Next Article in Journal
A Graphic Processing Unit–High-Order Spectral (GPU-HOS) Numerical Wave Tank for the Simulation of Directional Wave Field Evolution over a Long Time
Previous Article in Journal
Fatigue Life Assessment in the Typical Structure of Large Container Vessels Based on Fracture Mechanics
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
JMSE
Volume 11
Issue 11
10.3390/jmse11112076
jmse-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Low Salinity on Growth, Digestive Enzyme Activity, Antioxidant and Immune Status, and the Microbial Community of Litopenaeus vannamei in Biofloc Technology Aquaculture Systems

by
Lina Long
,
Huang Liu
* and
Shimin Lu
Fishery Machinery and Instrument Research Institute, Chinese Academy of Fishery Sciences, Shanghai 200092, China
*
Author to whom correspondence should be addressed.
J. Mar. Sci. Eng. 2023, 11(11), 2076; https://doi.org/10.3390/jmse11112076
Submission received: 24 August 2023 / Revised: 22 September 2023 / Accepted: 27 October 2023 / Published: 30 October 2023
(This article belongs to the Topic Aquatic Environment Research for Sustainable Development)
Browse Figures
Versions Notes

Abstract

:
Biofloc technology (BFT) culture systems based on low salinity can meet the needs of shrimp growth and environmental protection, thus having potential application. To evaluate the effects of BFT on water quality, the microbial community, growth, digestive enzyme activity, and antioxidant and immune status of Litopenaeus vannamei under low salinity conditions, a four-week experiment was conducted in a BFT culture system (C/N ratio of 12: 1) with three salinity conditions: 5.0‰ (S5 group), 10.0‰ (S10 group), and 15.0‰. The results showed that water quality parameters were all within the range suitable for the culture of L. vannamei. There were no significant differences in growth parameters such as final weight or specific growth rate. Muscle moisture, crude protein, and crude lipid contents of L. vannamei did not differ among groups (p > 0.05). In addition, intestinal amylase and trypsin activities in the S5 group significantly increased (p < 0.05). In the S15 group, the superoxide dismutase activity and total antioxidant capacity in the serum and hepatopancreas of L. vannamei, as well as serum catalase, acid phosphatase, and alkaline phosphatase activities, markedly increased (p < 0.05). The microbial diversity (Shannon and Simpson indices) and richness (Chao1 and ACE indices) were higher in the S5 group than in the S15 group. Our findings indicated that although the shrimp in BFT systems with a salinity of 5‰ had lower antioxidant and immune levels, the digestive enzyme activity as well as the gut microbial diversity and richness improved compared to other groups, suggesting the possibility of culturing L. vannamei in low-saline areas with BFT systems.

1. Introduction

Biofloc technology (BFT) is a low-cost, sustainable, and environmentally friendly aquaculture system [1,2]. By adding carbon sources to regulate the carbon/nitrogen (C/N) ratio in the water, the culture can promote the formation of biofloc that contains bacteria, fungi, protozoa, rotifers, and microalgae. Ammonia nitrogen and nitrite nitrogen can be removed through the assimilation of heterotrophic bacteria to maintain water quality [3,4,5]. Biofloc is rich in nutrients such as crude protein, crude lipid, and a variety of extracellular enzymes that can benefit aquatic animals. Thus, it can improve the feed utilization of cultured species [6,7]. In addition, biofloc contains bioactive compounds, including polyβ-hydroxybutyric acid (PHB), polysaccharides, carotenoids, chlorophylls, phytosterols, taurine, and fat-soluble vitamins, which can significantly improve the immunity and antioxidant levels of aquatic animals [8,9,10,11]. At present, BFT is widely used in culturing Litopenaeus vannamei [9,12,13], Macrobrachium rosenbergii [14], Oreochromis niloticus [15,16,17], Cyprinus carpio [18], and other aquatic animals.
Litopenaeus vannamei has the advantages of wide adaptability and rapid growth. It is the world’s most widely cultivated euryhaline crustacean [19]. In China, L. vannamei is also the most widely cultivated shrimp, producing the highest yield and accounting for 85% of the country’s shrimp production [20]. The culturing of L. vannamei in inland areas at low-salinity conditions is a current trend, and the rearing scale will show sustained growth in the future [21]. On the one hand, such a culture mode alleviates the pollution of mariculture on the coastal marine environment, thus protecting the coastal ecosystem. On the other hand, it also promotes the development of inland aquaculture, providing fresh shrimp for inland areas that cannot otherwise obtain such commodities [22]. However, the cultivation of L. vannamei in inland areas may have adverse ecological and environmental impacts on the local nonsaline earth surface [23,24].
Fortunately, using BFT in inland areas to culture L. vannamei can necessitate little or no change in water usage during the farming process, thus reducing the discharge of salt and minimizing the impact on the local ecological environment [23]. At present, several studies successfully applied BFT to low-salinity L. vannamei aquaculture systems, but these studies primarily focused on growth performance [25,26,27,28,29], amino acid and fatty acid compositions [30], and yield [24,31] of L. vannamei as well as the compositions of biofloc [32]. However, there are few research reports on digestive enzyme activity, antioxidant levels, or immune status of L. vannamei in the BFT culture system under low-salinity conditions [30]. Therefore, this study employed L. vannamei as a research object to investigate the effects of BFT on water quality regulation of zero exchange aquaculture systems. Shrimp growth performance, muscle composition, digestive enzyme activity, antioxidant and immune statuses, and the composition of biofloc and the intestinal microbial community under low-salinity conditions were analyzed. Our aim was to provide references for the promotion and application of BFT in the cultivation of shrimp under low-salinity conditions in inland areas.

2. Materials and Methods

2.1. Experiment and Design

The experiment was conducted in the Pond Ecological Engineering Research Center of the Chinese Academy of Fishery Sciences. Three low-salinity groups were set up, namely, 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15). Each group had three replicates. This study used a zero-water exchange BFT system comprising the culture tanks (70 cm × 50 cm × 50 cm), sedimentation tanks, and biofilm purification tanks. Glucose was purchased from local markets and used as a supplementary carbon source to adjust the C/N ratio to 12. The C/N ratio was calculated according to the carbon–nitrogen contents of pellet feed and the carbon content contained in glucose following the protocol described by Avnimelech [3]. The culture period was four weeks.
L. vannamei used in this study were purchased from Hainan Ruyilai Aquaculture Co., Ltd. (Wenchang, Hainan Province, China). Before the experiment, L. vannamei were temporarily raised for two weeks at 28 ± 1 °C, pH 7.5 ± 0.7, and dissolved oxygen > 5 mg L−1. The shrimp were fed with pellet feed three times a day (crude protein 43%, Jiangsu Changshou Group Nanshan Biotechnology Co., Ltd., Rugao, Jiangsu Province, China). The salinity was adjusted according to the following method: artificial sea salt powder (Shanghai Baojia Industry & Trade Co., Ltd., Shanghai, China) and marine elements supplement (Shanghai Blue Sea aquatic Products Development Co., Ltd., Shanghai, China) were added to fully aerated tap water. After being adjusted to the target salinity and stabilizing, healthy L. vannamei with an initial mean body length of 5.06 ± 0.29 cm and initial mean body weight of 0.65 ± 0.13 g were selected for the experiment (50 shrimp per tank). The shrimp were fed three times per day. During the experiment, water was not exchanged, and only the small amount of water lost due to sewage and evaporation was replaced irregularly.

2.2. Sampling and Measurement

2.2.1. Water Quality Parameters

During the experiment, water temperature, dissolved oxygen, pH, and salinity of the culture water were measured daily using water quality instruments (YSI-550A, Yellow Springs Instruments Inc., OH, USA; AZ8371, Hengxin Technological Co., Ltd., Guangzhou, China). The contents of total ammonia nitrogen, nitrite nitrogen, and nitrate nitrogen were measured once a week. Water samples (100 mL) were collected from all tanks and then filtered through a 0.45 μm filtration membrane for determination of total ammonia nitrogen, nitrite nitrogen, and nitrate nitrogen according to standard methods [33].

2.2.2. Growth, Muscle Composition, Digestive Enzyme Activity, and Antioxidant and Immune status

After the experiment, L. vannamei were fasted for 24 h and then were counted and weighed. Three individuals were anesthetized in an ice bath from each tank, and then hemolymph was taken using a nonheparinized tuberculin syringe. After clotting at 4 °C for one night and centrifuging at 7000 r/g at 4 °C for 15 min, serum samples were stored in a refrigerator at −80 °C for the determination of antioxidant and immune activities. The L. vannamei were then dissected on an ice tray immediately after hemolymph collection. The muscle, hepatopancreas, and intestinal tissues were obtained and placed in the refrigerator at −80 °C. These tissues were used for the determination of muscle composition, hepatopancreas antioxidant and immune activities, and intestinal digestive enzyme activities, respectively.
The contents of moisture, crude protein, crude lipid, and ash in shrimp muscle were determined according to standard measurement methods (GB/T 5009.3-2003, GB/T 6432-1994, GB/T 6433-2006, and GB/T 6438-2007, respectively). Serum and hepatopancreas superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPX), total antioxidant capacity (T-AOC), lysozyme (LZM), acid phosphatase (ACP), and alkaline phosphatase (AKP) were measured using commercial assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu Province, China) following the manufacturer’s protocols. In addition, intestinal digestive enzyme activities (amylase, lipase, and trypsin) were also measured using such commercial assay kits.

2.2.3. Microbial Community Analysis

Fifty-milliliter water samples were taken from all tanks, filtered, and then stored at −80 °C for the analysis of the microbial community in the biofloc after the experiment. In addition, five shrimp were taken from each tank and disinfected with 75% alcohol on the body surface. Then, the shrimp were washed with sterile water, and the intestinal contents were removed into 2 mL sterile centrifuge tubes that were then stored at −80 °C for the analysis of the intestinal microbial community.
A Fast DNA Spin Kit for Soil (MP Biomedicals, Irvine, CA, USA) was used to extract total genomic DNA from all samples. The purity of extracted genomic DNA was determined using an ultrafine spectrophotometer (NanoDrop2000, Thermo Fisher Scientific, Waltham, MA, USA). PCR amplification of 16S rRNA (the 16S V3-V4 hypervariable region) was carried out using primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT). The PCR reaction mixture as well as the amplification procedure followed those of Liu et al. [34]. Each sample had three replicates. The PCR products were extracted, purified, and quantified.
Sequencing was performed on an Illumina Miseq PE300 platform (Illumina, San Diego, CA, USA). The original sequences were controlled and spliced according to fastp and FLASH, respectively. UPARSE 7.1 software was used to carry out operational taxonomic units (OTUs) clustering on the quality-controlled spliced sequences according to 97% similarity, and chimeras were removed. The sequences were compared with the bacterial SILVA database by the RDP classifier, and OTUs species taxonomic annotation was performed.
Data analysis was performed via the Majorbio Cloud platform. Alpha diversity indices (Simpson index, Shannon index, Chao1, and ACE) were calculated by Mothur v1.30.1 software. Principal coordinate analysis (PCoA) based on the Bray–Curtis distance algorithm was used to test the similarity of microbial community structures among samples. Linear discriminant analysis (LDA) effect size (LEfSe) was used to determine the significantly abundant taxa (phylum to genus levels) of bacteria in different groups (the LDA threshold was set to 4).

2.3. Calculations and Statistics

In this study, data analysis was performed using SPSS 18.0. Before analyses, data were checked for normality and homogeneity of variances with Levine’s test. One-way ANOVA followed by Duncan’s multiple range test was used for significance detection. Differences were considered significant at p < 0.05.
Growth performance was evaluated by the following calculation formulas [16]:
Survival   rate   % = 100 ×   harvested   number / stocking   number ,
Weight   gain   WG ;   % = 100 × FW   −   IW / IW ,
Specific   growth   rate   SGR ;   %   day − 1 = 100 × Ln   FW   −   Ln   IW / culture   days ,
where FW = final weight and IW = initial weight.

3. Results

3.1. Water Quality Parameters

The water quality parameters were similar in all treatments (p > 0.05), including temperature at 27.75–28.36 °C, dissolved oxygen at 6.53–6.62 mg L−1, and pH at 7.90–7.92. In addition, these water quality parameters were suitable for shrimp culture.
Total ammonia nitrogen showed a trend of first rising and then declining (Figure 1a). Nitrite concentration fluctuated during the first two weeks; the concentration of nitrite in the S15 group was initially higher than in other groups and then stabilized, while the concentration of nitrite in the S5 group was lower overall (Figure 1b). The concentration of nitrate nitrogen in different groups showed a rapidly rising trend during the first two weeks, then became stable from the third week (Figure 1c).

3.2. Growth and Muscle Composition

As can be seen in Table 1, no significant differences in growth performance were found among the groups (p > 0.05). The specific growth rate and survival rate of shrimp in different low-salinity groups were 7.25–7.41% day−1 and 78.34–81.22%, respectively.
Table 2 shows the muscle composition of shrimp in different low-salinity groups. Moisture, crude protein, and crude lipid contents did not differ among groups (p > 0.05). The S10 group had a higher ash content than the S5 and S15 groups (p < 0.05).

3.3. Digestive Enzyme Activity

The activities of amylase, lipase, and trypsin in the intestines of shrimp are shown in Figure 2 (colors in all the figures have no real meaning). The intestinal amylase activity of L. vannamei in the S5 and S10 groups was significantly higher, by 141% and 132%, respectively, than that in the S15 group (p < 0.05). In addition, intestinal lipase activity did not differ significantly among groups (p > 0.05). Trypsin activity in the intestines of L. vannamei was notably higher in the S5 group compared to the S10 and S15 groups (p < 0.05), increasing by 163% and 274%, respectively.

3.4. Antioxidant and Immune Status of Shrimp

Antioxidant capacities of the shrimp are presented in Figure 3. The serum SOD and T-AOC activities of shrimp in the S15 group were significantly higher than those in the S5 group (p < 0.05). In hepatopancreas, SOD activity was elevated significantly with the increase in salinity (p < 0.05). In the S10 and S15 groups, CAT activity was significantly greater than in the S5 group (p < 0.05). T-AOC in the S15 group was notably higher than in the S10 and S5 groups (p < 0.05). GPX activities showed no significant differences in serum or hepatopancreas among groups (p > 0.05).
Figure 4 shows the immune status of shrimp at the end of the experiment. Serum LZM activity of L. vannamei had no significant difference among groups, but the hepatopancreatic LZM activity of shrimp in the S10 group was significantly higher than that in the S5 group (p < 0.05). Serum ACP and AKP activities of L. vannamei in the S15 group were significantly higher than those in the S10 and S5 groups (p < 0.05), but no significant difference was demonstrated in the hepatopancreas (p > 0.05).

3.5. Microbial Analysis

3.5.1. Composition of the Microbial Community

A total of 928,671 effective sequences were acquired from 18 samples after deculturization, quality control, and removal of chimeras. Each sample had an average of 51,593 sequences. The coverage rate per sample was more than 99%, indicating that the sequencing depth was good. The effective sequences were clustered into 1579 OTUs according to 97% similarity. As shown in Figure 5, 87 OTUs were shared by all groups. Except for the biofloc sample in the S10 group (WS10), all of the samples had a decreased number of OTUs with the increase in salinity. In addition, the number of OTUs in biofloc samples was higher than that in the intestine of L. vannamei, except for the intestine sample of shrimp in the S5 group (CS5).

3.5.2. Diversity of the Microbial Community

The α-diversity analysis demonstrated that the Shannon index of the biofloc sample in the S10 group was significantly higher compared to other biofloc samples (p < 0.05, Table 3). Furthermore, the index value of the biofloc samples was higher than that of the intestine samples. The Simpson index of the biofloc sample in the S5 group was the highest (p < 0.05), whereas no significant difference in diversity was found in the intestines of the shrimp. The richness indices (Chao1 and ACE) for the S5 group were significantly higher than those for the S15 group, and the values as well as variation of biofloc samples were generally higher than those of intestinal samples (Table 3). PCoA analysis of β-diversity showed differences in microbial community composition between biofloc and intestine samples under different salinity conditions (Figure 6a).
Proteobacteria was the dominant phylum in each group, accounting for 71.86–95.91% (Figure 6b). The top three predominant phyla in biofloc samples of each group were Proteobacteria, Actinobacteria, and Bacteroidetes. However, in intestine samples, Proteobacteria, Actinomycetes, and Firmicutes were the top three phyla. A heatmap was constructed to characterize the relative abundances of the first 35 genera detected in biofloc and shrimp intestine samples of each group (Figure 6c). The abundance of Vibrio in biofloc and shrimp intestine samples was highest in the S15 group. In addition, LEfSe analysis showed that there were ten and nine biomarkers with significantly higher relative abundance in biofloc samples of the S5 and S10 groups, as well as seven, two, and five biomarkers in the intestine samples of the S5, S10, and S15 groups, respectively (Figure 6d). However, no biomarkers were found in biofloc samples of the S15 group. The biomarkers of biofloc samples in the S5 group included Rhodobacterales, Rhodobacteraceae, and Paracoccus. Vibrionaceae, Vibrionales, and Vibrio were the biomarkers in the intestine samples of the S15 group; these are potential pathogens of fish and shellfish.

4. Discussion

4.1. Water Quality

Total ammonia nitrogen and nitrite nitrogen are toxic to aquatic animals; they can inhibit growth and even lead to death [35]. In this study, the average concentrations of water quality parameters were all within accepted safe ranges. Biofloc was formed and gradually stabilized in about 15 days [36]. The biofloc can transform inorganic nitrogen into organic nitrogen, thereby regulating water quality in aquaculture systems. This was in accordance with our study, in which the total ammonia nitrogen concentration increased continuously during the first two weeks and then gradually decreased. The concentration of nitrate nitrogen in BFT culture systems generally shows an increasing trend [37,38]. According to the study of Ebeling et al. [39], organic nitrogen such as residual feed in culture systems and protein in the feces of farming objects will be degraded with the successive production of ammonia, nitrite, and nitrate [39]. High amounts of total ammonia nitrogen and nitrite nitrogen appear successively, followed by the continuous accumulation of nitrate. This pattern is similar to the results of the present experiment.

4.2. Growth and Muscle Composition

This work showed no significant difference in the growth of L. vannamei among different salinity groups. Maicá et al. [32] found that the growth of L. vannamei in BFT systems with 25.0‰ salinity was notably higher than those with 2.0‰ and 4.0‰ salinity. Ponce-Palafox et al. [27] demonstrated that the growth performance of L. vannamei was elevated with the increase in salinity (10.0‰, 20.0‰, and 30.0‰), and the values of survival rate and SGR at a salinity of 30‰ were higher compared to this experiment. However, the lower-salinity (5‰) rearing with BFT did not show significantly lower growth than that under the salinity of 30‰ in the case of Penaeus indicus postlarvae [40]. Such differences may have been caused by various culture conditions, including different carbon sources, the C/N ratio, the number of culture days, and shrimp growth stages [14].
As the salinity of the aquaculture water increases, moisture content in the muscle of L. vannamei decreases [41]. This is because L. vannamei belongs to the group of euryhaline shrimp that can adapt to the changes in environmental salinity through hemolymph osmosis and ion regulation: when the salinity is high, the shrimp can expel water; when salinity is low, water is absorbed to maintain isotonicity with the external environment, thus maintaining a stable state [42]. In this study, the muscle moisture contents of the three different salinity groups showed no significant difference; however, the S5 group exhibited a slightly higher content of muscle moisture than the S10 and S15 groups did. In the BFT systems, studies on L. vannamei [43] showed that their crude lipid content was notably higher compared to that of the control group, a result that may have been due to biofloc in these systems containing a certain amount of lipid [38]. This experiment showed no significant differences in the contents of crude protein or crude lipid in the muscle of L. vannamei under three different low-salinity conditions. This indicates that salinity may not have a notable effect on the composition of the biofloc. Therefore, it may not play a role in the contents of crude protein or crude lipid of cultured aquatic animals. In addition, Li et al. [41] found that the lower the moisture content in L. vannamei, the higher the ash content. This study also found that the S10 group exhibited a slightly lower muscle moisture content than the S5 and S15 groups, while the ash content was relatively higher in the S10 group. The ash content is composed of inorganic substances such as mineral oxides or salts. The higher muscle ash content of the S10 group may indicate that the mineral content was relatively high. Thus, minerals could participate in the regulation of osmotic pressure.

4.3. Digestive Enzyme Activity

Digestive enzymes are closely related to growth and thus directly affect the digestive capacity of cultured animals [44]. Among the digestive enzymes, amylase and protease play essential roles in the digestion of carbohydrate and protein [45]. When aquatic animals are stressed by salinity, they need energy for osmoregulation. Researchers have shown that glucose, amino acids, and lipids can be used as energy sources for the osmotic regulation of aquatic animals [46,47,48]. Li et al. [49] found that the trypsin activity of shrimp was elevated during low-salinity stress. In addition, biofloc contains digestive enzymes such as amylase, lipase, and protease that can improve the digestive ability of cultured animals [9,12,50]. Biofloc can also stimulate the secretion of more endogenous digestive enzymes [51]. Therefore, we speculate that the significantly increased intestinal amylase and trypsin activities of L. vannamei in the S5 group may have been due to the higher digestive enzyme activity obtained by eating more biofloc in the culture system. The shrimp in this group improved their intestinal amylase and trypsin activities, thereby producing more glucose and amino acids under low-salinity pressure to provide energy and maintain osmotic pressure balance.

4.4. Antioxidant and Immune Status

Shrimp have a lipid soluble antioxidant system (LSAS) [52]. In this system, SOD has an important role in maintaining the metabolic balance of ROS [53], and T-AOC reflects the shrimp antioxidant defense capacity [54]. In addition, the antioxidant capacity of shrimp is closely related to the immune system [9]. LZM, ACP, and AKP are hydrolytic enzymes that can resist pathogens and kill or digest microorganisms during the immune response process [55,56]. In this work, SOD, CAT, and T-AOC, along with ACP and AKP, increased significantly in the S15 group, and these results were consistent with the notably enriched Vibrio in the biofloc and the intestines of shrimp in the S15 group (Figure 6c,d). Vibrio is a normal component of the flora in the gut of shrimp that is conducive to the metabolism and utilization of carbon sources. However, some Vibrio species are conditional pathogenic bacteria and could affect the health of the shrimp when they multiply in large numbers for some reason [57]; this usually causes considerable economic losses [58].

4.5. Microbial Analysis

Shannon and Simpson indices are good indicators of bacterial diversity, while Chao1 and ACE are good indicators of bacterial richness [59]. In this study, the overall bacterial richness and diversity indices were high in the S5 group compared to other groups (Table 3), and the richness and diversity of biofloc samples were higher than those of intestine samples, indicating that changes in salinity would alter the richness and diversity of bacteria in biofloc samples and thus affect the intestinal flora of shrimp.
The first five bacterial groups with an abundance greater than 1% were found in different salinity groups: Proteobacteria, Actinobacteria, Bacteroidetes, Firmicutes, and Patescibacteria (Figure 6b). Most of these phyla exist widely in biofloc systems [13,60,61,62] and are considered to possess some ecological and functional characteristics [60]. Among all such groups, Proteobacteria was the dominant phylum, accounting for more than 70%. This phylum is widely distributed in marine environments; it can be used to remove organic matter from BFT culture systems, thus regulating water quality effectively [63,64]. In this study, with respect to the genus, the abundance of Vibrio was significantly higher in the S15 group than in the S5 and S10 groups (Figure 6c), and this finding was similar to that of Hosain et al. [14]. It may be that Vibrio is more suited to surviving in brackish/marine habitats [65,66].
In addition, Rhodobacteraceae and Paracoccus were the main biomarkers in biofloc samples in the S5 group. Rhodobacteraceae is considered to be an excellent biofilm-forming organism with a variety of metabolic activities [67], and it can often be found in aquaculture biofilm systems [68]. It may form an antagonistic beneficial microbial community in culture systems, thus limiting the survival rate of pathogenic bacteria [69]. This may be one of the reasons why there were fewer Vibrio in the S5 group in this study. Furthermore, Paracoccus, a denitrifying bacterium, can help reduce nitrate to molecular nitrogen [13]. It is because of the existence of these microorganisms that the water quality of rearing system remains good.

5. Conclusions

L. vannamei cultured under three different salinity conditions (5.0‰, 10.0‰, and 15.0‰) in BFT was examined in this study. The water parameters measured in this study were within the acceptable ranges for L. vannamei. No significant differences in growth parameters were found among the three groups. L. vannamei cultured in BFT with a salinity of 5‰ had lower antioxidant and immune levels. However, the digestive enzyme activity, microbial diversity, and microbial richness of L. vannamei in this group were significantly higher than those of other groups. These findings suggest the possible application of rearing L. vannamei at low salinity in BFT systems.

Author Contributions

Conceptualization, H.L.; methodology, S.L. and H.L.; software, L.L.; validation, H.L.; formal analysis, L.L.; investigation, H.L.; resources, H.L.; data curation, L.L.; writing—original draft preparation, L.L.; writing—review and editing, L.L., S.L. and H.L.; supervision, H.L.; project administration, L.L. and H.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the earmarked fund for CARS 48 and Central Public-interest Scientific Institution Basal Research Fund, FMIRI of CAFS (NO. 2018YJS006).

Institutional Review Board Statement

The experiment conforms to the regulations and guidelines formulated by the Animal Protection and Use Committee of the Fishery Machinery and Instrument Research Institute, Chinese Academy of Fishery Sciences. The approval number is FMIRI-AWE-2021-002, and approval was given on 26 May 2021.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Avnimelech, Y. Feeding with microbial flocs by tilapia in minimal discharge bioflocs technology ponds. Aquaculture 2007, 264, 140–147. [Google Scholar] [CrossRef]
  2. Khanjani, M.H.; Sharifinia, M. Biofloc technology as a promising tool to improve aquaculture production. Rev. Aquac. 2020, 12, 1836–1850. [Google Scholar] [CrossRef]
  3. Avnimelech, Y. Carbon nitrogen ratio as a control element in aquaculture systems. Aquaculture 1999, 176, 227–235. [Google Scholar] [CrossRef]
  4. De Schryver, P.; Crab, R.; Defoirdt, T.; Boon, N.; Verstraete, W. The basics of bio-flocs technology: The added value for aquaculture. Aquaculture 2008, 277, 125–137. [Google Scholar] [CrossRef]
  5. Zhao, P.; Huang, J.; Wang, X.; Song, X.; Yang, C.; Zhang, X.; Wang, G. The application of bioflocs technology in high-intensive, zero exchange farming systems of Marsupenaeus japonicus. Aquaculture 2012, 354–355, 97–106. [Google Scholar] [CrossRef]
  6. Burford, M.A.; Thompson, P.J.; McIntosh, R.P.; Bauman, R.H.; Pearson, D.C. The contribution of flocculated material to shrimp (Litopenaeus vannamei) nutrition in a high-intensity, zero-exchange system. Aquaculture 2004, 232, 525–537. [Google Scholar] [CrossRef]
  7. Xu, W.J.; Pan, L.Q.; Sun, X.H.; Huang, J. Effects of bioflocs on water quality, and survival, growth and digestive enzyme activities of Litopenaeus vannamei (Boone) in zero-water exchange culture tanks. Aquac. Res. 2012, 44, 1093–1102. [Google Scholar] [CrossRef]
  8. Ju, Z.Y.; Forster, I.; Con Quest, L.; Dominy, W. Enhanced growth effects on shrimp (Litopenaeus vannamei) from inclusion of whole shrimp floc or floc fractions to a formulated diet. Aquac. Nutr. 2008, 14, 533–543. [Google Scholar] [CrossRef]
  9. Xu, W.J.; Pan, L.Q. Enhancement of immune response and antioxidant status of Litopenaeus vannamei juvenile in biofloc-based culture tanks manipulating high C/N ratio of feed input. Aquaculture 2013, 412–413, 117–124. [Google Scholar] [CrossRef]
  10. Ekasari, J.; Azhar, M.H.; Surawidjaja, E.H.; Nuryati, S.; De Schryver, P.; Bossier, P. Immune response and disease resistance of shrimp fed biofloc grown on different carbon sources. Fish Shellfish Immunol. 2014, 41, 332–339. [Google Scholar] [CrossRef]
  11. Kim, S.K.; Pang, Z.G.; Seo, H.C.; Cho, Y.R.; Samocha, T.; Jang, I.K. Effect of bioflocs on growth and immune activity of Pacific white shrimp. Aquac. Res. 2014, 45, 362–371. [Google Scholar] [CrossRef]
  12. Xu, W.J.; Pan, L.Q. Dietary protein level and C/N ratio manipulation in zero-exchange culture of Litopenaeus vannamei: Evaluation of inorganic nitrogen control, biofloc composition and shrimp performance. Aquac. Res. 2014, 45, 1842–1851. [Google Scholar]
  13. Jiang, W.; Ren, W.; Li, L.; Dong, S.; Tian, X. Light and carbon sources addition alter microbial community in biofloc-based Litopenaeus vannamei culture systems. Aquaculture 2020, 515, 734572. [Google Scholar] [CrossRef]
  14. Hosain, M.E.; Amin, S.M.N.; Salleh, K.M.; Arshad, A.; Karim, M.; Romano, N. Effect of salinity on growth, survival, and proximate composition of Macrobrachium rosenbergii post larvae as well as zooplankton composition reared in a maize starch based biofloc system. Aquaculture 2021, 533, 736235. [Google Scholar] [CrossRef]
  15. Crab, R.; Kochva, M.; Verstraete, W.; Avnimelech, Y. Bio-flocs technology application in over-wintering of tilapia. Aquac. Eng. 2009, 40, 105–112. [Google Scholar] [CrossRef]
  16. Long, L.N.; Yang, J.; Li, Y.; Guan, C.W.; Fan, W. Effect of biofloc technology on growth, digestive enzyme activity, hematology, and immune response of genetically improved farmed tilapia (Oreochromis niloticus). Aquaculture 2015, 448, 135–141. [Google Scholar] [CrossRef]
  17. Aliabad, H.S.; Naji, A.; Mortezaei, S.R.S.; Sourinejad, I.; Akbarzadeh, A. Effects of restricted feeding levels and stocking densities on water quality, growth performance, body composition and mucosal innate immunity of Nile tilapia (Oreochromis niloticus) fry in a biofloc system. Aquaculture 2022, 546, 737320. [Google Scholar] [CrossRef]
  18. Adineh, H.; Naderi, M.; Hamidi, M.K.; Harsij, M. Biofloc technology improves growth, innate, oxidative status, and resistance to acute stress in common carp (Cyprinus carpio) under high stocking density. Fish Shellfish Immunol. 2019, 95, 440–448. [Google Scholar] [CrossRef]
  19. Qian, D.W.; Xu, C.; Chen, C.Z.; Qin, J.G.; Chen, L.Q.; Li, E.C. Toxic effect of chronic waterborne copper exposure on growth, immunity, anti-oxidative capacity and gut microbiota of Pacific white shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 2020, 100, 445–455. [Google Scholar] [CrossRef]
  20. Zhang, Z.; Yang, Z.W.; Ge, H.; Chen, H.H.; Zhuo, X.H. Effects of different carbon sources on the biofloc formation, nutritional ingredients and bacterial community and water quality in Litopenaeus vannamei culture tank. J. Fish. China 2019, 43, 639–649. [Google Scholar]
  21. Roy, L.A.; Davis, D.A.; Saoud, I.P.; Boyd, C.A.; Pine, H.J.; Boyd, C.E. Shrimp culture in inland low salinity waters. Rev. Aquac. 2010, 2, 191–208. [Google Scholar] [CrossRef]
  22. Browdy, C.L.; Moss, S.M. Shrimp culture in urban, super-intensive closed systems. In Urban Aquaculture; CABI: Oxfordshire, UK, 2005; pp. 173–186. [Google Scholar]
  23. Hosain, M.E.; Amin, S.M.N.; Arshad, A.; Kamarudin, M.S.; Karim, M. Effects of carbon sources on the culture of giant river prawn in biofloc system during nursery phase. Aquac. Rep. 2012, 19, 100607. [Google Scholar] [CrossRef]
  24. Ray, A.J.; Lotz, J.M. Comparing salinities of 10, 20, and 30‰ in intensive, commercial-scale biofloc shrimp (Litopenaeus vannamei) production systems. Aquaculture 2017, 476, 29–36. [Google Scholar] [CrossRef]
  25. Esparza-Leal, H.M.; Amaral Xavier, J.A.; Wasielesky, W., Jr. Performance of Litopenaeus vannamei postlarvae reared in indoor nursery tanks under biofloc conditions at different salinities and zero-water exchange. Aquac. Int. 2016, 24, 1435–1447. [Google Scholar] [CrossRef]
  26. Lobato, O.S.C.; de Azevedo Silva Ribeiro, F.; Miranda-Baeza, A.; Emerenciano, M.G.C. Production performance of Litopenaeus vannamei (Boone, 1931) fed with different dietary levels of tilapia processing waste silage reared in biofloc system using two carbon sources. Aquaculture 2019, 501, 515–518. [Google Scholar] [CrossRef]
  27. Ponce-Palafox, J.T.; Alcala Pavia, A.; Mendoza Lopez, D.G.; Luis Arredondo-Figueroa, J.; Lango-Reynoso, F.; del Refugio Castaneda-Chavez, M.; Esparza-Leal, H.; Ruiz-Luna, A.; Paez-Ozuna, F.; Castillo-Vargasmachuca, S.G.; et al. Response surface analysis of temperature-salinity interaction effects on water quality, growth and survival of shrimp Penaeus vannamei postlarvae raised in biofloc intensive nursery production. Aquaculture 2019, 503, 312–321. [Google Scholar] [CrossRef]
  28. Huang, H.H.; Li, C.Y.; Song, Y.; Lei, Y.J.; Yang, P.H. Growth performance of shrimp and water quality in a freshwater biofloc system with a salinity of 5.0‰: Effects on inputs, costs and wastes discharge during grow-out culture of Litopenaeus vannamei. Aquac. Eng. 2022, 98, 102265. [Google Scholar] [CrossRef]
  29. Huang, H.H.; Liao, H.M.; Lei, Y.J.; Yang, P.H. Effects of different carbon sources on growth performance of Litopenaeus vannamei and water quality in the biofloc system in low salinity. Aquaculture 2022, 546, 737239. [Google Scholar] [CrossRef]
  30. Moreno-Arias, A.; Lopez-Elias, J.A.; Miranda-Baeza, A.; Rivas-Vega, M.E.; Martinez-Cordova, L.R.; Ramirez-Suarez, J.C. Replacement of fishmeal by vegetable meal mix in the diets of Litopenaeus vannamei reared in low-salinity biofloc system: Effect on digestive enzymatic activity. Aquac. Nutr. 2017, 23, 236–245. [Google Scholar] [CrossRef]
  31. Ray, A.J.; Dillon, K.S.; Lotz, J.M. Water quality dynamics and shrimp (Litopenaeus vannamei) production in intensive, mesohaline culture systems with two levels of biofloc management. Aquac. Eng. 2011, 45, 127–136. [Google Scholar] [CrossRef]
  32. Maicá, P.F.; Borba, M.R.D.; Wasielesky, W., Jr. Effect of low salinity on microbial floc composition and performance of Litopenaeus vannamei (Boone) juveniles reared in a zero-water-exchange super-intensive system. Aquac. Res. 2012, 43, 361–370. [Google Scholar] [CrossRef]
  33. Luo, G.Z.; Gao, Q.; Wang, C.H.; Liu, W.C.; Sun, D.C.; Li, L.; Tan, H.X. Growth, digestive activity, welfare, and partial cost-effectiveness of genetically improved farmed tilapia (Oreochromis niloticus) cultured in a recirculating aquaculture system and an indoor biofloc system. Aquaculture 2014, 422–423, 1–7. [Google Scholar] [CrossRef]
  34. Liu, W.C.; Ke, H.Y.; Xie, J.; Tan, H.X.; Luo, G.Z.; Xu, B.; Abakari, G. Characterizing the water quality and microbial communities in different zones of a recirculating aquaculture system using biofloc biofilters. Aquaculture 2020, 529, 735624. [Google Scholar] [CrossRef]
  35. Huang, M.X.; Xie, J.; Yu, Q.R.; Xu, C.; Zhou, L.; Qin, J.G.; Chen, L.Q.; Li, E.C. Toxic effect of chronic nitrite exposure on growth and health in Pacific white shrimp Litopenaeus vannamei. Aquaculture 2020, 529, 735664. [Google Scholar] [CrossRef]
  36. Xia, Y.; Yu, E.M.; Xie, J.; Yu, D.G.; Wang, G.J.; Li, Z.F.; Wang, H.Y.; Gong, W.B. Analysis of bacterial community structure of biofloc by PCR-DGGE. J. Fish. China 2012, 36, 1563–1571. [Google Scholar] [CrossRef]
  37. Avnimelech, Y.; Kochba, M. Evaluation of nitrogen uptake and excretion by tilapia in biofloc tanks, using 15N tracing. Aquaculture 2009, 287, 163–168. [Google Scholar] [CrossRef]
  38. Krummenauer, D.; Samocha, T.; Poersch, L.; Lara, G.; Wasielesky, W., Jr. The reuse of water on the culture of pacific white shrimp, Litopenaeus vannamei, in BFT system. J. World Aquac. Soc. 2014, 45, 3–14. [Google Scholar] [CrossRef]
  39. Ebeling, J.M.; Timmons, M.B.; Bisogni, J.J. Engineering analysis of the stoichiometry of photoautotrophic, autotrophic, and heterotrophic removal of ammonia-nitrogen in aquaculture systems. Aquaculture 2006, 257, 346–358. [Google Scholar] [CrossRef]
  40. Das, R.R.; Panigrahi, A.; Sarkar, S.; Saravanan, A.; Biju, I.F.; Ambikanandham, K.; Jayanthi, M.; Kannappan, S. Growth, survival, and immune potential of post larvae of Indian white shrimp, Penaeus indicus (H. Milne Edwards, 1937) in different salinities with biofloc system (BFT) during nursery phase. Aquacult Int. 2023, 31, 273–293. [Google Scholar] [CrossRef]
  41. Li, X.; Wang, X.L.; Wang, Y.; Jiang, X.D.; Li, H.Y.; Liu, T.H.; Wu, Z.H.; Ji, L. Effects of different salinities on nutritional composition in muscle of Litopenaeus vannamei. J. Agric. Sci. Technol. 2020, 22, 130–137. [Google Scholar]
  42. Panikkar, N.K. Osmotic behavior of shrimps and prawns in relation to their biology and culture. FAO Fish. Rep. 1968, 57, 527–538. [Google Scholar]
  43. Izquierdo, M.; Forster, I.; Divakaran, S.; Conquest, L.; Decamp, O. Effect of green and clear water and lipid source on survival, growth and biochemical composition of pacific white shrimp Litopenaeus vannamei. Aquac. Nutr. 2006, 12, 192–202. [Google Scholar] [CrossRef]
  44. Abolfathi, M.; Hajimoradloo, A.; Ghorbani, R.; Zamani, A. Effect of starvation and refeeding on digestive enzyme activities in juvenile roach, Rutilus rutilus caspicus. Comp. Biochem. Physiol. A Physiol. 2012, 161, 166–173. [Google Scholar] [CrossRef] [PubMed]
  45. Zhou, L.; Zhang, J.S.; Yan, M.Z.; Tang, S.S.; Wang, X.D.; Qin, J.G.; Chen, L.Q.; Li, E.C. Inulin alleviates hypersaline-stress induced oxidative stress and dysbiosis of gut microbiota in Nile tilapia (Oreochromis niloticus). Aquaculture 2020, 529, 735681. [Google Scholar] [CrossRef]
  46. Shinji, J.; Okutsu, T.; Jayasankar, V.; Jasmani, S.; Wilder, M.N. Metabolism of amino acids during hyposmotic adaptation in the whiteleg shrimp, Litopenaeus vannamei. Amino Acids 2012, 43, 1945–1954. [Google Scholar] [CrossRef] [PubMed]
  47. Wang, X.; Li, E.; Qin, J.G.; Wang, S.; Chen, X.; Cai, Y.; Chen, K.; Hou, Y.; Yu, N.; Zhang, M.; et al. Growth, body composition, and ammonia tolerance of juvenile white shrimp Litopenaeus vannamei fed diets containing different carbohydrate levels at low salinity. J. Shellfish Res. 2014, 33, 511–517. [Google Scholar] [CrossRef]
  48. Abou Anni, I.S.; Bianchini, A.; Barcarolli, I.F.; Junior, A.S.V.; Robaldo, R.B.; Tesser, M.B.; Sampaio, L.A. Salinity influence on growth, osmoregulation and energy turnover in juvenile pompano Trachinotus marginatus Cuvier 1832. Aquaculture 2016, 455, 63–72. [Google Scholar] [CrossRef]
  49. Li, E.C.; Chen, L.Q.; Zeng, C.; Yu, N.; Xiong, Z.Q.; Chen, X.F.; Qin, J.G. Comparison of digestive and antioxidant enzymes activities, haemolymph oxyhemocyanin contents and hepatopancreas histology of white shrimp, Litopenaeus vannamei, at various salinities. Aquaculture 2008, 274, 80–86. [Google Scholar] [CrossRef]
  50. Wasielesky, W.; Atwood, H.; Stokes, A.; Browdy, C.L. Effect of natural production in a zero exchange suspended microbial floc based super-intensive culture system for white shrimp Litopenaeus vannamei. Aquaculture 2006, 258, 396–403. [Google Scholar] [CrossRef]
  51. Anand, P.S.S.; Kohli, M.P.S.; Kumar, S.; Sundaray, J.K.; Roy, S.D.; Venkateshwarlu, G.; Sinha, A.; Pailan, G.H. Effect of dietary supplementation of biofloc on growth performance and digestive enzyme activities in Penaeus monodon. Aquaculture 2014, 418, 108–115. [Google Scholar] [CrossRef]
  52. Montalvo, G.; Campos, S.; Arenas, M.; Barreto, A.; Escalante, K.; Cuzon, G.; Gaxiola, G. Immune gene expression and antioxidant response to vitamin E enriched diets for males Litopenaeus vannamei breeder (Boone, 1931). Comp. Biochem. Physiol. Part A 2022, 268, 111187. [Google Scholar] [CrossRef] [PubMed]
  53. Campa-Córdova, A.I.; Hernández-Saavedra, N.Y.; Ascencio, F. Superoxide dismutase as modulator of immune function in American white shrimp (Litopenaeus vannamei). Comp. Biochem. Physiol. Part C 2002, 33, 557–565. [Google Scholar] [CrossRef] [PubMed]
  54. Yu, Z.; Wu, X.Q.; Zheng, L.J.; Dai, Z.Y.; Wu, L.F. Effect of acute exposure to ammonia and BFT alterations on Rhynchocypris lagowski: Digestive enzyme, inflammation response, oxidative stress and immunological parameters. Environ. Toxicol. Phar. 2020, 78, 103380. [Google Scholar] [CrossRef] [PubMed]
  55. Defoiedt, T.; Boon, N.; Soegeloos, P.; Verstraete, W.; Bossier, P. Alternatives to antibiotics to control bacterial infections: Luminescent vibriosis in aquaculture as an example. Trends Biotechnol. 2007, 25, 472–479. [Google Scholar] [CrossRef] [PubMed]
  56. Zhou, X.; Tian, Z.; Wang, Y. Effect of treatment with probiotics as water additives on tiapia (Oreochomis niloticus) growth performance and immune response. Fish Physiol Biochem. 2010, 36, 501–509. [Google Scholar] [CrossRef] [PubMed]
  57. Karunasagar, I.; Pai, R.; Malathi, G.R.; Karunasagar, I. Mass mortality of Penaeus monodon larvae due to antibiotic-resistant Vibrio harveyi infection. Aquaculture 1994, 128, 203–209. [Google Scholar] [CrossRef]
  58. Tran, L.; Nunan, L.; Redman, R.M.; Mohney, L.L.; Pantoja, C.R.; Fitzsimmons, K.; Lightner, D.V. Determination of the infectious nature of the agent of acute hepatopancreatic necrosis syndrome affecting penaeid shrimp. Dis. Aquat. Org. 2013, 105, 45–55. [Google Scholar] [CrossRef] [PubMed]
  59. Xu, W.; Xu, Y.; Huang, X.; Hu, X.; Xu, Y.; Su, H.; Li, Z.; Yang, K.; Wen, G.; Cao, Y. Addition of algicidal bacterium CZBC1 and molasses to inhibit cyanobacteria and improve microbial communities, water quality and shrimp performance in culture systems. Aquaculture 2019, 502, 303–311. [Google Scholar] [CrossRef]
  60. Luo, G.Z.; Chen, X.Q.; Tan, J.H.; Abakari, G.; Tan, H.X. Effects of carbohydrate addition strategy and biofloc levels on the establishment of nitrification in biofloc technology aquaculture systems. Aquaculture 2020, 514, 734441. [Google Scholar] [CrossRef]
  61. Cardona, E.; Gueguen, Y.; Magré, K.; Lorgeoux, B.; Piquemal, D.; Pierrat, F.; Noguier, F.; Saulnier, D. Bacterial community characterization of water and intestine of the shrimp Litopenaeus stylirostris in a biofloc system. BMC Microbiol. 2016, 16, 157. [Google Scholar] [CrossRef]
  62. Deng, Y.; Xu, X.; Yin, X.; Lu, H.; Chen, G.; Yu, J.; Ruan, Y. Effect of stock density on the microbial community in biofloc water and Pacific white shrimp (Litopenaeus vannamei) gut microbiota. Appl. Microbiol. Biotechnol. 2019, 103, 4241–4252. [Google Scholar] [CrossRef] [PubMed]
  63. Miura, Y.; Hiraiwa, M.N.; Ito, T.; Itonaga, T.; Watanabe, Y.; Okabe, S. Bacterial community structures in MBRs treating municipal wastewater: Relationship between community stability and reactor performance. Water Res. 2007, 41, 627–637. [Google Scholar] [CrossRef] [PubMed]
  64. Rud, I.; Kolarevic, J.; Holan, A.B.; Berget, I.; Calabrese, S.; Terjesen, B.F. Deep-sequencing of the bacterial microbiota in commercial-scale recirculating and semi-closed aquaculture systems for Atlantic salmon post-smolt production. Aquac. Eng. 2017, 78, 50–62. [Google Scholar] [CrossRef]
  65. Sullivan, T.J.; Neigel, J.E. Effects of temperature and salinity on prevalence and intensity of infection of blue crabs, Callinectes sapidus by Vibrio cholerae, V. parahemolyticus, and V. vulnificus in Louisiana. J. Invertebr. Pathol. 2018, 151, 82–90. [Google Scholar] [CrossRef] [PubMed]
  66. Wong, Y.Y.; Lee, C.W.; Bong, C.W.; Lim, J.H.; Narayannan, K.; Sim, E.U.H. Environmental control of Vibrio spp. abundance and community structure in tropical waters. FEMS Microbiol. Ecol. 2019, 95, fiz176. [Google Scholar] [CrossRef] [PubMed]
  67. Wei, Y.F.; Wang, A.L.; Liao, S.A. Eeffct of different carbon sources on microbial community structure and composition of ex-situ biofloc formation. Aquaculture 2020, 515, 734492. [Google Scholar] [CrossRef]
  68. Cytryn, E.; van Rijn, J.; Schramm, A.; Gieseke, A.; de Beer, D.; Minz, D. Identification of bacteria potentially responsible for oxic and anoxic sulfide oxidation in biofilters of a recirculating mariculture system. Appl. Environ. Microbiol. 2005, 71, 6134–6141. [Google Scholar] [CrossRef] [PubMed]
  69. Hjelm, M.; Riaza, A.; Formoso, F.; Melchiorsen, J.; Gram, L. Seasonal incidence of autochthonous antagonistic Roseobacter spp. and Vibrionaceae strains in a turbot larva (Scophthalmus maximus) rearing system. Appl. Environ. Microbiol. 2004, 70, 7288–7294. [Google Scholar] [CrossRef]
Jmse 11 02076 g001
Figure 1. Weekly changes of total ammonia nitrogen (a), nitrite nitrogen (b), and nitrate nitrogen (c) concentrations in the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15). Error bar indicates ± standard deviation (SD).
Figure 1. Weekly changes of total ammonia nitrogen (a), nitrite nitrogen (b), and nitrate nitrogen (c) concentrations in the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15). Error bar indicates ± standard deviation (SD).
Jmse 11 02076 g001
Jmse 11 02076 g002aJmse 11 02076 g002b
Figure 2. Specific activities of (a) amylase, (b) lipase, and (c) trypsin in the intestine of Litopenaeus vannamei reared in the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15) at the end of the 4-week experiment. Each value represents mean ± S.E. (n = 9). Values within the same tissue with different superscript letters are significantly different at p < 0.05.
Figure 2. Specific activities of (a) amylase, (b) lipase, and (c) trypsin in the intestine of Litopenaeus vannamei reared in the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15) at the end of the 4-week experiment. Each value represents mean ± S.E. (n = 9). Values within the same tissue with different superscript letters are significantly different at p < 0.05.
Jmse 11 02076 g002aJmse 11 02076 g002b
Jmse 11 02076 g003aJmse 11 02076 g003b
Figure 3. Antioxidants and total antioxidant capacity in serum and hepatopancreas of Litopenaeus vannamei reared in the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15) at the end of the 4-week experiment. (a) superoxide dismutase activity in serum, (b) catalase activity in serum, (c) glutathione peroxidase activity in serum, (d) total antioxidant capacity in serum, (e) superoxide dismutase activity in hepatopancreas, (f) catalase activity in hepatopancreas, (g) glutathione peroxidase activity in hepatopancreas, (h) total antioxidant capacity in hepatopancreas. Each value represents mean ± S.E. (n = 9). Values within the same tissue with different superscript letters are significantly different at p < 0.05.
Figure 3. Antioxidants and total antioxidant capacity in serum and hepatopancreas of Litopenaeus vannamei reared in the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15) at the end of the 4-week experiment. (a) superoxide dismutase activity in serum, (b) catalase activity in serum, (c) glutathione peroxidase activity in serum, (d) total antioxidant capacity in serum, (e) superoxide dismutase activity in hepatopancreas, (f) catalase activity in hepatopancreas, (g) glutathione peroxidase activity in hepatopancreas, (h) total antioxidant capacity in hepatopancreas. Each value represents mean ± S.E. (n = 9). Values within the same tissue with different superscript letters are significantly different at p < 0.05.
Jmse 11 02076 g003aJmse 11 02076 g003b
Jmse 11 02076 g004
Figure 4. Immunity in serum and hepatopancreas of Litopenaeus vannamei reared in the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15) at the end of the 4-week experiment. (a) lysozyme activity in serum, (b) acid phosphatase activity in serum, (c) alkaline phosphatase activity in serum, (d) lysozyme activity in hepatopancreas, (e) acid phosphatase activity in hepatopancreas, (f) alkaline phosphatase activity in hepatopancreas. Each value represents mean ± S.E. (n = 9). Values within the same tissue with different superscript letters are significantly different at p < 0.05.
Figure 4. Immunity in serum and hepatopancreas of Litopenaeus vannamei reared in the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15) at the end of the 4-week experiment. (a) lysozyme activity in serum, (b) acid phosphatase activity in serum, (c) alkaline phosphatase activity in serum, (d) lysozyme activity in hepatopancreas, (e) acid phosphatase activity in hepatopancreas, (f) alkaline phosphatase activity in hepatopancreas. Each value represents mean ± S.E. (n = 9). Values within the same tissue with different superscript letters are significantly different at p < 0.05.
Jmse 11 02076 g004
Jmse 11 02076 g005
Figure 5. Venn diagram analysis of microbial communities in biofloc (WS5, WS10, and WS15) and Litopenaeus vannamei intestine (CS5, CS10, and CS15) among the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15) at the end of the 4-week experiment.
Figure 5. Venn diagram analysis of microbial communities in biofloc (WS5, WS10, and WS15) and Litopenaeus vannamei intestine (CS5, CS10, and CS15) among the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15) at the end of the 4-week experiment.
Jmse 11 02076 g005
Jmse 11 02076 g006
Figure 6. (a) Principal coordinate analysis (PCoA), (b) relative abundance of dominant phyla, (c) heatmap of the abundance of bacteria at the genus level, and (d) bacterial taxa identified by LEfSe using an LDA score threshold of >4 in biofloc (WS5, WS10, and WS15) and Litopenaeus vannamei intestine (CS5, CS10, and CS15) among the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15) at the end of the 4-week experiment.
Figure 6. (a) Principal coordinate analysis (PCoA), (b) relative abundance of dominant phyla, (c) heatmap of the abundance of bacteria at the genus level, and (d) bacterial taxa identified by LEfSe using an LDA score threshold of >4 in biofloc (WS5, WS10, and WS15) and Litopenaeus vannamei intestine (CS5, CS10, and CS15) among the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15) at the end of the 4-week experiment.
Jmse 11 02076 g006
Table 1. Growth performance of Litopenaeus vannamei growing in the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15).
Table 1. Growth performance of Litopenaeus vannamei growing in the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15).
ParametersGroups
S5S10S15
Initial weight (g)0.65 ± 0.080.64 ± 0.060.65 ± 0.04
Final weight (g)5.21 ± 0.144.96 ± 0.175.20 ± 0.40
Specific growth rate (SGR, %day−1)7.41 ± 0.167.25 ± 0.197.30 ± 0.36
Survival rate (%)78.34 ± 1.2380.61 ± 1.5981.22 ± 1.74
Weight gain (%)708.34 ± 34.80680.43 ± 41.85713.77 ± 43.25
Each value represents mean ± S.E. (n = 15).
Table 2. Muscle proximate composition of Litopenaeus vannamei growing in the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15).
Table 2. Muscle proximate composition of Litopenaeus vannamei growing in the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15).
ParametersGroups
S5S10S15
Moisture (%)79.52 ± 0.4578.5 ± 0.5279.06 ± 0.11
Crude protein (%)11.42 ± 0.510.21 ± 0.3511.72 ± 0.27
Crude lipid (%)4.34 ± 0.44.46 ± 0.314.46 ± 0.41
Ash (%)5.1 ± 0.31 b6.73 ± 0.52 a4.98 ± 0.57 b
Each value represents mean ± S.E. (n = 9). Means in the same row with different superscripts are significantly different at p < 0.05.
Table 3. Bacterial diversity indices (Shannon, Simpson) and estimated OTU richness indices (Chao1, ACE) for the biofloc and Litopenaeus vannamei intestinal bacterial diversity analysis among the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15) at the end of the 4-week experiment.
Table 3. Bacterial diversity indices (Shannon, Simpson) and estimated OTU richness indices (Chao1, ACE) for the biofloc and Litopenaeus vannamei intestinal bacterial diversity analysis among the three biofloc groups at salinities of 5.0‰ (S5), 10.0‰ (S10), and 15.0‰ (S15) at the end of the 4-week experiment.
GroupsIndices
ShannonSimpsonChao1ACE
BioflocS52.39 ± 0.12 b0.34 ± 0.04 a650.10 ± 21.49 a641.09 ± 18.93 a
S103.29 ± 0.20 a0.09 ± 0.02 c676.95 ± 50.73 a713.41 ± 36.46 a
S152.34 ± 0.10 b0.23 ± 0.01 b436.78 ± 15.79 b501.07 ± 52.52 b
IntestineS52.19 ± 0.220.32 ± 0.06547.50 ± 71.14 a552.80 ± 70.55 a
S101.90 ± 0.120.34 ±0.07335.74 ± 30.48 a379.55 ± 13.00 b
S151.75± 0.290.31 ± 0.09182.55 ± 29.39 b205.19 ± 44.85 c
Each value represents mean ± S.E. (n = 3). Means in the same row with different superscripts are significantly different at p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Long, L.; Liu, H.; Lu, S. Effects of Low Salinity on Growth, Digestive Enzyme Activity, Antioxidant and Immune Status, and the Microbial Community of Litopenaeus vannamei in Biofloc Technology Aquaculture Systems. J. Mar. Sci. Eng. 2023, 11, 2076. https://doi.org/10.3390/jmse11112076

AMA Style

Long L, Liu H, Lu S. Effects of Low Salinity on Growth, Digestive Enzyme Activity, Antioxidant and Immune Status, and the Microbial Community of Litopenaeus vannamei in Biofloc Technology Aquaculture Systems. Journal of Marine Science and Engineering. 2023; 11(11):2076. https://doi.org/10.3390/jmse11112076

Chicago/Turabian Style

Long, Lina, Huang Liu, and Shimin Lu. 2023. "Effects of Low Salinity on Growth, Digestive Enzyme Activity, Antioxidant and Immune Status, and the Microbial Community of Litopenaeus vannamei in Biofloc Technology Aquaculture Systems" Journal of Marine Science and Engineering 11, no. 11: 2076. https://doi.org/10.3390/jmse11112076

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop