncogene [15]. PPARA activation promotes TXNIP antisense lncRNA Gm15441 activation, which attenuates fasting-induced metabolic stress through TXNIP-mediated NLRP3 inflammasome pathway suppression in liver [16]. LncRNA G23Rik is a PPARA-sensitive gene that modulates fasting-induced metabolic stress in liver [17].
However, the modulation mechanism of metabolic stress by PPARA is largely unknown. RNA-seq analysis identified that PPARA activation promoted Cbfa2t3 induction in mouse liver and induction of Cbfa2t3 was completely abolished in Ppara−/− mouse liver [16]. Previous studies showed that PPARA target genes play a modulatory role in metabolic remodeling [16,17]. In the current study, the role of CBFA2T3 in metabolic stress modulation in mouse liver was investigated. Basal Cbfa2t3 mRNA expression is very low in liver but abundant in lung, heart, and BAT. However, hepatic Cbfa2t3 mRNA expression levels are highly elevated after WY14643 treatment of wild-type mice but not Ppara−/− mice, demonstrating that Cbfa2t3 is a PPARA target gene. Gene expression monitoring results revealed that Cbfa2t3 mRNA expression is a response at an early time point and is robustly elevated after 6 h of PPARA activation. These results indicate that hepatic Cbfa2t3 is PPARA sensitive and suggest that it is involved in cell proliferation and fatty acid metabolism and transport, both of which are under the control of PPARA in mouse liver.
PPARA activates a subset of its target genes in mouse liver [15]. HSPA1B is a typical stress-induced chaperone protein that is regulated by miR-15a through directly binding to its 3′-UTR [22]. Recently, single-cell profiling analysis of human CD127+ innate lymphoid cells from human patients with hepatocellular carcinoma (HCC) revealed that HSPA1A and HSPA1B expression were highly activated in late-state HCC, suggesting HSPA1B is important in tumor microenvironment remodeling [23]. Single-cell analysis of the GSE129516 dataset and expression profiling GSE184019 dataset analysis revealed that HSPA1B expression is elevated in non-alcoholic steatohepatitis (NASH) [24]. Wang et al. suggested that HSPA1B could be a diagnostic and prognostic biomarker and a potential therapeutic target for NASH [24]. However, the molecular mechanism by which HSPA1B modulates remodeling is still not clear.
CAR5A is important for ureagenesis and gluconeogenesis, and Car5a-null mice are smaller than Car5a wild-type littermates [25]. However, sodium and potassium citrate-containing water administration rescue the offspring in the expected numbers [25]. Fasting glucose levels were normal, but blood ammonia concentration was significantly elevated in Car5a-null mice, suggesting that Car5a is highly expressed in liver and modulates ammonia detoxification [25]. Car5A/B double-knockout mice revealed a phenotype of hyperammonemia, smaller than littermates, a poor survival rate and lower fasting glucose levels compared to Car5a-null mice [25]. Recently, a study showed that Car5a has a predominant role in ammonia detoxification, whereas the roles of Car5b in ureagenesis and gluconeogenesis are essential only in the absence of Car5a [26]. In a clinical study, metabolic disorders in children associated with Car5a were more common than other metabolic disorders and responded well to treatment with N-carbamyl-l-glutamate [26]. However, the regulatory mechanism of Car5a on metabolic remodeling is largely unknown.
In this study, hepatic Hspa1b mRNA expression was increased by WY14643 and abolished in Cbfa2t3−/− mice. Gene expression monitoring results showed that maximum Hspa1b mRNA expression was at 12 h after WY14643 administration, the same expression pattern as Cbfa2t3 mRNA expression. A previous study revealed that PPARA directly activates MYC expression and MYC amplifies PPARA target gene expression [15]. Gene expression profiling analysis from β-catenin and YAP-induced hepatoblastoma mouse models identified that a high expression level of Hspab1 was seen in the liver of Myc+/+ mice but not Myc−/− mice [27]. These results indicate that multiple mechanisms, such as PPARA and MYC, are involved in Cbfa2t3 mRNA expression in liver. Hepatic Car5a mRNA expression was repressed by WY14643 and rescued in Cbfa2t3−/− mice. However, Car5a mRNA expression was rapidly suppressed after WY14643 administration, and the maximum suppression time point was 12 h.
Interestingly, the expression pattern of Car5a mRNA induced by WY14643 was opposite to that of Cbfa2t3 mRNA expression. PPARA ChIP-sequence analysis identified potential PPARA binding sites within the Car5a transcriptional start site, suggesting PPARA may directly regulate Car5a gene expression [28]. However, no significant expression pattern was seen in the fasting liver of Cbfa2t3+/+ mice and Cbfa2t3−/− mice, suggesting multiple mechanisms may be involved in Car5a expression in liver. These results suggest that PPARA may have a repressive role on Car5a during metabolic stress in liver. However, the mechanism of gene repression by PPARA was recently uncovered. Taken together, these data suggest that Hspa1b and Car5a may be PPARA-sensitive and CBFA2T3-regulated genes that modulate stress and homeostasis in mouse liver.
PPARA directly modulates the metabolic stress response, hepatosteatosis, and lipid accumulation through direct activation of PPARA target genes such as Gm15441 and G23Rik [16,17]. To verify the modulatory role of Cbfa2t3 on metabolic stress, physiological PPARA activation by a fasting model was used. Histology analysis identified that lipid droplets appeared in the fasting liver of Cbfa2t3+/+ mice but were more widely spread in the fasting liver of Cbfa2t3−/− mice. Lipid accumulation was seen in the fasting liver of Cbfa2t3−/− mice compared to that of Cbfa2t3+/+ mice by ORO staining. The levels of liver CHOL, NEFA, and TG were significantly induced by fasting in Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice. Serum NEFA and TG levels were significantly elevated in Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice. Interestingly, NEFA and TG levels in serum and liver were significantly elevated in Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice. These results suggest that Cbfa2t3 has a regulatory role in metabolic stress. qRT-PCR analysis results showed that mRNA expression of lipid accumulation-related genes such as Cd36, Cidea, and Fabp1 were induced in fasting Cbfa2t3−/− liver compared to Cbfa2t3+/+ liver. Cd36, Cidea, and Fabp1 are considered PPARA-dependent genes that are highly expressed under metabolic stress in liver and could be potential therapeutic targets for nonalcoholic fatty liver disease [29,30,31]. Especially, basal expression levels of Cbfa2t3 mRNA were significantly elevated in Cbfa2t3−/− mice compared to Cbfa2t3+/+ mice, and much higher induction was seen in Cbfa2t3−/− liver compared to Cbfa2t3+/+ liver after WY14643 administration. Excessive expression of Cidea promoted lipid accumulation, lipid droplets, and hepatic steatosis in mice and humans [32]. High fat diet-induced lipid accumulation and hepatic steatosis were reduced in Cidea−/− liver compared to Cidea+/+ liver [32]. Triglyceride levels in milk collected from female Cidea−/− mice were reduced around 70% compared to milk from female Cidea+/+ mice [33]. Cidea induction by lipopolysaccharide promoted lipid accumulation and liver steatosis in mouse liver and human hepatocytes [34]. Thus, Cbfa2t3 regulates Cidea expression, which may contribute to lipid accumulation and hepatosteatosis in Cbfa2t3−/− liver. These results indicate that Cbfa2t3 is a PPARA-dependent gene that modulates lipid accumulation under metabolic stress conditions.
In conclusion, the PPARA-dependent hepatic CBFA2T3 protein is a metabolic modulator that is induced by PPARA induction in mouse liver. Lipid accumulation and lipid droplets were observed in fasting liver of Cbfa2t3−/− mice but not Cbfa2t3+/+ liver. TG, CHOL, and NEFA levels in liver in fasting Cbfa2t3−/− mice were significantly increased with induction of transcription of Cd36, Cidea, and Fabp1, which encode lipid metabolism-modulated proteins. Especially, basal expression levels of hepatic Cidea mRNA were elevated in Cbfa2t3−/− compared to Cbfa2t3+/+ mice and highly elevated in Cbfa2t3−/− mice after WY14643 administration, suggesting Cbfa2t3 may modulate lipid metabolism through regulation of Cidea. Taken together, these results suggest that CBFA2T3 can prevent the fasting-induced liver stress response and represents a novel therapeutic target against metabolic stress modulators.

Author Contributions

D.K. designed the study and performed all of the experiments. D.K. wrote the manuscript. S.K.H. and F.J.G. contributed to data analysis. F.J.G. modified the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by [NCI Intramural Research Program] and [Korea Food Research Institute] grant number [E0210203] AND The APC was funded by [E0210203].

Institutional Review Board Statement

The animal study protocol was approved by the Institu-tional Animal Care and Use Committee of National Cancer Institute (protocol code LM-086 and date of approval 2019/03/08).

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article.

Acknowledgments

The authors would like thank Frank J. Gonzalez for supporting animal work and revising manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Hendrikse, L.D.; Haldipur, P.; Saulnier, O.; Millman, J.; Sjoboen, A.H.; Erickson, A.W.; Ong, W.; Gordon, V.; Coudiere-Morrison, L.; Mercier, A.L.; et al. Failure of human rhombic lip differentiation underlies medulloblastoma formation. Nature 2022, 609, 1021–1028. [Google Scholar] [CrossRef] [PubMed]
  2. Chyla, B.J.; Moreno-Miralles, I.; Steapleton, M.A.; Thompson, M.A.; Bhaskara, S.; Engel, M.; Hiebert, S.W. Deletion of Mtg16, a target of t(16;21), alters hematopoietic progenitor cell proliferation and lineage allocation. Mol. Cell. Biol. 2008, 28, 6234–6247. [Google Scholar] [CrossRef]
  3. Steinauer, N.; Guo, C.; Zhang, J. Emerging Roles of MTG16 in Cell-Fate Control of Hematopoietic Stem Cells and Cancer. Stem Cells Int. 2017, 2017, 6301385. [Google Scholar] [CrossRef]
  4. Le, Q.; Hadland, B.; Smith, J.L.; Leonti, A.; Huang, B.J.; Ries, R.; Hylkema, T.A.; Castro, S.; Tang, T.T.; McKay, C.N.; et al. CBFA2T3-GLIS2 model of pediatric acute megakaryoblastic leukemia identifies FOLR1 as a CAR T cell target. J. Clin. Investig. 2022, 132, e157101. [Google Scholar] [CrossRef]
  5. Neault, M.; Lebert-Ghali, C.E.; Fournier, M.; Capdevielle, C.; Garfinkle, E.A.R.; Obermayer, A.; Cotton, A.; Boulay, K.; Sawchyn, C.; St-Amand, S.; et al. CBFA2T3-GLIS2-dependent pediatric acute megakaryoblastic leukemia is driven by GLIS2 and sensitive to navitoclax. Cell Rep. 2023, 42, 113084. [Google Scholar] [CrossRef] [PubMed]
  6. Gress, V.; Roussy, M.; Boulianne, L.; Bilodeau, M.; Cardin, S.; El-Hachem, N.; Lisi, V.; Khakipoor, B.; Rouette, A.; Farah, A.; et al. CBFA2T3::GLIS2 pediatric acute megakaryoblastic leukemia is sensitive to BCL-XL inhibition by navitoclax and DT2216. Blood Adv. 2024, 8, 112–129. [Google Scholar] [CrossRef] [PubMed]
  7. Brown, R.E.; Jacobse, J.; Anant, S.A.; Blunt, K.M.; Chen, B.; Vega, P.N.; Jones, C.T.; Pilat, J.M.; Revetta, F.; Gorby, A.H.; et al. MTG16 regulates colonic epithelial differentiation, colitis, and tumorigenesis by repressing E protein transcription factors. JCI Insight 2022, 7, 153045. [Google Scholar] [CrossRef] [PubMed]
  8. Kumar, P.; Gullberg, U.; Olsson, I.; Ajore, R. Myeloid translocation gene-16 co-repressor promotes degradation of hypoxia-inducible factor 1. PLoS ONE 2015, 10, e0123725. [Google Scholar] [CrossRef] [PubMed]
  9. Wang, X.; Luo, X.; Wang, Z.; Wang, Y.; Zhao, J.; Bian, L. Identification of cancer stemness and M2 macrophage-associated biomarkers in lung adenocarcinoma. Heliyon 2023, 9, e19114. [Google Scholar] [CrossRef]
  10. Xu, R.; Lu, T.; Zhao, J.; Wang, J.; Peng, B.; Zhang, L. Identification of Tumor Antigens and Immune Subtypes in Lung Adenocarcinoma for mRNA Vaccine Development. Front. Cell Dev. Biol. 2022, 10, 815596. [Google Scholar] [CrossRef]
  11. Zhang, X.; Fan, Y.; Liu, B.; Qi, X.; Guo, Z.; Li, L. Med19 promotes breast cancer cell proliferation by regulating CBFA2T3/HEB expression. Breast Cancer 2017, 24, 433–441. [Google Scholar] [CrossRef] [PubMed]
  12. Sinha, R.A.; Rajak, S.; Singh, B.K.; Yen, P.M. Hepatic Lipid Catabolism via PPARalpha-Lysosomal Crosstalk. Int. J. Mol. Sci. 2020, 21, 2391. [Google Scholar] [CrossRef] [PubMed]
  13. Brocker, C.N.; Patel, D.P.; Velenosi, T.J.; Kim, D.; Yan, T.; Yue, J.; Li, G.; Krausz, K.W.; Gonzalez, F.J. Extrahepatic PPARalpha modulates fatty acid oxidation and attenuates fasting-induced hepatosteatosis in mice. J. Lipid Res. 2018, 59, 2140–2152. [Google Scholar] [CrossRef] [PubMed]
  14. Yang, R.; Wang, P.; Chen, Z.; Hu, W.; Gong, Y.; Zhang, W.; Huang, C. WY-14643, a selective agonist of peroxisome proliferator-activated receptor-alpha, ameliorates lipopolysaccharide-induced depressive-like behaviors by preventing neuroinflammation and oxido-nitrosative stress in mice. Pharmacol. Biochem. Behav. 2017, 153, 97–104. [Google Scholar] [CrossRef]
  15. Kim, D.; Brocker, C.N.; Takahashi, S.; Yagai, T.; Kim, T.; Xie, G.; Wang, H.; Qu, A.; Gonzalez, F.J. Keratin 23 Is a Peroxisome Proliferator-Activated Receptor Alpha-Dependent, MYC-Amplified Oncogene That Promotes Hepatocyte Proliferation. Hepatology 2019, 70, 154–167. [Google Scholar] [CrossRef] [PubMed]
  16. Brocker, C.N.; Kim, D.; Melia, T.; Karri, K.; Velenosi, T.J.; Takahashi, S.; Aibara, D.; Bonzo, J.A.; Levi, M.; Waxman, D.J.; et al. Long non-coding RNA Gm15441 attenuates hepatic inflammasome activation in response to PPARA agonism and fasting. Nat. Commun. 2020, 11, 5847. [Google Scholar] [CrossRef] [PubMed]
  17. Kim, D.; Kim, B.; Brocker, C.N.; Karri, K.; Waxman, D.J.; Gonzalez, F.J. Long non-coding RNA G23Rik attenuates fasting-induced lipid accumulation in mouse liver. Mol. Cell. Endocrinol. 2022, 557, 111722. [Google Scholar] [CrossRef] [PubMed]
  18. Lee, S.S.; Pineau, T.; Drago, J.; Lee, E.J.; Owens, J.W.; Kroetz, D.L.; Fernandez-Salguero, P.M.; Westphal, H.; Gonzalez, F.J. Targeted disruption of the alpha isoform of the peroxisome proliferator-activated receptor gene in mice results in abolishment of the pleiotropic effects of peroxisome proliferators. Mol. Cell. Biol. 1995, 15, 3012–3022. [Google Scholar] [CrossRef] [PubMed]
  19. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
  20. Hunt, A.; Fischer, M.; Engel, M.E.; Hiebert, S.W. Mtg16/Eto2 contributes to murine T-cell development. Mol. Cell. Biol. 2011, 31, 2544–2551. [Google Scholar] [CrossRef]
  21. Masetti, R.; Bertuccio, S.N.; Pession, A.; Locatelli, F. CBFA2T3-GLIS2-positive acute myeloid leukaemia. A peculiar paediatric entity. Br. J. Haematol. 2019, 184, 337–347. [Google Scholar] [CrossRef]
  22. Ji, Z.; Lu, R.; Mou, L.; Duan, Y.G.; Zhang, Q.; Wang, Y.; Gui, Y.; Cai, Z. Expressions of miR-15a and its target gene HSPA1B in the spermatozoa of patients with varicocele. Reproduction 2014, 147, 693–701. [Google Scholar] [CrossRef]
  23. He, Y.; Luo, J.; Zhang, G.; Jin, Y.; Wang, N.; Lu, J.; Li, C.; Guo, X.; Qin, N.; Dai, J.; et al. Single-cell profiling of human CD127(+) innate lymphoid cells reveals diverse immune phenotypes in hepatocellular carcinoma. Hepatology 2022, 76, 1013–1029. [Google Scholar] [CrossRef]
  24. Wang, L.; Zhou, K.; Wu, Q.; Zhu, L.; Hu, Y.; Yang, X.; Li, D. Microanatomy of the metabolic associated fatty liver disease (MAFLD) by single-cell transcriptomics. J. Drug Target. 2023, 31, 421–432. [Google Scholar] [CrossRef]
  25. Shah, G.N.; Rubbelke, T.S.; Hendin, J.; Nguyen, H.; Waheed, A.; Shoemaker, J.D.; Sly, W.S. Targeted mutagenesis of mitochondrial carbonic anhydrases VA and VB implicates both enzymes in ammonia detoxification and glucose metabolism. Proc. Natl. Acad. Sci. USA 2013, 110, 7423–7428. [Google Scholar] [CrossRef]
  26. Aspatwar, A.; Supuran, C.T.; Waheed, A.; Sly, W.S.; Parkkila, S. Mitochondrial carbonic anhydrase VA and VB: Properties and roles in health and disease. J. Physiol. 2023, 601, 257–274. [Google Scholar] [CrossRef]
  27. Wang, H.; Lu, J.; Edmunds, L.R.; Kulkarni, S.; Dolezal, J.; Tao, J.; Ranganathan, S.; Jackson, L.; Fromherz, M.; Beer-Stolz, D.; et al. Coordinated Activities of Multiple Myc-dependent and Myc-independent Biosynthetic Pathways in Hepatoblastoma. J. Biol. Chem. 2016, 291, 26241–26251. [Google Scholar] [CrossRef] [PubMed]
  28. Lee, J.M.; Wagner, M.; Xiao, R.; Kim, K.H.; Feng, D.; Lazar, M.A.; Moore, D.D. Nutrient-sensing nuclear receptors coordinate autophagy. Nature 2014, 516, 112–115. [Google Scholar] [CrossRef]
  29. Xia, B.; Yu, R.; Liu, J.; Liu, D.; Li, S.; Yang, L.; Liu, N.; Liang, B.; Zeng, J.; Wei, J.; et al. BDE-47 induces metabolic dysfunction-associated steatotic liver disease (MASLD) through CD36-mediated increased fatty acid uptake and PPARalpha-induced abnormal fatty acid oxidation in BALB/c mice. Toxicol. Lett. 2024, 391, 100–110. [Google Scholar] [CrossRef] [PubMed]
  30. Chen, Y.; Yu, M.; Chen, L.; Mao, J.; Wang, W.; Yang, Z.; Cao, Z.; Liu, Y.; Wei, M.; Zhang, L.; et al. Design, synthesis, and biological evaluation of first-in-class FABP1 inhibitors for the treatment of NASH. Eur. J. Med. Chem. 2024, 270, 116358. [Google Scholar] [CrossRef] [PubMed]
  31. Tang, J.; Zhao, X.; Wei, W.; Liu, W.; Fan, H.; Liu, X.P.; Li, Y.; Wang, L.; Guo, J. METTL16-mediated translation of CIDEA promotes non-alcoholic fatty liver disease progression via m6A-dependent manner. PeerJ 2022, 10, e14379. [Google Scholar] [CrossRef]
  32. Zhou, L.; Xu, L.; Ye, J.; Li, D.; Wang, W.; Li, X.; Wu, L.; Wang, H.; Guan, F.; Li, P. Cidea promotes hepatic steatosis by sensing dietary fatty acids. Hepatology 2012, 56, 95–107. [Google Scholar] [CrossRef]
  33. Li, L.; Zhou, H.; Wang, J.; Li, J.; Lyu, X.; Wang, W.; Luo, C.; Huang, H.; Zhou, D.; Chen, X.; et al. Metabolic switch from glycogen to lipid in the liver maintains glucose homeostasis in neonatal mice. J. Lipid Res. 2023, 64, 100440. [Google Scholar] [CrossRef]
  34. Li, Q.; Wang, W.; Duan, F.; Wang, Y.; Chen, S.; Shi, K.; Xia, Y.; Li, X.; Gao, Y.; Liu, G. DNMT3B Alleviates Liver Steatosis Induced by Chronic Low-grade LPS via Inhibiting CIDEA Expression. Cell Mol. Gastroenterol. Hepatol. 2024, 17, 59–77. [Google Scholar] [CrossRef]
Cells 13 00831 g001
Figure 1. PPARA induces hepatic Cbfa2t3. WY14643 was administered to Ppara+/+ and Ppara−/− mice for 2 days. (A) Relative basal Cbfa2t3 mRNA expression in tissues. (B) Cbfa2t3 mRNA expression in mice with and without WY14643. (C) Time course for changes in expression in liver of Cbfa2t3 mRNA following WY14643 administration. (D) Time course for changes in expression in liver of Hspa1b and Car5a mRNAs following WY14643 treatment. Each data point represents the mean ± SD for n = 5. *** p < 0.001 vs. Ppara+/+.
Figure 1. PPARA induces hepatic Cbfa2t3. WY14643 was administered to Ppara+/+ and Ppara−/− mice for 2 days. (A) Relative basal Cbfa2t3 mRNA expression in tissues. (B) Cbfa2t3 mRNA expression in mice with and without WY14643. (C) Time course for changes in expression in liver of Cbfa2t3 mRNA following WY14643 administration. (D) Time course for changes in expression in liver of Hspa1b and Car5a mRNAs following WY14643 treatment. Each data point represents the mean ± SD for n = 5. *** p < 0.001 vs. Ppara+/+.
Cells 13 00831 g001
Cells 13 00831 g002
Figure 2. Cbfa2t3 modulates glucose metabolism and insulin sensitivity. (A) GTT in Cbfa2t3+/+ and Cbfa2t3−/− mice and calculated area under the curve (AUC) for GTT tests (n = 5). (B) ITT in Cbfa2t3+/+ and Cbfa2t3−/− mice and calculated AUC for ITT tests (n = 5). Each data point represents the mean ± SD for n = 5. ** p < 0.01 vs. Cbfa2t3+/+.
Figure 2. Cbfa2t3 modulates glucose metabolism and insulin sensitivity. (A) GTT in Cbfa2t3+/+ and Cbfa2t3−/− mice and calculated area under the curve (AUC) for GTT tests (n = 5). (B) ITT in Cbfa2t3+/+ and Cbfa2t3−/− mice and calculated AUC for ITT tests (n = 5). Each data point represents the mean ± SD for n = 5. ** p < 0.01 vs. Cbfa2t3+/+.
Cells 13 00831 g002
Cells 13 00831 g003
Figure 3. Impact of Cbfa2t3 deficiency in the liver. WY14643 administered to Cbfa2t3+/+ and Cbfa2t3−/− mice for 2 days. (A) Liver index (mg liver/g total body mass) and body weight loss in Cbfa2t3+/+ and Cbfa2t3−/− mice. (B) TG and CHOL levels in Cbfa2t3+/+ and Cbfa2t3−/− mice. (C) Expression of Cbfa2t3 and Cyp4a14 mRNA in Cbfa2t3+/+ and Cbfa2t3−/− mice. (D) Expression of Hspa1b and Car5a mRNA in Cbfa2t3+/+ and Cbfa2t3−/− mice with and without WY14643. Each data point represents the mean ± SD for n = 5. * p < 0.05; ** p < 0.01; *** p < 0.001 vs. Cbfa2t3+/+.
Figure 3. Impact of Cbfa2t3 deficiency in the liver. WY14643 administered to Cbfa2t3+/+ and Cbfa2t3−/− mice for 2 days. (A) Liver index (mg liver/g total body mass) and body weight loss in Cbfa2t3+/+ and Cbfa2t3−/− mice. (B) TG and CHOL levels in Cbfa2t3+/+ and Cbfa2t3−/− mice. (C) Expression of Cbfa2t3 and Cyp4a14 mRNA in Cbfa2t3+/+ and Cbfa2t3−/− mice. (D) Expression of Hspa1b and Car5a mRNA in Cbfa2t3+/+ and Cbfa2t3−/− mice with and without WY14643. Each data point represents the mean ± SD for n = 5. * p < 0.05; ** p < 0.01; *** p < 0.001 vs. Cbfa2t3+/+.
Cells 13 00831 g003
Cells 13 00831 g004
Figure 4. Cbfa2t3 null causes lipid accumulation during fasting. Cbfa2t3+/+ and Cbfa2t3−/− mice were fasted for 24 h. (A) Liver indexes (mg liver/g total body mass) and body weight loss after fasting. (B) Expression of Cbfa2t3, Cyp4a14, Hspa1b, and Car5a mRNA after 24 h of fasting. (C) Liver H&E and ORO staining after 24 h fasting. Scale bars represent 100 nm (200×). At least 10 cells were quantified in each image for calculating the lipid droplet area. (D) CHOL, NEFA and TG levels from serum and liver tissues after 24 h. (E) Expression of lipid accumulation-related genes after 24 h fasting. (F) Expression of Cd36 and Cidea mRNA in liver of Ppara+/+, Ppara−/−, Cbfa2t3+/+ and Cbfa2t3−/− mice after WY14643 administration for 2 days. Each data point represents the mean ± SD for n = 5. * p < 0.05; ** p < 0.01; *** p < 0.001 vs. Cbfa2t3+/+, vs. Ppara+/+.
Figure 4. Cbfa2t3 null causes lipid accumulation during fasting. Cbfa2t3+/+ and Cbfa2t3−/− mice were fasted for 24 h. (A) Liver indexes (mg liver/g total body mass) and body weight loss after fasting. (B) Expression of Cbfa2t3, Cyp4a14, Hspa1b, and Car5a mRNA after 24 h of fasting. (C) Liver H&E and ORO staining after 24 h fasting. Scale bars represent 100 nm (200×). At least 10 cells were quantified in each image for calculating the lipid droplet area. (D) CHOL, NEFA and TG levels from serum and liver tissues after 24 h. (E) Expression of lipid accumulation-related genes after 24 h fasting. (F) Expression of Cd36 and Cidea mRNA in liver of Ppara+/+, Ppara−/−, Cbfa2t3+/+ and Cbfa2t3−/− mice after WY14643 administration for 2 days. Each data point represents the mean ± SD for n = 5. * p < 0.05; ** p < 0.01; *** p < 0.001 vs. Cbfa2t3+/+, vs. Ppara+/+.
Cells 13 00831 g004
Table 1. qRT-PCR primer sequences.
Table 1. qRT-PCR primer sequences.
NameSequence (5′ → 3′)
ApoB FGGTGTATGGCTTCAACCCTGA
ApoB RGCTTGAGTTCGTACCTGGACA
Car5a FGCAAACTTCGCTCGTCCTTC
Car5a RTTCCGGTCTGCTCTGCCTAT
Cd36 FGATTAATGGCACAGACGCAGC
Cd36 RCAGATCCGAACACAGCGTAGA
Cyp4a14 FCCTGACTTTCTTTCGCCTGC
Cyp4a14 RTGATCACTCCATCTGTGTGCT
Dgat2 FGGTCTGCAGCCAGAGAAGAG
Dgat2 RTCCAGGTATGAGGAGTCTTCC
Fabp1 FAGTCAAGGCAGTCGTCAAGC
Fabp1 RATGTCGCCCAATGTCATGGT
Fabp4 FCATAACCCTAGATGGCGGGG
Fabp4 RCGCCTTTCATAACACATTCCACC
Gapdh FGACTTCAACAGCAACTCCCAC
Gapdh RTCCACCACCCTGTTGCTGTA
Hspa1b FCGAGGAGGTGGATTAGAGGC
Hspa1b RTGCCCAAGCAGCTATCAAGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kim, D.; Ha, S.K.; Gonzalez, F.J. CBFA2T3 Is PPARA Sensitive and Attenuates Fasting-Induced Lipid Accumulation in Mouse Liver. Cells 2024, 13, 831. https://doi.org/10.3390/cells13100831

AMA Style

Kim D, Ha SK, Gonzalez FJ. CBFA2T3 Is PPARA Sensitive and Attenuates Fasting-Induced Lipid Accumulation in Mouse Liver. Cells. 2024; 13(10):831. https://doi.org/10.3390/cells13100831

Chicago/Turabian Style

Kim, Donghwan, Sang Keun Ha, and Frank J. Gonzalez. 2024. "CBFA2T3 Is PPARA Sensitive and Attenuates Fasting-Induced Lipid Accumulation in Mouse Liver" Cells 13, no. 10: 831. https://doi.org/10.3390/cells13100831

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop