Dietary Lycium barbarum Polysaccharide Modulates Growth Performance, Antioxidant Capacity, and Lipid Metabolism in Common Carp (Cyprinus carpio) Fed with High-Fat Diet
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Methods
2.2.1. Experimental Diets
2.2.2. Feeding Experiment
2.2.3. Sample Collection
2.2.4. Calculation of Growth Performance
2.2.5. Biochemical Analysis
2.2.6. Quantitative Real-Time PCR Analysis
2.2.7. Transmission Electron Microscopy Characterization
2.2.8. Statistical Analysis
3. Results
3.1. LBP Improved the Growth Performance of Common Carp
3.2. LBP Enhanced Antioxidant Capacities in the Liver
3.3. LBP Decreased Hepatic Lipogenesis-Related Enzyme Activity
3.4. LBP Increased Hepatic Lipase Activity
3.5. LBP Improved Hepatic Mitochondrial Function
3.6. LBP Regulated The Expression of Genes Related to Lipid Metabolism
3.7. Ultrastructural Images Revealed That LBP Alleviated Hepatic Lipid Deposition
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Limbu, S.M.; Ma, Q.; Zhang, M.L.; Du, Z.Y. High Fat Diet Worsens the Adverse Effects of Antibiotic on Intestinal Health in Juvenile Nile Tilapia (Oreochromis niloticus). Sci. Total Environ. 2019, 680, 169–180. [Google Scholar] [CrossRef]
- Tang, T.; Hu, Y.; Peng, M.; Chu, W.Y.; Hu, Y.J.; Zhong, L. Effects of High-Fat Diet on Growth Performance, Lipid Accumulation and Lipid Metabolism-Related Microrna/Gene Expression in the Liver of Grass Carp (Ctenopharyngodon idella). Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 2019, 234, 34–40. [Google Scholar] [CrossRef] [PubMed]
- Gou, N.N.; Chang, Z.G.; Deng, W.; Ji, H.; Zhou, J.S. Effects of Dietary Lipid Levels on Growth, Fatty Acid Composition, Antioxidant Status and Lipid Metabolism in Juvenile Onychostoma macrolepis. Aquac. Res. 2019, 50, 3369–3381. [Google Scholar] [CrossRef]
- Amirkolaie, A.K.; Mahdavi, S.; Hosseini, S.A. Dietary Fat Content and Feed Supply Influence Growth and Body Composition in Juvenile Beluga Sturgeon (Huso huso). Aquac. Int. 2012, 20, 859–867. [Google Scholar] [CrossRef]
- Wu, D.; Li, J.N.; Fan, Z.; Wang, L.S.; Zheng, X.H. Resveratrol Ameliorates Oxidative Stress, Inflammatory Response and Lipid Metabolism in Common Carp (Cyprinus carpio) Fed with High-Fat Diet. Front. Immunol. 2022, 13, 965954. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.T.; He, X.J.; Hong, Y.K.; Ma, T.; Xu, Y.P.; Li, H.H. Chemical Characterization of Lycium barbarum Polysaccharides and its Inhibition Against Liver Oxidative Injury of High-Fat Mice. Int. J. Biol. Macromol. 2010, 46, 540–543. [Google Scholar] [CrossRef] [PubMed]
- Tang, H.L.; Chen, C.; Wang, S.K.; Sun, G.J. Biochemical Analysis and Hypoglycemic Activity of a Polysaccharide Isolated from the Fruit of Lycium barbarum L. Int. J. Biol. Macromol. 2015, 77, 235–242. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.X.; Ni, Z.J.; Zhang, F.; Thakur, K.; Zhang, J.G.; Khan, M.R.; Busquets, R.; Wei, Z.J. Physicochemical and Antioxidant Properties of Lycium barbarum Seed Dreg Polysaccharides Prepared by Continuous Extraction. Food Chem. X 2022, 14, 100282. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.H.; Zhao, Y.B.; Huang, Z.F.; Long, Z.Y.; Qin, H.H.; Lin, H.; Zhou, S.S.; Kong, L.M.; Ma, J.R.; Li, Z.B. Effects of Lycium barbarum Polysaccharides Supplemented to High Soybean Meal Diet on Immunity and Hepatic Health of Spotted Sea Bass Lateolabrax maculatus. Front. Immunol. 2024, 15, 1333469. [Google Scholar] [CrossRef]
- Gan, L.; Zhang, S.H.; Yang, X.L.; Xu, H.B. Immunomodulation and Antitumor Activity by a Polysaccharide-Protein Complex from Lycium barbarum. Int. Immunopharmacol. 2004, 4, 563–569. [Google Scholar] [CrossRef]
- Li, X.L.; Zhou, A.G. Evaluation of the Antioxidant Effects of Polysaccharides Extracted from Lycium barbarum. Med. Chem. Res. 2007, 15, 471–482. [Google Scholar] [CrossRef]
- Li, X.M.; Li, X.L.; Zhou, A.G. Evaluation of Antioxidant Activity of the Polysaccharides Extracted from Lycium barbarum Fruits In Vitro. Eur. Polym. J. 2007, 43, 488–497. [Google Scholar] [CrossRef]
- Lin, C.L.; Wang, C.C.; Chang, S.C.; Inbaraj, B.S.; Chen, B.H. Antioxidative Activity of Polysaccharide Fractions Isolated from Lycium barbarum Linnaeus. Int. J. Biol. Macromol. 2009, 45, 146–151. [Google Scholar] [CrossRef] [PubMed]
- Qiu, S.L.; Chen, J.; Chen, X.; Fan, Q.; Zhang, C.S.; Wang, D.Y.; Li, X.P.; Chen, X.Y.; Chen, X.L.; Liu, C.; et al. Optimization of Selenylation Conditions for Lycium barbarum Polysaccharide Based on Antioxidant Activity. Carbohydr. Polym. 2014, 103, 148–153. [Google Scholar] [CrossRef] [PubMed]
- Xu, T.L.; Liu, R.; Lu, X.B.; Wu, X.Y.; Heneberg, P.; Mao, Y.J.; Jiang, Q.M.; Loor, J.; Yang, Z.P. Lycium barbarum Polysaccharides Alleviate LPS-Induced Inflammatory Responses through PPARγ/MAPK/NF-κB Pathway in Bovine Mammary Epithelial Cells. J. Anim. Sci. 2022, 100, skab345. [Google Scholar] [CrossRef] [PubMed]
- Li, D.D.; Ma, J.M.; Li, M.J.; Gao, L.L.; Fan, Y.N.; Zhang, Y.N.; Tao, X.J.; Yang, J.J. Supplementation of Lycium barbarum Polysaccharide Combined with Aerobic Exercise Ameliorates High-Fat-Induced Nonalcoholic Steatohepatitis Via AMPK/PPARα/PGC-1α Pathway. Nutrients 2022, 14, 3247. [Google Scholar] [CrossRef]
- Sun, Y.; Meng, X.W.; Hu, X.W.; Liu, R.; Zhao, Z.G.; Wang, S.H.; Zhang, R.; Guo, K.; Luo, L. Dietary Supplementation with Lycium barbarum Polysaccharides Conducive to Maintaining the Health of Luciobarbus Capito Via the Enhancement of Enzyme Activities and the Modulation of Gut Microbiota. Int. J. Biol. Macromol. 2023, 232, 123500. [Google Scholar] [CrossRef] [PubMed]
- Huang, Z.F.; Ye, Y.L.; Xu, A.L.; Li, Z.B. Effects of Dietary Crude Polysaccharides from Lycium barbarum on Growth Performance, Digestion, and Serum Physiology and Biochemistry of Spotted Sea Bass Lateolabrax maculatus. Aquacult. Rep. 2023, 32, 101710. [Google Scholar] [CrossRef]
- Tan, X.H.; Sun, Z.Z.; Ye, C.X.; Lin, H.Z. The Effects of Dietary Lycium barbarum Extract on Growth Performance, Liver Health and Immune Related Genes Expression in Hybrid Grouper (Epinephelus lanceolatus ♂ ×E. Fuscoguttatus ♀) Fed High Lipid Diets. Fish Shellfish Immunol. 2019, 87, 847–852. [Google Scholar] [CrossRef]
- Mo, W.Y.; Lun, C.H.I.; Choi, W.M.; Man, Y.B.; Wong, M.H. Enhancing Growth and Non-Specific Immunity of Grass Carp and Nile Tilapia by Incorporating Chinese Herbs (Astragalus membranaceus and Lycium barbarum) into Food Waste Based Pellets. Environ. Pollut. 2016, 219, 475–482. [Google Scholar] [CrossRef]
- Zhang, X.; Xiao, J.; Guo, Z.B.; Zhong, H.; Luo, Y.J.; Wang, J.J.; Tang, Z.Y.; Huang, T.; Li, M.Y.; Zhu, J.J.; et al. Transcriptomics Integrated with Metabolomics Reveals the Effect of Lycium Barbarum Polysaccharide on Apoptosis in Nile Tilapia (Oreochromis niloticus). Genomics 2022, 114, 229–240. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Huang, K.; Zhong, H.; Ma, Y.Q.; Guo, Z.B.; Tang, Z.Y.; Liang, J.N.; Luo, Y.J.; Su, Z.J.; Wang, L.Q. Effects of Lycium barbarum Polysaccharides on Immunological Parameters, Apoptosis, and Growth Performance of Nile Tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 2020, 97, 509–514. [Google Scholar] [CrossRef] [PubMed]
- Goh, K.W.; Kari, Z.A.; Wee, W.; Van Doan, H.; Reduan, M.; Kabir, M.A.; Khoo, M.I.; Al-Amsyar, S.M.; Wei, L.S. The Roles of Polysaccharides in Carp Farming: A Review. Animals 2023, 13, 244. [Google Scholar] [CrossRef]
- Department of Agriculture and Administration; National Aquatic Technology Extension Station; China Society of Fisheries. China Fishery Statistical Yearbook; China Agriculture Press: Beijing, China, 2023. [Google Scholar]
- Chen, Q.Q.; Liu, W.B.; Zhou, M.; Dai, Y.J.; Xu, C.; Tian, H.Y.; Xu, W.N. Effects of Berberine on the Growth and Immune Performance in Response to Ammonia Stress and High-Fat Dietary in Blunt Snout Bream Megalobrama amblycephala. Fish Shellfish Immunol. 2016, 55, 165–172. [Google Scholar] [CrossRef]
- Zhao, X.Y.; Chen, W.J.; Zhang, Y.Y.; Gao, X.C.; Huang, Y.; Ren, H.T.; Chang, K.; Sun, P.; Gao, S.Y. Dietary Guar Gum Supplementation Reduces the Adverse Effects of High-Fat Diets on the Growth Performance, Antioxidant Capacity, Inflammation, and Apoptosis of Juvenile Largemouth Bass (Micropterus salmoides). Anim. Feed Sci. Technol. 2024, 308, 115881. [Google Scholar] [CrossRef]
- Tian, J.; Wu, F.; Yu, L.J.; Lu, X.; Jiang, M.; Liu, W.; Leng, X.J.; Wen, H. The Effects of High-Macronutrient (Protein, Fat and Carbohydrate) Diets on Growth Performance and Muscular Metabolic Responses in Grass Carp. Aquac. Nutr. 2020, 26, 2135–2146. [Google Scholar] [CrossRef]
- Du, Z.Y. Causes of Fatty Liver in Farmed Fish: A Review and New Perspectives. J. Fish. China 2014, 38, 1628–1638. [Google Scholar]
- Tian, X.J.; Liang, T.S.; Liu, Y.L.; Ding, G.T.; Zhang, F.M.; Ma, Z.R. Extraction, Structural Characterization, and Biological Functions of Lycium barbarum Polysaccharides: A Review. Biomolecules 2019, 9, 389. [Google Scholar] [CrossRef]
- Tan, X.H.; Sun, Z.Z.; Ye, C.X. Dietary Lycium Barbarum Extract Administration Improved Growth, Meat Quality and Lipid Metabolism in Hybrid Grouper (Epinephelus Lanceolatus ♂ × E. Fuscoguttatus ♀) Fed High Lipid Diets. Aquaculture 2019, 504, 190–198. [Google Scholar] [CrossRef]
- Ooi, G.T.; Tawadros, N.; Escalona, R.M. Pituitary Cell Lines and their Endocrine Applications. Mol. Cell. Endocrinol. 2004, 228, 1–21. [Google Scholar] [CrossRef]
- Thiel, L.F.; Beermann, D.H.; Krick, B.J.; Boyd, R.D. Dose-Dependent Effects of Exogenous Porcine Somatotropin on the Yield, Distribution, and Proximate Composition of Carcass Tissues in Growing Pigs. J. Anim. Sci. 1993, 71, 827–835. [Google Scholar] [CrossRef] [PubMed]
- Hoseinifar, S.H.; Yousefi, S.; Van Doan, H.; Ashouri, G.; Gioacchini, G.; Maradonna, F.; Carnevali, O. Oxidative Stress and Antioxidant Defense in Fish: The Implications of Probiotic, Prebiotic, and Synbiotics. Rev. Fish. Sci. Aquac. 2020, 29, 198–217. [Google Scholar] [CrossRef]
- Mates, J.M.; Perez-Gomez, C.; Nunez, D.C.I. Antioxidant Enzymes and Human Diseases. Clin. Biochem. 1999, 32, 595–603. [Google Scholar] [CrossRef] [PubMed]
- Jia, Y.D.; Jing, Q.Q.; Niu, H.X.; Huang, B. Ameliorative Effect of Vitamin E on Hepatic Oxidative Stress and Hypoimmunity Induced by High-Fat Diet in Turbot (Scophthalmus maximus). Fish Shellfish Immunol. 2017, 67, 634–642. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.; Yao, R.; Wei, H.L.; Guo, Y.C.; Chen, A.Q.; Chen, B.Y.; Jin, N. Astaxanthin, Bile Acid and Chlorogenic Acid Attenuated the Negative Effects of High-Fat Diet on the Growth, Lipid Deposition, and Liver Health of Oncorhynchus mykiss. Aquaculture 2023, 567, 739255. [Google Scholar] [CrossRef]
- Huang, Z.F.; Ye, Y.L.; Long, Z.Y.; Qin, H.H.; Liu, L.H.; Xu, A.L.; Li, Z.B. Lycium barbarum Polysaccharides Improve Lipid Metabolism Disorders of Spotted Sea Bass Lateolabrax maculatus Induced by High Lipid Diet. Int. J. Biol. Macromol. 2023, 242, 125122. [Google Scholar] [CrossRef]
- Zhang, F.; Zhang, X.; Gu, Y.T.; Wang, M.; Guo, S.; Liu, J.Z.; Zhang, X.F.; Zhao, Z.H.; Qian, B.W.; Yan, Y.C.; et al. Hepatoprotection of Lycii Fructus Polysaccharide Against Oxidative Stress in Hepatocytes and Larval Zebrafish. Oxidative Med. Cell. Longev. 2021, 2021, 3923625. [Google Scholar] [CrossRef]
- Zhang, J.M.; Shu, D.B.; Cheng, X.; Tian, T.; Xiao, K.; Zhang, D.Z.; Yang, J. Effect of Plant Polysaccharides (Poria cocos and Astragalus Polysaccharides) on Immune Responses and Intestinal Microbiota of Dabry’s Sturgeons. Biosci. Microbiota Food Health 2023, 42, 243–253. [Google Scholar] [CrossRef]
- Huang, C.; Chen, Q.L.; Luo, Z.; Shi, X.; Pan, Y.X.; Song, Y.F.; Zhuo, M.Q.; Wu, K. Time-Dependent Effects of Waterborne Copper Exposure Influencing Hepatic Lipid Deposition and Metabolism in Javelin Goby Synechogobius hasta and their Mechanism. Aquat. Toxicol. 2014, 155, 291–300. [Google Scholar] [CrossRef]
- Slaninova, A.; Smutna, M.; Modra, H.; Svobodova, Z. A Review: Oxidative Stress in Fish Induced by Pesticides. Neuroendocrinol. Lett. 2009, 30, 2–12. [Google Scholar]
- Zou, C.Y.; Su, N.N.; Wu, J.H.; Xu, M.L.; Sun, Z.Z.; Liu, Q.Y.; Chen, L.L.; Zhou, Y.Y.; Wang, A.L.; Ye, C.X. Dietary Radix Bupleuri Extracts Improves Hepatic Lipid Accumulation and Immune Response of Hybrid Grouper (Epinephelus lanceolatusa ♂ × Epinephelus fuscoguttatus ♀). Fish Shellfish Immunol. 2019, 88, 496–507. [Google Scholar] [CrossRef]
- Tang, C.; Wang, Y.X.; Chen, D.; Zhang, M.; Xu, J.G.; Xu, C.; Liu, J.; Kan, J.; Jin, C.H. Natural Polysaccharides Protect Against Diet-Induced Obesity by Improving Lipid Metabolism and Regulating the Immune System. Food Res. Int. 2023, 172, 113192. [Google Scholar] [CrossRef]
- Wu, Q.Q.; Wang, Q.T.; Fu, J.F.; Ren, R.D. Polysaccharides Derived from Natural Sources Regulate Triglyceride and Cholesterol Metabolism: A Review of the Mechanisms. Food Funct. 2019, 10, 2330–2339. [Google Scholar] [CrossRef]
- Huang, R.R.; Wu, E.H.; Deng, X.L. Potential of Lycium barbarum Polysaccharide for the Control of Glucose and Lipid Metabolism Disorders: A Review. Int. J. Food Prop. 2022, 25, 673–680. [Google Scholar] [CrossRef]
- Kolsi, R.B.A.; Salah, H.B.; Jardak, N.; Chaaben, R.; Jribi, I.; Feki, A.E.; Rebai, T.; Jamoussi, K.; Allouche, N.; Blecker, C.; et al. Sulphated Polysaccharide Isolated from Sargassum vulgare: Characterization and Hypolipidemic Effects. Carbohydr. Polym. 2017, 170, 148–159. [Google Scholar] [CrossRef]
- Yang, G.K.; Liang, X.M.; Hu, J.H.; Li, C.Q.; Hu, W.P.; Li, K.K.; Chang, X.L.; Zhang, Y.M.; Zhang, X.D.; Shen, Y.W.; et al. Feeding Tea Polysaccharides Affects Lipid Metabolism, Antioxidant Capacity and Immunity of Common Carp (Cyprinus carpio L.). Front. Immunol. 2022, 13, 1074198. [Google Scholar] [CrossRef] [PubMed]
- Kurtovic, I.; Marshall, S.N.; Zhao, X.; Simpson, B.K. Lipases from Mammals and Fishes. Rev. Fish. Sci. 2009, 17, 18–40. [Google Scholar] [CrossRef]
- Du, Z.Y.; Clouet, P.; Huang, L.M.; Degrace, P.; Zheng, W.H.; He, J.G.; Tian, L.X.; Liu, Y.J. Utilization of Different Dietary Lipid Sources at High Level in Herbivorous Grass Carp (Ctenopharyngodon idella): Mechanism Related to Hepatic Fatty Acid Oxidation. Aquac. Nutr. 2008, 14, 77–92. [Google Scholar] [CrossRef]
- Manoli, I.; Alesci, S.; Blackman, M.R.; Su, Y.A.; Rennert, O.M.; Chrousos, G.P. Mitochondria as Key Components of the Stress Response. Trends Endocrinol. Metab. 2007, 18, 190–198. [Google Scholar] [CrossRef]
- Bell, R.M.; Ballas, L.M.; Coleman, R.A. Lipid Topogenesis. J. Lipid Res. 1981, 22, 391–403. [Google Scholar] [CrossRef]
- Song, Y.F.; Wu, K.; Tan, X.Y.; Zhang, L.H.; Zhuo, M.Q.; Pan, Y.X.; Chen, Q.L. Effects of Recombinant Human Leptin Administration on Hepatic Lipid Metabolism in Yellow Catfish Pelteobagrus fulvidraco: In Vivo and In Vitro Studies. Gen. Comp. Endocrinol. 2015, 212, 92–99. [Google Scholar] [CrossRef] [PubMed]
- Lu, K.L.; Xu, W.N.; Wang, L.N.; Zhang, D.D.; Zhang, C.N.; Liu, W.B. Hepatic β-Oxidation and Regulation of Carnitine Palmitoyltransferase (CPT) I in Blunt Snout Bream Megalobrama amblycephala Fed a High Fat Diet. PLoS ONE 2014, 9, e93135. [Google Scholar] [CrossRef] [PubMed]
- Desouky, H.E.; Jiang, G.Z.; Zhang, D.D.; Abasubong, K.P.; Yuan, X.Y.; Li, X.F.; Liu, W.B. Influences of Glycyrrhetinic Acid (GA) Dietary Supplementation on Growth, Feed Utilization, and Expression of Lipid Metabolism Genes in Channel Catfish (Ictalurus punctatus) Fed a High-Fat Diet. Fish Physiol. Biochem. 2020, 46, 653–663. [Google Scholar] [CrossRef] [PubMed]
- Abasubong, K.P.; Li, X.F.; Zhang, D.D.; Jia, E.T.; Ye, X.Y.; Xu, C.; Liu, W.B. Dietary Supplementation of Xylooligosaccharides Benefits the Growth Performance and Lipid Metabolism of Common Carp (Cyprinus carpio) Fed High-Fat Diets. Aquac. Nutr. 2018, 24, 1416–1424. [Google Scholar] [CrossRef]
- Eberlé, D.; Hegarty, B.; Bossard, P.; Ferré, P.; Foufelle, F. Srebp Transcription Factors: Master Regulators of Lipid Homeostasis. Biochimie 2004, 86, 839–848. [Google Scholar] [CrossRef]
- Sen, U.; Coleman, C.; Sen, T. Stearoyl Coenzyme A Desaturase-1: Multitasker in Cancer, Metabolism, and Ferroptosis. Trends Cancer 2023, 9, 480–489. [Google Scholar] [CrossRef] [PubMed]
- Wu, X.; Huang, T.H. Recent Development in Acetyl-CoA Carboxylase Inhibitors and their Potential as Novel Drugs. Future Med. Chem. 2020, 12, 533–561. [Google Scholar] [CrossRef]
- Huang, C.C.; Sun, J.; Ji, H.; Kaneko, G.; Xie, X.D.; Chang, Z.G.; Deng, W. Systemic Effect of Dietary Lipid Levels and α-Lipoic Acid Supplementation on Nutritional Metabolism in Zebrafish (Danio rerio): Focusing on the Transcriptional Level. Fish Physiol. Biochem. 2020, 46, 1631–1644. [Google Scholar] [CrossRef]
Ingredients | NL | HL | LBP0.05 | LBP0.10 | LBP0.20 |
---|---|---|---|---|---|
Fishmeal | 50 | 50 | 50 | 50 | 50 |
Chicken meal | 50 | 50 | 50 | 50 | 50 |
Soybean protein concentrate | 70 | 70 | 70 | 70 | 70 |
Soybean meal | 350 | 350 | 350 | 350 | 350 |
Wheat middlings | 270 | 270 | 270 | 270 | 270 |
Fish oil | 20 | 70 | 70 | 70 | 70 |
Soybean oil | 25 | 75 | 75 | 75 | 75 |
Vitamin premix 1 | 5 | 5 | 5 | 5 | 5 |
Trace mineral premix 2 | 5 | 5 | 5 | 5 | 5 |
Choline chloride | 5 | 5 | 5 | 5 | 5 |
Dicalcium phosphate | 20 | 20 | 20 | 20 | 20 |
Cellulose | 7 | 7 | 6.5 | 6 | 5 |
Sodium carboxymethylcellulose | 10 | 10 | 10 | 10 | 10 |
Lysine | 6 | 6 | 6 | 6 | 6 |
Threonine | 2 | 2 | 2 | 2 | 2 |
Methionine | 5 | 5 | 5 | 5 | 5 |
LBP | 0 | 0 | 0.5 | 1 | 2 |
Proximate compositions | |||||
Crude protein (%) | 30.24 | 30.02 | 30.35 | 30.08 | 30.14 |
Crude lipid (%) | 5.93 | 15.92 | 15.68 | 15.76 | 15.88 |
Gene | Primer Sequence (5′–3′) | GenBank Number |
---|---|---|
CPT1 1 | F: CAGATGGAAAGTGTTGCTAATGAC R: TGTGTAGAAGTTGCTGTTGACCA | XM_051899001.1 |
ACC1 2 | F: GTCACTGGCGTATGAGGATATT R:TCCACCTGTATGGTTCTTTGG | XM_042757417.1 |
SCD1 3 | F: TTCGTCACCTTCAGCGCTAT R:CGCTTCTCTGGACACACGCT | XM_051917718.1 |
FAS 4 | F: GACAGGCCGCTATTGCTATT R: TGCCGTAAGCTGAGGAAATC | XM_042767930.1 |
SREBP 5 | F: CGTCTGCTTCACTTCACTACTC R:GGACCAGTCTTCATCCACAAA | XM_042752869.1 |
PPAR-γ 6 | F: CTTCGTGAACC TGGACTTG R: ATCTGACCGTAGGAGATGAG | XM_042766485.1 |
FBPase 7 | F: ACAGTCTGAATGAAGGCTAC R:CTCATACAACAGCCTCAGCT | XM_042756375.1 |
G6Pase 8 | F: GCAGGTCAATCTCACTGGCT R:CTGATGTAGTGGAGCGCTAT | XM_042767111.1 |
PEPCK 9 | F: GTCAGGTGCTGTGGCTGAAT R: TCCTTAGTGACAATCACAGT | XM_019080165.2 |
β-actin | F: GATCGGCAATGAGCGTTTCC R: ACGGTGTTGGCATACAGGTC | M24113.1 |
NL | HL | 0.5 g/kg LBP | 1.0 g/kg LBP | 2.0 g/kg LBP | p-Values 2 | ||
---|---|---|---|---|---|---|---|
Linear | Quadratic | ||||||
IBW 3 (g) | 5.30 ± 0.20 | 5.33 ± 0.06 | 5.27 ± 0.15 | 5.27 ± 0.06 | 5.27 ± 0.15 | 0.521 | 0.631 |
FBW 4 (g) | 41.23 ± 0.49 | 35.70 ± 2.29 b* | 40.93 ± 1.53 a | 41.00 ± 0.61 a | 43.63 ± 3.10 a | 0.002 | 0.314 |
WGR 5 (%) | 676.40 ± 32.67 | 572.00 ± 50.80 b* | 676.77 ± 21.92 a | 677.43 ± 16.00 a | 727.50 ± 44.80 a | 0.001 | 0.230 |
FI 6 (g) | 1431.06 ± 39.19 | 1400.62 ± 46.94 b | 1434.09 ± 48.52 b | 1445.47 ± 32.34 ab | 1561.99 ± 62.40 a | 0.004 | 0.178 |
SGR 7 (%/d) | 3.79 ± 0.08 | 3.52 ± 0.14 b* | 3.80 ± 0.05 a | 3.80 ± 0.04 a | 3.91 ± 0.10 a | 0.001 | 0.166 |
FCR 8 | 1.59 ± 0.05 | 1.84 ± 0.08 a** | 1.61 ± 0.03 b | 1.62 ± 0.05 b | 1.63 ± 0.08 b | 0.005 | 0.009 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, D.; Li, J.; Fan, Z.; Sun, Z.; Zheng, X.; Zhang, H.; Xu, H.; Wang, L. Dietary Lycium barbarum Polysaccharide Modulates Growth Performance, Antioxidant Capacity, and Lipid Metabolism in Common Carp (Cyprinus carpio) Fed with High-Fat Diet. Antioxidants 2024, 13, 540. https://doi.org/10.3390/antiox13050540
Wu D, Li J, Fan Z, Sun Z, Zheng X, Zhang H, Xu H, Wang L. Dietary Lycium barbarum Polysaccharide Modulates Growth Performance, Antioxidant Capacity, and Lipid Metabolism in Common Carp (Cyprinus carpio) Fed with High-Fat Diet. Antioxidants. 2024; 13(5):540. https://doi.org/10.3390/antiox13050540
Chicago/Turabian StyleWu, Di, Jinnan Li, Ze Fan, Zhipeng Sun, Xianhu Zheng, Haitao Zhang, Hong Xu, and Liansheng Wang. 2024. "Dietary Lycium barbarum Polysaccharide Modulates Growth Performance, Antioxidant Capacity, and Lipid Metabolism in Common Carp (Cyprinus carpio) Fed with High-Fat Diet" Antioxidants 13, no. 5: 540. https://doi.org/10.3390/antiox13050540