Next Article in Journal
The Braconid Syntretomorpha szaboi Papp Is Posing a Great Threat to the Eastern Honeybee, Apis cerana
Previous Article in Journal
A Comparison of RML Prion Inactivation Efficiency by Heterogeneous and Homogeneous Photocatalysis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Pathogens
Volume 13
Issue 5
10.3390/pathogens13050421
pathogens-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Tick-Borne Pathogens in Dermacentor reticulatus Ticks from Bosnia and Herzegovina

by
Teufik Goletić
1,*,†,
Darinka Klarić Soldo
1,†,
Naida Kapo
1,
Šejla Goletić
1,
Amira Koro-Spahić
1,
Amra Alispahić
1,
Adis Softić
1,
Vedad Škapur
2 and
Jasmin Omeragić
1
1
University of Sarajevo—Veterinary Faculty, 71000 Sarajevo, Bosnia and Herzegovina
2
University of Sarajevo—Faculty of Agriculture and Food Science, 71000 Sarajevo, Bosnia and Herzegovina
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Pathogens 2024, 13(5), 421; https://doi.org/10.3390/pathogens13050421
Submission received: 22 February 2024 / Revised: 15 April 2024 / Accepted: 16 April 2024 / Published: 16 May 2024
(This article belongs to the Special Issue Ticks and Tick-Borne Pathogens in the Balkans)
Browse Figures
Versions Notes

Abstract

:
Dermacentor (D.) reticulatus ticks carry and transmit a wide range of pathogens to vertebrate hosts. Limited information is available about the existence of emerging tick-borne pathogens and the distribution of D. reticulatus in Bosnia and Herzegovina. The study aimed to investigate the occurrence and distribution of D. reticulatus and to detect the presence of Anaplasma spp., Borrelia (B.) burgdorferi s.l., Rickettsia spp., and Babesia spp. in samples originating from questing ticks and ticks collected from domestic animals in various regions of Bosnia and Herzegovina. A total of 402 collected D. reticulatus ticks were widely distributed throughout the country. Of the 41 pools consisting of 205 individual D. reticulatus ticks, 21 (51.2%) indicated the presence of Rickettsia spp., 17 (41.4%) of Babesia spp., 2 (4.8%) of Anaplasma spp., and 1 (2.4%) of B. burgdorferi s.l. after real-time PCR screening. Our study indicates that D. reticulatus has significantly expanded its distribution and host range in Bosnia and Herzegovina. Moreover, our results represent the first detection of Babesia spp. in D. reticulatus in Bosnia and Herzegovina. Given the demonstrated presence of emerging pathogens in questing and feeding ticks, there is an urge to establish a surveillance system for ticks and tick-borne pathogens in Bosnia and Herzegovina.

1. Introduction

Ticks have exhibited a notable surge in population density and geographical range expansion across Europe during the initial two decades of the 21st century [1]. This can be attributed to a myriad of factors, with climatic change standing out as the primary driver [1]. However, it is crucial to recognize the multifaceted nature of this phenomenon, which also encompasses ecological alterations, shifts in the habitat of tick hosts, host variations, and human-induced modifications such as land use changes [2,3,4]. The proliferation of ticks into regions previously considered free from their presence has consequentially led to an escalation of tick-borne pathogens that have become a significant global public health challenge in recent years [5,6].
Dermacentor reticulatus ranks as the second most prevalent tick species within the Western Palearctic, succeeding Ixodes ricinus [7]. Its documented range of expansion is notable across various European countries [8,9,10]. In Bosnia and Herzegovina, an inventory of tick species has revealed the existence of eleven ixodid tick species to date [11]. Despite the fact that I. ricinus maintains its dominance as the primary tick species within the country, recent findings have highlighted the remarkable expansion of D. reticulatus ticks. This expansion is underscored by a significant increase in occurrence, escalating from a mere 0.2% in 2011 [12] to a notable 3.8% in 2022 [11]. Correspondingly, Bosnia and Herzegovina exhibited similar climatological trends observed across Europe, indicating a perceptible shift in D. reticulatus distribution. Notably, there has been a transition from its stronghold in the southern regions of the country, typified by a Mediterranean climate, to more northern territories, characterized by moderate-continental and mountain climates.
Dermacentor reticulatus shows resilient biological characteristics to conditions imposed by the environment, a broad host range, and notable vector capacity and competence, attributes congruent with its extensive dissemination throughout Europe and its veterinary and public health importance [8]. Given the intermittent feeding behavior of male ticks, D. reticulatus serves as a crucial vector for various pathogenic agents, distinguishing it epidemiologically from Ixodes spp. [8]. Notably, D. reticulatus stands as the primary vector of Babesia canis, alongside several bacterial pathogens, including Anaplasma phagocytophilum, A. marginale, Bartonella spp., Coxiella burnetii, Francisella spp., and Rickettsia raoultii. Additionally, it serves as a vector for viral pathogens such as the Omsk hemorrhagic fever virus and tick-borne encephalitis virus [8,9,13,14].
Several records of Borrelia burgdorferi sensu lato (s.l.), Anaplasma phagocytophilum, as well as various Rickettsia species, including R. monacensis, R. helvetica, R. raoultii, and R. slovaca, alongside Francisella tularensis subsp. holartica, have been documented in Bosnia and Herzegovina [15,16]. Conversely, the incidence of clinical cases pertaining to Lyme borreliosis and tularemia remains limited [17,18,19]. Despite these findings, the scientific literature concerning the presence of emerging infectious agents in ticks in Bosnia and Herzegovina is relatively lacking.
This study aimed to investigate the occurrence and geographical distribution of D. reticulatus while concurrently identifying the presence of Anaplasma spp., Babesia spp., Borrelia (B.) burgdorferi s.l., and Rickettsia spp. within ticks sampled from domestic animals and vegetation across diverse regions of Bosnia and Herzegovina.

2. Materials and Methods

2.1. Study Area and Sample Collection

This study encompassed the entire state territory, with tick collections and sampling procedures meticulously tailored to reflect the geographical and bioclimatic attributes of the area. This study encompassed the entire state territory (Figure 1). Tick collections and sampling procedures were meticulously tailored to reflect the geographical and bioclimatic attributes of the study area and the distribution and prevalence of ticks within the territory as from previous studies.
The sampling of questing ticks involved techniques aimed at collecting ticks from environmental sources, e.g., vegetation, leaf litter, or other substrates, or ticks waiting to attach to a passing host. The sampling of questing ticks was performed by dragging a piece (1 × 1 square meter) of white fabric or flannel over the vegetation of leaf litter in accordance with standard protocols [20]. Ticks were then collected from the fabric using tweezers and placed in tubes until laboratory examination.
The selection of sampling sites was performed upon meticulous consideration of habitat characteristics, encompassing habitat type and vegetation density, alongside the adjacency to animal husbandry facilities, thereby targeting locales with higher potential for host abundance (Supplementary Table S1). Feeding ticks were collected directly from host animals, either with fine-tipped forceps or by gently dragging a cloth over the host’s fur. Another option involved a cloth that was gently dragged over the host’s fur, dislodging questing ticks onto the fabric for collection. The collection of feeding ticks was mainly performed by local veterinarians. From the total ticks collected (n = 7438), only D. reticulatus was selected for this study. Furthermore, these periods coincided with climatic conditions characterized by average monthly temperatures ranging from 13.0 and 20.0 °C, relative humidity exceeding 80%, and average monthly precipitation exceeding 120 mm. These conditions have been previously established as conducive to the prevalence and abundance of ticks throughout the territory of Bosnia and Herzegovina [12]. D. reticulatus was predominately sampled during two distinct periods: May to June and August to November, spanning seven consecutive years from 2017 to 2023. D. reticulatus collection was extended to the winter month of November, as previous observations reported its activity also during the winter season [11]. These sampling intervals were selected based on prior knowledge of the presence and distribution of ticks in Bosnia and Herzegovina [12]. After collection, D. reticulatus samples were transferred to plastic containers and transported to the University of Sarajevo—Veterinary Faculty. The sex and developmental stage of ticks were morphologically identified using a Zeiss Stemi 508 stereomicroscope (Zeiss, Oberkochen, Germany) with magnification 0.63–5.0×, employing established identification keys [21].

2.2. Tick Pooling Procedure

Following morphological identification, D. reticulatus was categorized and grouped based on developmental stage, sex, engorgement status, sampling details (including date and location), environmental characteristics (temperature and relative humidity), and host species from which they were collected. Upon collection, ticks were stratified based on their engorgement status, categorized as either engorged or non-engorged. Engorged ticks were identified by visual inspection of their size and appearance, indicative of blood ingestion. Non-engorged ticks were those lacking visible signs of blood feeding. A subset of the identified D. reticulatus, comprising 51% (205/402) of the total, was chosen for molecular analyses. Selection criteria for these ticks were based on the need to ensure adequate representation from all surveyed regions of Bosnia and Herzegovina, both urban and rural environments, as well as different types of host animals, including livestock and domestic pets. To prepare the pools, ticks were transferred from individual vials to sterile tubes using fine-tipped forceps, taking care to maintain the integrity of the specimens. The number of ticks in each pool was recorded, and the tubes were labeled accordingly to facilitate tracking and analysis. Each pooled sample comprised up to five adult ticks, with specific pooling protocols as follows: for instance, if ≥10 ticks of the same developmental stage were collected from a single host animal or herd, every second tick was selected for the pool. Likewise, if ≥20 ticks were present under similar conditions, every fourth tick was selected. The resulting pools were stored at −20 °C for further analysis.

2.3. Molecular Identification of Pathogens

The extraction of nucleic acids from pools was performed using a QIAamp DNA Mini kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. Before DNA extraction, engorged ticks were carefully dissected, and each tick was cut in half using sterile scissors. The dissected tick halves were then individually homogenized in lysis buffer using a TissueLyser II (Qiagen, Hilden, Germany) to ensure efficient disruption of the tick tissues and facilitate DNA release. Homogenization was carried out at high speed to achieve thorough tissue disruption. Subsequently, DNA extraction was performed from the homogenized samples following the standard protocol provided by the manufacturer. The remaining halves of the dissected ticks were preserved by deep freezing as a backup for potential future analysis (e.g., identification of positive individual ticks) or other purposes. Subsequent DNA amplification procedures were executed utilizing the QuantiFast Pathogen PCR + IC Kit (Qiagen, Hilden, Germany) on the Mic qPCR Cycler platform (Bio Molecular Systems, Australia). The specific primers and probes, as well as pertinent information on the targeted pathogens, are outlined in Table 1. The multiplex PCR approach was implemented for selected pathogens, comprising two duplex PCRs targeting Rickettsia spp. and Babesia spp., as well as Anaplasma spp. and B. burgodrferi s.l. The identifications of Rickettsia spp., based on the amplification of a section of the gltA gene, Babesia spp., based on the amplification of the section of the 18S rRNA gene, Borrelia burgdorferi s.l., based on the amplification of the ospA gene, and Anaplasma spp., based on the amplification of Msp2 genes, were performed following previously published studies [22,23,24,25]. The cycling conditions used for both duplex PCRs were uniform, comprising an initial denaturation of 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 15 s, and annealing and elongation at 60 °C for 30 s. Fluorescence readings and graphical plotting were performed automatically at 60 °C after each extension/elongation phase, facilitated by the micPCR software ver. 2.8.13. (Bio Molecular Systems, Upper Coomera, Australia).
The prevalence of positive pooled tick samples was determined using a modified calculation method to account for the pooling of individual ticks. The prevalence was calculated by dividing the number of positive pools by the total number of pools tested. To adjust for pool size, the Clopper–Pearson method was employed. The prevalence calculations were conducted using Stata Statistical Software 15.1 (StataCorp LLC, College Station, TX, USA).

3. Results

A total of 402 D. reticulatus ticks (5.4%; 402/7438) were collected during the period 2017–2023. A total of 41 pools, including 205 individual D. reticulatus ticks, were meticulously prepared for subsequent analysis.
The distribution pattern of D. reticulatus ticks across the study area and their associated host species is depicted in Figure 2. The distribution of tick-borne pathogens detected in D. reticulatus ticks in Bosnia and Herzegovina is depicted in Figure 3. It illustrates the cumulative distribution of tick-borne pathogens detected in D. reticulatus ticks across various regions of Bosnia and Herzegovina. Each color represents a different pathogen species.
The findings reveal that 36 out of 41 D. reticulatus pools (87.8%) tested positive for at least one pathogen. Notably, the majority of pools (29 out of 41) exclusively consisted of female ticks, all of which (100%) were found to harbor at least one of the investigated pathogens. In contrast, a lower proportion of pools (7 out of 41) included only male ticks, with 58.3% of them testing positive for at least one pathogen. The distribution of positive pools, categorized by ticks’ sex and identified pathogens, is provided in Table 2. Furthermore, the spatial distribution of identified pathogens across the study regions is detailed in Table 3. Positive pools were obtained predominantly from dogs, but also cats, sheep, and questing ticks from vegetation were represented (Figure 4). However, specimens were also obtained from feline, ovine, equine, and bovine hosts, albeit at a slightly lower frequency.
An intriguing finding revealed that 14.6% (6 out of 41) of the pools exhibited positivity for at least two of the targeted pathogens. Specifically, mutual infection involving Babesia spp. and Rickettsia spp. was detected in four pools originating from dogs as well as one pool originating from sheep located in the western and southwestern Bosnia region. Upon further investigation, individual testing of ticks constituting these pools elucidated the presence of three ticks originating from two pooled dog samples, serving as carriers of both pathogens. In the Herzegovina region, another notable result arose when a pool collected from a dog showed positivity for Rickettsia spp. and Anaplasma spp. However, subsequent analysis at the individual level did not reveal co-infections.

4. Discussion

The overall share of D. reticulatus ticks among the collected tick specimens amounted to 5.4%. Our findings indicate a notable increase in the occurrence of D. reticulatus compared to prior studies conducted within Bosnia and Herzegovina [11,12]. Moreover, our sampling efforts extended into areas where D. reticulatus had not previously been documented, suggesting a notable shift in the distribution of this tick species and its habitat range, aligning with observations from earlier investigations [2,7]. Moreover, our findings offer an updated perspective on the scarcity of D. reticulatus ticks in the Balkan region, as suggested in a comprehensive review by Földvári et al. [8]. This expansion into new habitats may be attributed to the availability of uncultivated open environments in Bosnia and Herzegovina, but also across all of Europe. These habitats provide suitable conditions for tick survival because they are characterized by favorable microclimatic conditions and vegetation cover [26,27]. Additionally, our study revealed the occurrence of D. reticulatus in ruminants, increasing the host spectrum identified in our previous studies [11,12]. However, it is important to note that our study period spans from 2017 to 2023, after the timeframe covered in the publication by Földvári et al. [8]. Therefore, our results may offer an updated perspective on the distribution of D. reticulatus ticks in part of the Balkan region, i.e., Bosnia and Herzegovina.
The findings of our study revealed that D. reticulatus was predominantly collected from dogs, which is consistent with recent research findings [11]. Importantly, our study also observed a broader host range for D. reticulatus, with instances of their presence on cattle, goats, sheep, and vegetation, contrary to previous reports where this tick species was not documented on these animals or vegetation [11]. Furthermore, our results highlight variations in the prevalence of D. reticulatus among different host types and vegetation, as depicted in Figure 5. The expansion in the host range and distribution of these ticks might have substantial implications for tick-borne disease epidemiology and underscores the need for continued surveillance and research efforts to better understand the dynamics of tick populations and their associated pathogens.
Our study revealed that a considerable proportion of D. reticulatus pools sampled from hosts and vegetation across various regions, excluding eastern Bosnia, harbored at least one pathogen, with an overall prevalence of 87.8%.
The DNA of Rickettsia spp. was detected in 51.2% of D. reticulatus pools. Rickettsia spp. predominated in ticks collected from dogs, with 80.2% of positive pools originating from this host species. Additionally, Rickettsia spp. DNA was identified in one pool from cats in central Bosnia, as well as two pools from sheep in locations within Herzegovina and southwestern Bosnia. Prior studies conducted in Bosnia and Herzegovina identified R. raoultii and R. slovaca in D. reticulatus ticks. While our study did not specifically identify these species, our findings contribute to the body of knowledge regarding tick-borne pathogens in the region. Remarkably, a previous investigation compared the presence of both Rickettsia spp. in a subset of 54 D. reticulatus ticks collected from the vegetation [16]. Considering the evident increase in the distribution of D. reticulatus and its expanded habitat range, our results suggest the potential emergence of Rickettsia spp. as a new public health problem in Bosnia and Herzegovina. The detection of these pathogens in a substantial proportion of tick pools underscores the need for continued surveillance and research efforts to monitor and mitigate the risks associated with tick-borne diseases in Bosnia and Herzegovina.
In the present study, the detection of Babesia spp. in 41.4% of D. reticulatus pools represents a remarkable finding, marking the first report of Babesia spp. presence in D. reticulatus in Bosnia and Herzegovina. In previous investigations, the presence of B. canis was documented, with studies revealing its detection in 85% of dogs exhibiting clinical symptoms of the disease [28]. Moreover, the prevalence of Babesia spp. among dogs infested with ticks has been reported in 27.9% of asymptomatic and 43.2% of symptomatic dogs in Bosnia and Herzegovina [29]. Hodžić et al. [30] extended the understanding of Babesia spp. distribution by identifying the pathogen in red foxes (Vulpes vulpes), reporting that 0.8% of examined samples were infested with B. canis and 31.9% with B. vulpes. A distinct strain of Babesia spp., referred to as “Badger type A”, was isolated from a single sample obtained from a European wild cat (Felis silvestris) in Bosnia and Herzegovina [31]. Stevanović et al. [32] documented two cases of bovine babesiosis caused by B. divergens in central Bosnia and Herzegovina. We found Babesia spp. in a pool of female D. reticulatus ticks collected from a cat. While feline babesiosis is uncommon in Europe [33], our finding emphasizes the need for more research on the prevalence and impact of this parasite in cats in Bosnia and Herzegovina. Continued surveillance efforts are crucial to better understanding the distribution and significance of Babesia spp. in feline populations. However, it is important to note that the specific Babesia species was not identified, which limits our ability to draw definitive conclusions about feline babesiosis.
The presence of B. burgdorferi s.l. in D. reticulatus ticks provides additional evidence of its association with this tick species [34]. In northwestern Europe, Borrelia afzelii, B. garinii, B. spielmanii, and B. miyamotoi have been identified in D. reticulatus ticks collected from the vegetation, highlighting the presence of these pathogens in association with this tick species across the area [13]. While the detection of these pathogens in D. reticulatus ticks is noteworthy, it does not necessarily imply vector competence. Consistent with findings from previous investigations in northwestern Europe, our single positive pool for B. burgdorferi s.l. included ticks collected from vegetation in the central Bosnia region. The identification of this pathogen in questing D. reticulatus ticks raises concerns for at-risk human activities such as hunters, trekkers, foresters, pet owners, etc.
Anaplasma spp. was identified in two D. reticulatus pools (4.8%, 2/41) obtained from dogs in the central Bosnia region. Previous investigations targeting the presence of zoonotic bacteria within the tick population in Bosnia and Herzegovina reported the detection of A. phagocytophilum in 1.1% of examined female D. reticulatus ticks [16]. Notably, A. phagocytophilum and A. marginale were documented in infected D. reticulatus ticks sampled from the environment in northwestern Europe and Ukraine, although at a low prevalence, i.e., 0.28% and 0.1%, respectively [13,35]. Sprong et al. [13] could not confirm A. phagocytophilum using conventional PCR methods. These authors pointed out that it is important to note that molecular techniques alone do not provide conclusive evidence of the presence of this infectious agent in D. reticulatus ticks or its vector competence for Anaplasma spp. Therefore, further research is needed to elucidate the vector competence of D. reticulatus before the implications of these pathogen findings can be fully understood for the surveillance of vector-borne diseases.
In the western and southwestern regions of Bosnia, mutual infection with Rickettsia spp. and Babesia spp. was identified in five pools of D. reticulatus ticks, comprising four pools collected from dogs and one pool from sheep. Notably, three individual ticks were found to harbor both pathogens concurrently. Additionally, in the Herzegovina region, one pool collected from a dog exhibited mutual infection with Rickettsia spp. and Anaplasma spp. The detection of ticks harboring multiple pathogens suggests the potential for humans to acquire simultaneous infections as well. Co-infections pose a significant challenge in understanding the epidemiology of tick-borne diseases and complicate diagnosis in humans [36]. Given the fact that coinfections of individual ticks were observed in our study, our results call for attention to prospective public or animal health concerns in Bosnia and Herzegovina. Our study included an individual screening of ticks in cases where co-infection or mutual infections were suspected based on initial pool screening results; however, this approach may have limitations. The selective nature of individual screening may have resulted in underestimation or missed detection of certain pathogens, particularly those with low prevalence or those that may not have been identified during initial pool screening. Therefore, future studies should consider the feasibility of comprehensive individual screening of ticks to enhance the accuracy and robustness of pathogen detection.

5. Conclusions

The results of this study offer valuable insights into the emergence and spread of pathogens carried by D. reticulatus in Bosnia and Herzegovina. Our results shed light on the expanding distribution and widening of the host spectrum of D. reticulatus, contributing to a deeper understanding of the epidemiology of tick-borne diseases within the region. The increasing prevalence and geographical range of D. reticulatus underscore the need for enhanced surveillance and control measures specific to Bosnia and Herzegovina, but also in neighboring countries and regions where similar ecological conditions may support the establishment and spread of this tick species. The detection of emerging tick-borne pathogens in D. reticulatus raises concerns about the potential for spillover into human populations. Given the interconnected nature of ecosystems and the mobility of hosts and vectors, the threat posed by tick-borne diseases transcends national boundaries, highlighting the importance of regional and international cooperation in addressing this public health challenge. In light of these findings, there is a pressing need for collaborative efforts among researchers, public health authorities, and policymakers to develop and implement integrated strategies for the prevention, surveillance, and control of tick-borne diseases. This includes the establishment of comprehensive surveillance programs, the development of targeted interventions to reduce tick populations and mitigate human exposure, and the promotion of public awareness and education initiatives to empower individuals to protect themselves against tick bites and tick-borne infections within Bosnia and Herzegovina

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/pathogens13050421/s1, Table S1: Meta data about sampling sites and methods, climatic condition and habitat in selected study areas of Bosnia and Herzegovina.

Author Contributions

Conceptualization, T.G., D.K.S. and J.O.; methodology, T.G., Š.G., A.S., A.K.-S. and D.K.S.; software, T.G., D.K.S., A.A. and N.K.; validation, T.G., D.K.S. and A.S.; formal analysis, T.G., D.K.S., N.K., Š.G., A.A., A.K.-S., V.Š. and A.S.; resources, J.O. and T.G.; writing—original draft preparation, T.G. and D.K.S.; writing—review and editing, N.K., Š.G., A.K.-S., A.A., A.S., V.Š. and J.O.; visualization, D.K.S.; supervision, T.G. and J.O.; project administration, J.O.; funding acquisition, T.G. and J.O. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Science, Higher Education, and Youth of Canton Sarajevo. Scientific project: Investigation of the causative agents of infectious and parasitic diseases in ticks (Grant no. 11-05-14-26437-1/18).

Institutional Review Board Statement

The authors declare that no experimentation on animals has been conducted to obtain the data presented in this paper. The study was performed following the Veterinary Law of Bosnia and Herzegovina (“OJ BiH”, no. 34/02), the Game Law of Bosnia and Herzegovina (‘OJ BiH’, no. 4/06), and the Animal Protection Law in Bosnia and Herzegovina.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Acknowledgments

This publication reports a part of the doctoral thesis of the first shared co-author (Darinka Klarić-Soldo). The authors express their gratitude to the staff of the Laboratory for Molecular Genetic and Forensic Investigations, Veterinary Institute of the University of Sarajevo—Veterinary Faculty, as well as the staff of the Laboratory for Parasitology, Veterinary Institute of the University of Sarajevo—Veterinary Faculty of Sarajevo.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Alfredsson, M.; Olafsson, E.; Eydal, M.; Unnsteinsdottir, E.R.; Hansford, K.; Wint, W.; Alexander, N.; Medlock, J.M. Surveillance of Ixodes ricinus ticks (Acari: Ixodidae) in Iceland. Parasites Vectors 2017, 10, 466. [Google Scholar] [CrossRef] [PubMed]
  2. Medlock, J.M.; Hansford, K.M.; Bormane, A.; Derdakova, M.; Estrada-Peña, A.; George, J.-C.; Golovljova, I.; Jaenson, T.G.T.; Jensen, J.-K.; Jensen, P.M.; et al. Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe. Parasites Vectors 2013, 6, 1. [Google Scholar] [CrossRef] [PubMed]
  3. Karbowiak, G. Changes in the occurrence range of hosts cause the expansion of the ornate dog tick Dermacentor reticulatus (Fabricius, 1794) in Poland. Biologia. 2022, 77, 1513–1522. [Google Scholar] [CrossRef]
  4. Karbowiak, G. The occurrence of the Dermacentor reticulatus tick—Its expansion to new areas and possible causes. Ann Parasitol. 2014, 60, 37–47. [Google Scholar]
  5. Caminade, C.; McIntyre, K.M.; Jones, A.E. Impact of recent and future climate change on vector-borne diseases. Ann. N. Y. Acad. Sci. 2019, 1436, 157–173. [Google Scholar] [CrossRef] [PubMed]
  6. Petersen, L.R.; Beard, C.B.; Visser, S.N. Combatting the increasing threat of vector-borne disease in the United States with a national vector-borne disease prevention and control system. Am. J. Trop. Med. Hyg. 2019, 100, 242–245. [Google Scholar] [CrossRef] [PubMed]
  7. Noll, M.; Wall, R.; Makepeace, B.L.; Vineer, H.R. Distribution of ticks in the Western Palearctic: An updated systematic review (2015–2021). Parasites Vectors 2023, 16, 141. [Google Scholar] [CrossRef] [PubMed]
  8. Földvári, G.; Široký, P.; Szekeres, S.; Majoros, G.; Sprong, H. Dermacentor reticulatus: A vector on the rise. Parasites Vectors 2016, 9, 314. [Google Scholar] [CrossRef] [PubMed]
  9. Rubel, F.; Brugger, K.; Belova, O.A.; Kholodilov, I.S.; Didyk, Y.M.; Kurzrock, L.; García-Pérez, A.L.; Kahl, O. Vectors of disease at the northern distribution limit of the genus Dermacentor in Eurasia: D. reticulatus and D. silvarum. Exp. Appl. Acarol. 2020, 82, 95–123. [Google Scholar] [CrossRef] [PubMed]
  10. Springer, A.; Lindau, A.; Probst, J.; Drehmann, M.; Fachet, K.; Thoma, D.; Rose Vineer, H.; Noll, M.; Dobler, G.; Mackenstedt, U.; et al. Update and prognosis of Dermacentor distribution in Germany: Nationwide occurrence of Dermacentor reticulatus. Front. Vet. Sci. 2022, 9, 1044597. [Google Scholar] [CrossRef] [PubMed]
  11. Omeragić, J.; Šerić-Haračić, S.; Klarić Soldo, D.; Kapo, N.; Fejzić, N.; Škapur, V.; Medlock, J. Distribution of ticks in Bosnia and Herzegovina. Ticks Tick-Borne Dis. 2022, 13, 101870. [Google Scholar] [CrossRef]
  12. Omeragic, J. Ixodid ticks in Bosnia and Herzegovina. Exp. Appl. Acarol. 2011, 53, 301–309. [Google Scholar] [CrossRef] [PubMed]
  13. Sprong, H.; Fonville, M.; Docters van Leeuwen, A.; Devillers, E.; Ibañez-Justicia, A.; Stroo, A.; Hansford, K.; Cull, B.; Medlock, J.; Heyman, P.; et al. Detection of pathogens in Dermacentor reticulatus in Northwestern Europe: Evaluation of a High-Throughput Array. Heliyon 2019, 5, e01270. [Google Scholar] [CrossRef] [PubMed]
  14. Ličková, M.; Fumačová Havlíková, S.; Sláviková, M.; Slovák, M.; Drexler, J.F.; Klempa, B. Dermacentor reticulatus is a vector of tick-borne encephalitis virus. Ticks Tick-Borne Dis. 2020, 11, 101414. [Google Scholar] [CrossRef] [PubMed]
  15. Lasić, L.; Ušanović, L.; Ćakić, S.; Hanjalić, J.; Kalamujić Stroil, B. First Molecular detection of Borrelia Burgdorferi sensu lato in Ixodes ricinus ticks collected from humans in the Sarajevo Canton (Bosnia and Herzegovina). Syst. Appl. Acarol. 2020, 25, 169–172. [Google Scholar] [CrossRef]
  16. Hodžić, A.; Fuehrer, H.-P.; Duscher, G.G. First Molecular evidence of zoonotic bacteria in ticks in Bosnia and Herzegovina. Transbound. Emerg. Dis. 2017, 64, 1313–1316. [Google Scholar] [CrossRef] [PubMed]
  17. Dautović-Krkić, S.; Cavaljuga, S.; Ferhatović, M.; Mostarac, N.; Gojak, R.; Hadzović, M.; Hadzić, A. [Lyme borreliosis in Bosnia and Herzegovina--clinical, laboratory and epidemiological research]. Med. Arh. 2008, 62, 107–110. [Google Scholar] [PubMed]
  18. Hukić, M.; Numanović, F.; Sisirak, M.; Moro, A.; Dervović, E.; Jakovec, S.; Salimović Bešić, I. Surveillance of wildlife zoonotic diseases in the Balkans Region. Med. Glas. 2010, 7, 96–105. [Google Scholar]
  19. Arapovic, J.; Skocibusic, S.; Grgic, S.; Nikolic, J. The first evidence of Lyme neuroborreliosis in Southern Bosnia and Herzegovina. Case Rep. Infect. Dis. 2014, 2014, 231969. [Google Scholar] [CrossRef]
  20. Salomon, J.; Hamer, S.A.; Swei, A. A beginner’s guide to collecting questing hard ticks (Acari: Ixodidae): A standardized tick dragging protocol. J. Insect Sci. 2020, 20, 11. [Google Scholar] [CrossRef] [PubMed]
  21. Walker, A.R.; Bouattour, A.; Camicas, J.L.; Estrada-Pena, A.; Horak, I.G.; Latif, A.; Pegram, R.G.; Preston, P.M. Ticks of Domestic Animals in Africa: A Guide to Identification of Species; Bioscience Reports: Edinburgh, UK, 2003. [Google Scholar]
  22. Labruna, M.B.; Whitworth, T.; Horta, M.C.; Bouyer, D.H.; McBride, J.W.; Pinter, A.; Popov, V.; Gennari, S.M.; Walker, D.H. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J. Clin. Microbiol. 2004, 42, 90–98. [Google Scholar] [CrossRef] [PubMed]
  23. Øines, Ø.; Radzijevskaja, J.; Paulauskas, A.; Rosef, O. Prevalence and diversity of Babesia Spp. in questing Ixodes ricinus ticks from Norway. Parasites Vectors 2012, 5, 156. [Google Scholar] [CrossRef] [PubMed]
  24. Ivacic, L.; Reed, K.D.; Mitchell, P.D.; Ghebranious, N. A LightCycler TaqMan assay for detection of Borrelia Burgdorferi sensu lato in clinical samples. Diagn. Microbiol. Infect. Dis. 2007, 57, 137–143. [Google Scholar] [CrossRef] [PubMed]
  25. Courtney, J.W.; Kostelnik, L.M.; Zeidner, N.S.; Massung, R.F. Multiplex real-time PCR for detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J. Clin. Microbiol. 2004, 42, 3164–3168. [Google Scholar] [CrossRef] [PubMed]
  26. Gray, J.S.; Dautel, H.; Estrada-Peña, A.; Kahl, O.; Lindgren, E. Effects of climate change on ticks and tick-borne diseases in Europe. Interdiscip. Perspect. Infect. Dis. 2009, 2009, 593232. [Google Scholar] [CrossRef] [PubMed]
  27. Estrada-Peña, A. Climate, Niche, Ticks, and Models: What they are and how we should interpret them. Parasitol. Res. 2008, 103 (Suppl. S1), S87–S95. [Google Scholar] [CrossRef] [PubMed]
  28. Ćoralić, A.; Gabrielli, S.; Zahirović, A.; Stojanović, N.M.; Milardi, G.L.; Jažić, A.; Zuko, A.; Čamo, D.; Otašević, S. First molecular detection of Babesia canis in dogs from Bosnia and Herzegovina. Ticks Tick-Borne Dis. 2018, 9, 363–368. [Google Scholar] [CrossRef]
  29. Omeragic, J.; Zuko, A.; Jazic, A. The effect of various factors for the development of ticks and tick-borne diseases in Bosnia and Herzegovina. In Proceedings of the 2nd Conference on Neglected Vectors and Vector-Borne Diseases (EURNEGVEC) with Management Committee and Working Group Meetings of the Cost Action TD1303, Izmir, Turkey, 31 March–2 April 2015. [Google Scholar]
  30. Hodžić, A.; Alić, A.; Fuehrer, H.-P.; Harl, J.; Wille-Piazzai, W.; Duscher, G.G. A Molecular survey of vector-borne pathogens in red foxes (Vulpes vulpes) from Bosnia and Herzegovina. Parasites Vectors 2015, 8, 88. [Google Scholar] [CrossRef] [PubMed]
  31. Hodžić, A.; Mrowietz, N.; Cézanne, R.; Bruckschwaiger, P.; Punz, S.; Habler, V.E.; Tomsik, V.; Lazar, J.; Duscher, G.G.; Glawischnig, W.; et al. Occurrence and diversity of arthropod-transmitted pathogens in red foxes (Vulpes vulpes) in Western Austria, and possible vertical (transplacental) transmission of Hepatozoon canis. Parasitology 2018, 145, 335–344. [Google Scholar] [CrossRef] [PubMed]
  32. Stevanović, O.; Jurković, D.; Polkinghorne, A.; Ćeleš, A.; Ilić, T.; Dimitrijević, S.; Nedić, D.; Beck, R. Molecular detection of Babesia divergens and Mycoplasma wenyonii infection in cattle from Bosnia And Herzegovina. Parasitol. Res. 2020, 119, 1423–1427. [Google Scholar] [CrossRef] [PubMed]
  33. Remesar, S.; Arnal, J.L.; Gómez, A.; Prieto, A.; García-Dios, D.; Benito, A.; Panadero, R.; Morrondo, P.; Díaz, P. A case report of fatal feline babesiosis caused by Babesia canis in north western Spain. BMC Vet. Res. 2022, 18, 177. [Google Scholar] [CrossRef] [PubMed]
  34. Mierzejewska, E.J.; Pawełczyk, A.; Radkowski, M.; Welc-Falęciak, R.; Bajer, A. Pathogens vectored by the tick, Dermacentor reticulatus, in endemic regions and zones of expansion in Poland. Parasites Vectors 2015, 8, 490. [Google Scholar] [CrossRef] [PubMed]
  35. Karbowiak, G.; Vichová, B.; Slivinska, K.; Werszko, J.; Didyk, J.; Peťko, B.; Stanko, M.; Akimov, I. The infection of questing Dermacentor reticulatus ticks with Babesia canis and Anaplasma phagocytophilum in the Chernobyl Exclusion zone. Vet. Parasitol. 2014, 204, 372–375. [Google Scholar] [CrossRef] [PubMed]
  36. Diuk-Wasser, M.A.; Vannier, E.; Krause, P.J. Coinfection by Ixodes tick-Borne Pathogens: Ecological, epidemiological, and clinical consequences. Trends Parasitol. 2016, 32, 30–42. [Google Scholar] [CrossRef] [PubMed]
Pathogens 13 00421 g001
Figure 1. Map of Bosnia and Herzegovina with sampling sites included in the study. Colored circles represent the sampling sites (Software: QGIS ver. 3.28.8).
Figure 1. Map of Bosnia and Herzegovina with sampling sites included in the study. Colored circles represent the sampling sites (Software: QGIS ver. 3.28.8).
Pathogens 13 00421 g001
Pathogens 13 00421 g002
Figure 2. Distribution of D. reticulatus ticks in (a) geographical regions of Bosnia and Herzegovina and (b) source of collection.
Figure 2. Distribution of D. reticulatus ticks in (a) geographical regions of Bosnia and Herzegovina and (b) source of collection.
Pathogens 13 00421 g002
Pathogens 13 00421 g003
Figure 3. Distribution of tick-borne pathogens detected in different regions of Bosnia and Herzegovina.
Figure 3. Distribution of tick-borne pathogens detected in different regions of Bosnia and Herzegovina.
Pathogens 13 00421 g003
Pathogens 13 00421 g004
Figure 4. Positive D. reticulatus pools for at least one of the investigated pathogens distributed over the host type or vegetation in Bosnia and Herzegovina.
Figure 4. Positive D. reticulatus pools for at least one of the investigated pathogens distributed over the host type or vegetation in Bosnia and Herzegovina.
Pathogens 13 00421 g004
Pathogens 13 00421 g005
Figure 5. Percentage of D. reticulatus ticks collected from different animal hosts or questing from vegetation in 2011 [12], 2022 [11], and 2023 (this study) in Bosnia and Herzegovina.
Figure 5. Percentage of D. reticulatus ticks collected from different animal hosts or questing from vegetation in 2011 [12], 2022 [11], and 2023 (this study) in Bosnia and Herzegovina.
Pathogens 13 00421 g005
Table 1. Primers and probes used for molecular detection of bacterial and protozoan pathogens in D. reticulatus ticks (real-time PCR).
Table 1. Primers and probes used for molecular detection of bacterial and protozoan pathogens in D. reticulatus ticks (real-time PCR).
Primer
(100 pmol/µL)		Oligonucleotide Sequence
(5′–3′)		Final Conc./25 µLAmplicon Size (bp)Ref.
Rspp-FGAGAGAAAATTATATCCAAATGTTGAT450 nM100[20]
Rspp-RAGGGTCTTCGTGCATTTCTT
Rspp-P[CY5]-CATTGTGCCATCCAGCCTACGGT-[BHQ2]150 nM
Bab-FCAGCTTGACGGTAGGGTATTGG1 µM20[21]
Bab-RTCGAACCCTAATTCCCCGTTA
Bab-P[YAKYE]- CGAGGCAGCAACGG-[BHQ1]500 nM
Bbsl_ospA-FAATATTTATTGGGAATAGGTCTAA600 nM59[22]
Bbsl_ospA-RCACCAGGCAAATCTACTGA
Bbsl_ospA-P[FAM]-TTAATAGCATGTAAGCAAAATGTTAGCA-[BHQ1]100 nM
Apmsp2-F:ATGGAAGGTAGTGTTGGTTATGGTATT900 nM77[23]
Apmsp2-RTTGGTCTTGAAGCGCTCGTA
Apmsp2-P[CY5]-TGGTGCCAGGGTTGAGCTTGAGATTG-[BHQ2]125 nM
Table 2. Positive D. reticulatus pools according to pathogens distributed over the sex of ticks.
Table 2. Positive D. reticulatus pools according to pathogens distributed over the sex of ticks.
SexRickettsia spp.Babesia spp.Anaplasma spp. Borrelia burgdorferi s.l.Positive Pools
Female
(n = 29)		62.0% (18/29)
CI *: 42.3–79.3		48.3% (14/29)
CI: 29.5–67.5		3.4% (1/29)
CI: 0.01–17.8		3.4% (1/29)
CI: 0.01–17.8		100%
(29/29)
Male
(n = 12)		25.0% (3/12)
CI: 5.5–57.2		25.0% (3/12)
CI: 5.5–57.2		8.3% (1/12)
CI: 0.2–38.5		-58.3%
(7/12)
* 95% Confidence interval.
Table 3. Positive D. reticulatus pools according to pathogens and geographical regions in Bosnia and Herzegovina.
Table 3. Positive D. reticulatus pools according to pathogens and geographical regions in Bosnia and Herzegovina.
PathogensW and SW
Bosnia		HerzegovinaCentral
Bosnia		N and NW BosniaE
Bosnia
Rickettsia spp.28.6% (6/21)
CI: 11.3–52.2		57.1% (12/21)
CI: 34.0–78.2		4.7% (1/21)
CI: 0.1–23.8		9.5%, (2/21)
CI: 1.2–30.4		-
Babesia spp.70.6%, (12/17)
CI: 44.0–89.7		-29.4%, (5/17)
CI: 10.3–56.0		--
Anaplasma spp.-50.0%, (1/2)
CI: 1.3–98.8		50.0%, (1/2)
CI: 1.3–98.8		--
B. burgdorferi s.l.--100%, (1/1)
CI: 2.5–100		--
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Goletić, T.; Klarić Soldo, D.; Kapo, N.; Goletić, Š.; Koro-Spahić, A.; Alispahić, A.; Softić, A.; Škapur, V.; Omeragić, J. Tick-Borne Pathogens in Dermacentor reticulatus Ticks from Bosnia and Herzegovina. Pathogens 2024, 13, 421. https://doi.org/10.3390/pathogens13050421

AMA Style

Goletić T, Klarić Soldo D, Kapo N, Goletić Š, Koro-Spahić A, Alispahić A, Softić A, Škapur V, Omeragić J. Tick-Borne Pathogens in Dermacentor reticulatus Ticks from Bosnia and Herzegovina. Pathogens. 2024; 13(5):421. https://doi.org/10.3390/pathogens13050421

Chicago/Turabian Style

Goletić, Teufik, Darinka Klarić Soldo, Naida Kapo, Šejla Goletić, Amira Koro-Spahić, Amra Alispahić, Adis Softić, Vedad Škapur, and Jasmin Omeragić. 2024. "Tick-Borne Pathogens in Dermacentor reticulatus Ticks from Bosnia and Herzegovina" Pathogens 13, no. 5: 421. https://doi.org/10.3390/pathogens13050421

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop