Identification and Pathogenicity of Fusarium Species Associated with Onion Basal Rot in the Moscow Region of Russian Federation
Abstract
:1. Introduction
2. Materials and Methods
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Krivenkov, L.V.; Agafonov, A.F.; Logunova, V.V.; Seredin, T.M. The State and Main Directions of Onion Crop Breeding of FSBSI FSVC. Veg. Crop. Russ. 2021, 3, 24–28. [Google Scholar] [CrossRef]
- Havey, M. Onion and Other Cultivated Alliums. Evol. Crop Plants 1995, 2, 344–350. [Google Scholar]
- Bystrická, J.; Musilová, J.; Vollmannová, A.; Timoracká, M.; Kavalcová, P. Bioactive Components of Onion (Allium cepa L.)—A Review. Acta Aliment. 2013, 42, 11–22. [Google Scholar] [CrossRef]
- Teshika, J.D.; Zakariyyah, A.M.; Zaynab, T.; Zengin, G.; Rengasamy, K.R.; Pandian, S.K.; Fawzi, M.M. Traditional and Modern Uses of Onion Bulb (Allium cepa L.): A Systematic Review. Crit. Rev. Food Sci. Nutr. 2019, 59, S39–S70. [Google Scholar] [CrossRef] [PubMed]
- FAOSTAT. Available online: https://www.fao.org/ (accessed on 23 January 2024).
- Summerell, B.A. Resolving Fusarium: Current Status of the Genus. Annu. Rev. Phytopathol. 2019, 57, 323–339. [Google Scholar] [CrossRef] [PubMed]
- Kalman, B.; Abraham, D.; Graph, S.; Perl-Treves, R.; Meller Harel, Y.; Degani, O. Isolation and Identification of Fusarium spp., the Causal Agents of Onion (Allium cepa) Basal Rot in Northeastern Israel. Biology 2020, 9, 69. [Google Scholar] [CrossRef] [PubMed]
- Sharma, S.; Cramer, C.S. Selection Progress for Resistance to Fusarium Basal Rot in Short-Day Onions Using Artificial Inoculation Mature Bulb Screening. Horticulturae 2023, 9, 99. [Google Scholar] [CrossRef]
- Cramer, C.S. Breeding and Genetics of Fusarium Basal Rot Resistance in Onion. Euphytica 2000, 115, 159–166. [Google Scholar] [CrossRef]
- Haapalainen, M.; Kuivainen, E.; Iivonen, S.; Niemi, M.; Latvala, S. Pathogenicity of Fusarium Oxysporum and Fusarium Proliferatum Isolates from Symptomless Onions (Allium Cepa) and Onions with Fusarium Basal Rot. Plant Pathol. 2023, 72, 1122–1135. [Google Scholar] [CrossRef]
- Stankovic, S.; Levic, J.; Petrovic, T.; Logrieco, A.; Moretti, A. Pathogenicity and Mycotoxin Production by Fusarium Proliferatum Isolated from Onion and Garlic in Serbia. Eur. J. Plant Pathol. 2007, 118, 165–172. [Google Scholar] [CrossRef]
- Tirado-Ramírez, M.A.; López-Orona, C.A.; Velázquez-Alcaraz, T.d.J.; Díaz-Valdés, T.; Velarde-Félix, S.; Martínez-Campos, A.R.; Retes-Manjarrez, J.E. First Report of Onion Basal Rot Caused by Fusarium Falciforme in Mexico. Plant Dis. 2018, 102, 2646. [Google Scholar] [CrossRef]
- Hamidou, S.K.; Kadidia, K.; Alassane, O.; Mohamed, S.; Itolou, K.A.; Harouna, S.; Claudine, C. Pathogenic Characterization of Three Fusarium Species Associated with Onion (Allium cepa L.) In Burkina Faso. Int. J. Phytopathol. 2022, 11, 267–276. [Google Scholar] [CrossRef]
- Engalycheva, I.; Kozar, E.; Frolova, S.; Vetrova, S.; Tikhonova, T.; Dzhos, E.; Engalychev, M.; Chizhik, V.; Martynov, V.; Shingaliev, A.; et al. Fusarium Species Causing Pepper Wilt in Russia: Molecular Identification and Pathogenicity. Microorganisms 2024, 12, 343. [Google Scholar] [CrossRef] [PubMed]
- Kristensen, R.; Torp, M.; Kosiak, B.; Holst-Jensen, A. Phylogeny and Toxigenic Potential Is Correlated in Fusarium Species as Revealed by Partial Translation Elongation Factor 1 Alpha Gene Sequences. Mycol. Res. 2005, 109, 173–186. [Google Scholar] [CrossRef] [PubMed]
- O’Donnell, K.; Ward, T.J.; Robert, V.A.R.G.; Crous, P.W.; Geiser, D.M.; Kang, S. DNA Sequence-Based Identification of Fusarium: Current Status and Future Directions. Phytoparasitica 2015, 43, 583–595. [Google Scholar] [CrossRef]
- O’Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple Evolutionary Origins of the Fungus Causing Panama Disease of Banana: Concordant Evidence from Nuclear and Mitochondrial Gene Genealogies. Proc. Natl. Acad. Sci. USA 1998, 95, 2044–2049. [Google Scholar] [CrossRef] [PubMed]
- Fernández-Ortuño, D.; Loza-Reyes, E.; Atkins, S.L.; Fraaije, B.A. The CYP51C Gene, a Reliable Marker to Resolve Interspecific Phylogenetic Relationships within the Fusarium Species Complex and a Novel Target for Species-Specific PCR. Int. J. Food Microbiol. 2010, 144, 301–309. [Google Scholar] [CrossRef] [PubMed]
- Gerlach, W.; Nirenberg, H. The Genus Fusarium—A Pictorial Atlas; Mitteilungen aus der Biologischen Bundesanstalt fur Land-und Forstwirtschaft Berlin-Dahlem: Berlin/Hamburg, Germany, 1982; Volume 2091, ISBN 3-489-20900-1. [Google Scholar]
- Liu, X.; Gu, X.; Lu, H.; Liu, P.; Miao, H.; Bai, Y.; Zhang, S. Identification of Novel Loci and Candidate Genes for Resistance to Powdery Mildew in a Resequenced Cucumber Germplasm. Genes. 2021, 12, 584. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. PCR Protoc. A Guide Methods Appl. 1990, 18, 315–322. [Google Scholar] [CrossRef]
- National Center for Biotechnology Information. Available online: https://www.ncbi.nlm.nih.gov/ (accessed on 26 January 2024).
- Fusarium. Available online: https://www.fusarium.org/ (accessed on 26 January 2024).
- Crous, P.W.; Lombard, L.; Sandoval-Denis, M.; Seifert, K.A.; Schroers, H.-J.; Chaverri, P.; Gené, J.; Guarro, J.; Hirooka, Y.; Bensch, K.; et al. Fusarium: More than a Node or a Foot-Shaped Basal Cell. Stud. Mycol. 2021, 98, 100116. [Google Scholar] [CrossRef]
- Tamura, K.; Nei, M. Estimation of the Number of Nucleotide Substitutions in the Control Region of Mitochondrial DNA in Humans and Chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Tsuji, M.; Kadota, I. Identification and Phylogenetic Analysis of Burkholderia Cepacia Complex Bacteria Isolated from Rot of Onion Bulbs in Tohoku Region of Japan. J. Gen. Plant Pathol. 2020, 86, 376–386. [Google Scholar] [CrossRef]
- Duncan, D.B. Multiple Range and Multiple F Tests. Biometrics 1955, 11, 1–42. [Google Scholar] [CrossRef]
- Nikitina, S.M.; Grinberg, E.G. Diagnosis of Fusarium of Perennial Onions during the Growing Season. Bull. NGAU 2014, 3, 49–53. [Google Scholar]
- Taylor, A.; Vágány, V.; Jackson, A.C.; Harrison, R.J.; Rainoni, A.; Clarkson, J.P. Identification of Pathogenicity-Related Genes in Fusarium Oxysporum f. Sp. Cepae. Mol. Plant Pathol. 2016, 17, 1032–1047. [Google Scholar] [CrossRef] [PubMed]
- Ghanbarzadeh, B.; Mohammadi Goltapeh, E.; Safaie, N. Identification of Fusarium Species Causing Basal Rot of Onion in East Azarbaijan Province, Iran and Evaluation of Their Virulence on Onion Bulbs and Seedlings. Arch. Phytopathol. Plant Prot. 2014, 47, 1050–1062. [Google Scholar] [CrossRef]
- Boehnke, B.; Karlovsky, P.; Pfohl, K.; Gamliel, A.; Isack, Y.; Dehne, H.W. Identification of Different Fusarium spp. in Allium Spp. in Germany. Commun. Agric. Appl. Biol. Sci. 2015, 80, 453–463. [Google Scholar]
- Bayraktar, H.; Dolar, F.S. Molecular Identification and Genetic Diversity of Fusarium Species Associated with Onion Fields in Turkey. J. Phytopathol. 2011, 159, 28–34. [Google Scholar] [CrossRef]
- Sobhani, Z.; Sharifnabi, B.; Darvishnia, M. Identification and Pathogenicity of Fusarium Species Involved in Onion Basal and Scale Rot in Isfahan. Iran. J. Plant Pathol. 2019, 54, 353–366. [Google Scholar]
- Ignjatov, M.; Bjelić, D.; Nikolić, Z.; Milošević, D.; Gvozdanović-Varga, J.; Marinković, J.; Ivanović, Ž. First Report of Fusarium Acuminatum Causing Garlic Bulb Rot in Serbia. Plant Dis. 2017, 101, 1047. [Google Scholar] [CrossRef]
- Delgado-Ortiz, J.C.; Ochoa-Fuentes, Y.M.; Cerna-Chávez, E.; Beltrán-Beache, M.; Rodríguez-Guerra, R.; Aguirre-Uribe, L.A.; Vázquez-Martínez, O. Patogenicidad de Especies de Fusarium Asociadas a La Pudrición Basal Del Ajo En El Centro Norte de México. Rev. Argent. De. Microbiol. 2016, 48, 222–228. [Google Scholar] [CrossRef] [PubMed]
- Vélez-Rodríguez, L.; Rivera-Vargas, L.I. Recent Studies of Fungal Pathogens of Onion in Puerto Rico. J. Agric.-Univ. Puerto Rico 2007, 91, 31–45. [Google Scholar]
- Seifert, K.A.; Aoki, T.; Baayen, R.P.; Brayford, D.; Burgess, L.W.; Chulze, S.; Gams, W.; Geiser, D.; De Gruyter, J.; Leslie, J.F. The Name Fusarium Moniliforme Should No Longer Be Used. Mycol. Res. 2003, 107, 643–644. [Google Scholar] [CrossRef]
- Nelson, P.E.; Toussoun, T.A.; Marasas, W.F.O. Fusarium Species: An Illustrated Manual for Identification; Pennsylvania State University Press: University Park, TX, USA, 1983; ISBN 978-0-271-00349-8. [Google Scholar]
- Yilmaz, N.; Sandoval-Denis, M.; Lombard, L.; Visagie, C.M.; Wingfield, B.D.; Crous, P.W. Redefining Species Limits in the Fusarium Fujikuroi Species Complex. Persoonia—Mol. Phylogeny Evol. Fungi 2021, 46, 129–162. [Google Scholar] [CrossRef] [PubMed]
- Parra, M.Ä.; Gómez, J.; Aguilar, F.W.; Martinez, J.A. Fusarium Annulatum Causes Fusarium Rot of Cantaloupe Melons in Spain. Phytopathol. Mediterr. 2022, 61, 269–277. [Google Scholar] [CrossRef]
- Mirghasempour, S.A.; Studholme, D.J.; Chen, W.; Zhu, W.; Mao, B. Molecular and Pathogenic Characterization of Fusarium Species Associated with Corm Rot Disease in Saffron from China. J. Fungi 2022, 8, 515. [Google Scholar] [CrossRef] [PubMed]
- Bustamante, M.I.; Elfar, K.; Smith, R.J.; Bettiga, L.J.; Tian, T.; Torres, G.A.; Eskalen, A. First Report of Fusarium Annulatum Associated with Young Vine Decline in California. Plant Dis. 2022, 106, 2752. [Google Scholar] [CrossRef]
- Dobbs, J.T.; Kim, M.-S.; Reynolds, G.J.; Wilhelmi, N.; Dumroese, R.K.; Klopfenstein, N.B.; Fraedrich, S.W.; Cram, M.M.; Bronson, J.; Stewart, J.E. Fusarioid Community Diversity Associated with Conifer Seedlings in Forest Nurseries across the Contiguous USA. Front. Plant Sci. 2023, 14, 1–11. [Google Scholar] [CrossRef]
Primer | Sequence 5′–3′ | Product Size (bp) | Tm (°C) | A Source |
---|---|---|---|---|
fRPB2-7cf RPB2-11ar | F: ATGGGYAARCAAGCYATGGG R: GCRTGGATCTTRTCRTCSACC | ~900 | 52 | [20] |
ITS5 ITS4 | F: GGAAGTAAAAGTCGTAACAAGG R:TCCTCCGCTTATTGATATGC | ~550 | 56 | [21] |
EF-1 EF-2 | F:ATGGGTAAGGARGACAAGAC R:GGARGTACCAGTSATCATG | ~680 | 55 | [17] |
Characteristic | F. annulatum | F. oxysporum | F. solani | F. acuminatum |
---|---|---|---|---|
Colony: | ||||
growth rate on PDA, mm/day ± S.E. | 10.0 ± 1.8 | 11.5 ± 2.4 | 7.1 ± 0.2 | 7.8 ± 0.1 |
mycelium | White, dense or loose, uniform | White with pronounced radial growth from the center to the periphery of the colony | White and cream with concentric rings | White, dense, uniform |
pigment | cream or purple on day 5 | light cream on day 7 | cream on day 5 | lemon on day 6, pink on the periphery of the colony on day 9 |
Microconidia: | ||||
size, µm ± S.E. | 6.3 ± 0.8 × 2.8 ± 0.5 | 8.5 ± 0.5 × 3.75 ± 0.5 | 22.8 ± 1.8 × 6.0 ± 0.3 | 10.3 ± 0.5 × 3.5 ± 0.3 |
septation | 0 | 0–1 | 1 | 0–1 |
shape | clavate, oval | oval | oval, slightly curved | curved |
Macroconidia: | ||||
size, µm ± S.E. | 26.3 ± 1.3 × 4.0 ± 0.3 | 34.5 ± 5.7 × 4.3 ± 0.5 | 36.3 ± 3.9 × 5.0 ± 1.3 | 24.5 ± 5.5 × 3.3 ± 0.5 |
septation | 2–3 | 3–4 | 2–4 | 2–4 |
shape | almost straight | straight to slightly curved | slightly curved | curved |
Chlamydospores: | ||||
size, µm ± S.E. | not formed | 8.5 ± 1.0 × 8.5 ± 0.8 | 8.3 ± 0.5 × 8.6 ± 1.0 | not formed |
shape | not formed | globose | globose, globose-oval | not formed |
abundance | not formed | abundant, single, or in pairs | abundant, single, or in pairs | not formed |
Strains | Place of Localization | Type | Degree of Aggressiveness 1 | FBR, Score 2 | |
---|---|---|---|---|---|
Average Volume of the Affected Area, mm3 | |||||
Control | 0 a | ||||
F-A-23-2 | mature bulb | basal plat | F. annulatum | WA | 2 ab |
F-A-23-1 | mature bulb | neck | F. annulatum | WA | 2,5 ab |
F-A-23-8 | seed bulb | basal plat | F. annulatum | WA | 3,3 ab |
F-A-23-3 | mature bulb | neck | F. annulatum | WA | 11,2 ab |
F-A-23-9 | seed bulb | basal plat | F. annulatum | WA | 20,5 abc |
F-A-23-6 | seed bulb | basal plat | F. oxysporum | WA | 2,5 ab |
F-A-23-7 | seed bulb | basal plat | F. oxysporum | WA | 6,5 ab |
F-A-23-4 | mature bulb | neck | F. oxysporum | WA | 11,5 ab |
F-A-23-11 | seed bulb | central part | F. oxysporum | WA | 23,5 abc |
F-A-23-10 | seed bulb | basal plat | F. solani | WA | 8,5 ab |
F-A-23-24 | mature bulb | whole bulb | F. annulatum | MA | 88,5 abcd |
F-A-23-20 | mature bulb | whole bulb | F. annulatum | MA | 98 abcd |
F-A-23-21 | mature bulb | neck | F. annulatum | MA | 118,5 abcd |
F-A-23-5 | seed bulb | whole bulb | F. acuminatum | MA | 121 abcd |
F-A-23-19 | mature bulb | basal plat | F. acuminatum | MA | 142,5 abcd |
F-A-23-23 | mature bulb | basal plat | F. oxysporum | HA | 152 bcd |
F-A-23-17 | mature bulb | basal plat | F. annulatum | HA | 155 bcd |
F-A-23-18 | mature bulb | neck | F. annulatum | HA | 167 cd |
F-A-23-27 | mature bulb | whole bulb | F. annulatum | HA | 230 d |
F-A-23-25 | mature bulb | whole bulb | F. annulatum | HA | 235 d |
Variety | Control | Strains | |||
---|---|---|---|---|---|
F-A-23-23 F. oxysporum | F-A-23-25 F. annulatum | F-A-23-19 F. acuminatum | F-A-23-5 F. acuminatum | ||
Sigma | 0 a | 0 a | 0 a | 52 a | 77 a |
Myachkovsky | 0 a | 84 ab | 59 a | 284 abc | 126 ab |
Cherny princ | 0 a | 42 a | 591 c | 826 bc | 127 ab |
Boterus | 0 a | 63 ab | 325 bc | 268 abc | 178 ab |
Tseparius | 0 a | 15 a | 61 a | 105 abc | 208 ab |
Atas | 0 a | 35 a | 74 a | 537 c | 129 ab |
Kolobok | 0 a | 86 ab | 277 abc | 110 abc | 942 bc |
Globus | 0 a | 233 b | 132 ab | 155 abc | 2123 c |
Average volume of the affected area, mm3 | 0 a | 69 a | 189 abc | 292 bc | 488 c |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vetrova, S.; Alyokhina, K.; Engalycheva, I.; Kozar, E.; Mukhina, K.; Sletova, M.; Krivenkov, L.; Tikhonova, T.; Kameneva, A.; Frolova, S.; et al. Identification and Pathogenicity of Fusarium Species Associated with Onion Basal Rot in the Moscow Region of Russian Federation. J. Fungi 2024, 10, 331. https://doi.org/10.3390/jof10050331
Vetrova S, Alyokhina K, Engalycheva I, Kozar E, Mukhina K, Sletova M, Krivenkov L, Tikhonova T, Kameneva A, Frolova S, et al. Identification and Pathogenicity of Fusarium Species Associated with Onion Basal Rot in the Moscow Region of Russian Federation. Journal of Fungi. 2024; 10(5):331. https://doi.org/10.3390/jof10050331
Chicago/Turabian StyleVetrova, Svetlana, Ksenia Alyokhina, Irina Engalycheva, Elena Kozar, Kseniya Mukhina, Maria Sletova, Leonid Krivenkov, Tatyana Tikhonova, Alina Kameneva, Svetlana Frolova, and et al. 2024. "Identification and Pathogenicity of Fusarium Species Associated with Onion Basal Rot in the Moscow Region of Russian Federation" Journal of Fungi 10, no. 5: 331. https://doi.org/10.3390/jof10050331