The Microalga Skeletonema marinoi Induces Apoptosis and DNA Damage in K562 Cell Line by Modulating NADPH Oxidase
Abstract
:1. Introduction
2. Results
2.1. The Extract of Skeletonema marinoi Affects the Viability of K562 Cells
2.2. The Extract of Skeletonema marinoi Induces Apoptosis in K562 Cells
2.3. The Extract of Skeletonema marinoi Protects K562 Cells from Lipid Peroxidation
2.4. The Extract of Skeletonema marinoi Exerts a Protective Effect on Nitrites (NO2−) and Nitrates (NO3−) Production
2.5. The Redox Status Activity Is Restored in K562 Cells after Treatment with the Extract of Skeletonema marinoi
2.6. Oxidative DNA Damage Is Decreased in K562 Cells after Treatment with the Extract of Skeletonema marinoi
2.7. The Extract of Skeletonema marinoi Induces K562 Cell Apoptosis and Reduces Oxidative Stress through NOX2 Pathway
2.8. The Extract of Skeletonema marinoi Affects NOX2, p22-phox, and Apoptosis Proteins’ Expression in K562 Cells
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Reagents
4.2. Microalga Culturing
4.3. Algal Pellet Extraction
4.4. Cell Culture
4.5. 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium Bromide (MTT) Assay
4.6. Annexin V-FITC Apoptosis Analysis
4.7. Determination of Lipid Peroxidation
4.8. Determination of NO2− and NO3− Productions
4.9. Measurement of Redox Status Activity
4.10. Oxidative DNA Damage
4.11. Quantitative Real-Time PCR (RT-qPCR)
4.12. Western Blot Analysis
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Gangping, H.; Jing, J.; Hanming, J.; Yuanying, Z.; Mengdi, W.; Yuyu, Q.; Cundong, F.; Lijuan, Y.; Suyun, B.; Lingyun, S.; et al. Acetylshikonin induces apoptosis of human leukemia cell line K562 by inducing S phase cell cycle arrest, modulating ROS accumulation, depleting Bcr-Abl and blocking NF-κB signaling. Biomed. Pharmacother. 2020, 122, 109677. [Google Scholar]
- Ciarcia, R.; d’Angelo, D.; Pacilio, C.; Pagnini, D.; Galdiero, M.; Fiorito, F.; Damiano, S.; Mattioli, E.; Lucchetti, C.; Florio, S.; et al. Dysregulated calcium homeostasis and oxidative stress in chronic myeloid leukemia (CML) cells. J. Cell. Physiol. 2010, 224, 443–453. [Google Scholar] [CrossRef] [PubMed]
- Andretta, E.; Costa, C.; Longobardi, C.; Damiano, S.; Giordano, A.; Pagnini, F.; Montagnaro, S.; Quintiliani, M.; Lauritano, C.; Ciarcia, R. Potential Approaches Versus Approved or Developing Chronic Myeloid Leukemia. Therapy. Front. Oncol. 2021, 11, 801779. [Google Scholar] [CrossRef] [PubMed]
- Simone, C.; Jane, F.A. The argument for using imatinib in CML. Hematol. Am. Soc. Hematol. Educ. Prog. 2018, 2018, 61–167. [Google Scholar]
- Richardson, C.; Yan, S.; Vestal, C.G. Oxidative stress, bone marrow failure, and genome instability in hematopoietic stem cells. Int. J. Mol. Sci. 2015, 16, 2366–2385. [Google Scholar] [CrossRef] [Green Version]
- Mohammadalipour, A.; Dumbali, S.P.; Wenzel, P.L. Mitochondrial Transfer and Regulators of Mesenchymal Stromal Cell Function and Therapeutic Efficacy. Front. Cell Dev. Biol. 2020, 8, 603292. [Google Scholar] [CrossRef]
- Naughton, R.; Quiney, C.; Turner, S.D.; Cotter, T.G. Bcr-Abl-mediated redox regulation of the PI3K/ AKT pathway. Leukemia 2009, 23, 1432–1440. [Google Scholar] [CrossRef] [Green Version]
- Rodrigues, M.S.; Reddy, M.M.; Sattler, M. Cell cycle regulation by oncogenic tyrosine kinases in myeloid neoplasias: From molecular redox mechanisms to health implications. Antioxid. Redox Signal. 2008, 10, 1813–1848. [Google Scholar] [CrossRef]
- Singh, R.K.; Tripathi, A.K.; Tripathi, P.; Singh, S.; Singh, R.; Ahmad, R. Studies on biomarkers for oxidative stress in patients with chronic myeloid leukemia. Hematol. Oncol. Stem Cell Ther. 2009, 2, 285–288. [Google Scholar] [CrossRef] [Green Version]
- Kaweme, N.M.; Zhou, W.; Changwe, G.J.; Zhou, F. The significant role of redox system in myeloid leukemia: From pathogenesis to therapeutic applications. Biomark. Res. 2020, 8, 63. [Google Scholar] [CrossRef]
- Frijhoff, J.; Winyard, P.; Zarkovic, N.; Davies, S.S.; Stocker, R.; Cheng, D.; Knight, A.R.; Taylor, E.L.; Oettrich, J.; Ruskovska, T.; et al. Clinical Relevance of Biomarkers of Oxidative Stress. Antioxid. Redox Signal. 2015, 23, 1144–1170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sillar, J.R.; Germon, Z.P.; De Iuliis, G.N.; Dun, M.D. The role of reactive oxygen species in acute myeloid leukaemia. Int. J. Mol. Sci. 2019, 20, 6003. [Google Scholar] [CrossRef] [PubMed]
- Curta, J.C.; Rabello de Moraes, A.C.; Licínio, M.A.; Costa, A.; Santos-Silva, M.C. Effect of nitric oxide on the daunorubicin efflux mechanism in K562 cells. Cell Biol. Int. 2012, 36, 529–535. [Google Scholar] [CrossRef] [PubMed]
- Bedard, K.; Krause, K.H. The NOX family of ROS-generating NADPH oxidases: Physiology and pathophysiology. Physiol. Rev. 2007, 87, 245–313. [Google Scholar] [CrossRef] [PubMed]
- Sardina, J.L.; López-Ruano, G.; Sánchez-Abarca, L.I.; Pérez-Simón, J.A.; Gaztelumendi, A.; Trigueros, C.; Llanillo, M.; Sánchez-Yagüe, J.; Hernández-Hernández, A. p22phox-dependent NADPH oxidase activity is required for megakaryocytic differentiation. Cell Death Differ. 2010, 17, 1842–1854. [Google Scholar] [CrossRef] [Green Version]
- Saide, A.; Damiano, S.; Ciarcia, R.; Lauritano, C. Promising Activities of Marine Natural Products against Hematopoietic Malignancies. Biomedicines 2021, 9, 645. [Google Scholar] [CrossRef]
- Schwartsmann, G.; Brondani da Rocha, A.; Berlinck, R.G.; Jimeno, J. Marine organisms as a source of new anticancer agents. Lancet Oncol. 2001, 2, 221–225. [Google Scholar] [CrossRef]
- Bourbon, E.; Salles, G. Polatuzumab vedotin: An investigational anti-CD79b antibody drug conjugate for the treatment of diffuse large B-cell lymphoma. Expert Opin. Investig. Drugs 2020, 29, 1079–1088. [Google Scholar] [CrossRef]
- Ketchum, E.B.; Clarke, A.; Clemmons, A.B. Belantamab Mafodotin-blmf: A Novel Antibody-Drug Conjugate for Treatment of Patients With Relapsed/Refractory Multiple Myeloma. J. Adv. Pract. Oncol. 2022, 13, 77–85. [Google Scholar]
- Miralto, A.; Barone, G.; Romano, G.; Poulet, S.A.; Ianora, A.; Russo, G.L. The insidious effect of diatoms on copepod reproduction. Nature 1999, 402, 173–176. [Google Scholar] [CrossRef]
- Sarno, D.; Kooistra, W.H.C.F.; Medlin, L.K.; Percopo, I.; Zingone, A. Diversity in the genus Skeletonema (Bacillariophyceae). ii. An assessment of the taxonomy of S. costatum-like species with the description of four new species. J. Phycol. 2005, 41, 151–176. [Google Scholar] [CrossRef] [Green Version]
- Ingebrigtsen, R.A.; Hansen, E.; Andersen, J.H.; Eilertsen, H.E. Light and temperature effects on bioactivity in diatoms. J. Appl. Phycol. 2016, 28, 939–950. [Google Scholar] [CrossRef] [Green Version]
- Lauritano, C.; Andersen, J.H.; Hansen, E.; Albrigtsen, M.; Escalera, L.; Esposito, F.; Helland, K.; Hanssen, K. Romano, G.; Ianora, A. Bioactivity Screening of Microalgae for Antioxidant, Anti-Inflammatory, Anticancer, Anti-Diabetes, and Antibacterial Activities. Front. Mar. Sci. 2016, 3, 68. [Google Scholar] [CrossRef]
- Lauritano, C.; Carotenuto, Y.; Vitiello, V.; Buttino, I.; Romano, G.; Hwang, J.S.; Ianora, A. Effects of the oxylipin-producing diatom Skeletonema marinoi on gene expression levels in the calanoid copepod Calanus sinicus. Mar. Genom. 2015, 24, 89–94. [Google Scholar] [CrossRef] [PubMed]
- Fontana, A.; D’Ippolito, G.; Cutignano, A.; Miralto, A.; Ianora, A.; Romano, G. Chemistry of oxylipin pathways in marine diatoms. Pure Appl. Chem. 2007, 79, 481–490. [Google Scholar] [CrossRef]
- Miceli, M.; Cutignano, A.; Conte, M.; Ummarino, R.; Romanelli, A.; Ruvo, M.; Leone, M.; Mercurio, F.A.; Doti, N.; Manzo, E.; et al. Monoacylglycerides from the Diatom Skeletonema marinoi Induce Selective Cell Death in Cancer Cells. Mar. Drugs 2019, 17, 625. [Google Scholar] [CrossRef] [Green Version]
- Saide, A.; Martínez, K.A.; Ianora, A.; Lauritano, C. Unlocking the Health Potential of Microalgae as Sustainable Sources of Bioactive Compounds. Int. J. Mol. Sci. 2021, 22, 4383. [Google Scholar] [CrossRef]
- Smerilli, A.; Orefice, I.; Corato, F.; Ruban, A.; Brunet, C. Photoprotective and antioxidant responses to light spectrum and intensity variations on a coastal diatom. Environ. Microbiol. 2017, 19, 611–627. [Google Scholar] [CrossRef]
- Brillatz, T.; Lauritano, C.; Jacmin, M.; Khamma, S.; Marcourt, L.; Righi, D.; Romano, G.; Esposito, F.; Ianora, A.; Queiroz, E.F.; et al. Zebrafish-based identification of the antiseizure nucleoside inosine from the marine diatom Skeletonema marinoi. PLoS ONE 2018, 13, e0196195. [Google Scholar] [CrossRef] [Green Version]
- Lauritano, C.; Romano, G.; Roncalli, V.; Amoresano, A.; Fontanarosa, C.; Bastianini, M.; Braga, F.; Carotenuto, Y.; Ianora, A. New oxylipins produced at the end of a diatom bloom and their effects on copepod reproductive success and gene expression levels. Harmful Algae 2016, 55, 221–229. [Google Scholar] [CrossRef]
- d’Ippolito, G.; Cutignano, A.; Briante, R.; Febbraio, F.; Cimino, G.; Fontana, A. New C16 fatty-acid-based oxylipin pathway in the marine diatom Thalassiosira rotula. Org. Biomol. Chem. 2005, 3, 4065–4070. [Google Scholar] [CrossRef] [PubMed]
- Lauritano, C.; Carotenuto, Y.; Miralto, A.; Procaccini, G.; Ianora, A. Copepod population-specific response to a toxic diatom diet. PLoS ONE 2012, 7, e47262. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hockenbery, D.M.; Oltval, Z.N.; Yin, X.M.; Milliman, C.L.; Korsmeyer, S.J. Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell 1993, 75, 241–251. [Google Scholar] [CrossRef] [PubMed]
- Chipuk, J.E.; Bouchier-Hayes, L.; Green, D.R. Mitochondrial outer membrane permeabilization during apoptosis: The innocent bystander scenario. Cell Death Differ. 2006, 13, 1396–1402. [Google Scholar] [CrossRef] [Green Version]
- Korsmeyer, S.J.; Shutter, J.R.; Veis, D.J.; Merry, D.E.; Oltvai, Z.N. Bcl-2/Bax: A rheostat that regulates an anti-oxidant pathway and cell death. Semin. Cancer Biol. 1993, 4, 327–332. [Google Scholar]
- Veis, D.J.; Sorenson, C.M.; Shutter, J.R.; Korsmeyer, S.J. Bcl-2-deficient mice demonstrate fulminant lymphoid apoptosis, polycystic kidneys, and hypopigmented hair. Cell 1993, 75, 229–240. [Google Scholar] [CrossRef]
- Hanusova, V.; Skalova, L.; Kralova, V.; Matouskova, P. Potential anti-cancer drugs commonly used for other indications. Curr. Cancer Drug Targets 2015, 15, 35–52. [Google Scholar] [CrossRef]
- Riyasat, A.; Mirza, Z.; Ghulam, M.D.A.; Mohammad, A.K.; Shakeel, A.A.; Ghazi, A.D.; Adel, M.A.; Adeel, G.C.; Ishfaq, A.S. New anticancer agents: Recent developments in tumor therapy. Anticancer Res. 2012, 32, 2999–3005. [Google Scholar]
- Ozkan, G.; Ulusoy, S.; Orem, A.; Alkanat, M.; Mungan, S.; Yulug, E.; Yucesan, F.B. How Does Colistin-Induced Nephropathy Develop and Can It Be Treated? Antimicrob. Agents Chemother. 2013, 57, 3463–3469. [Google Scholar] [CrossRef] [Green Version]
- Korhonen, R.; Lahti, A.; Kankaanranta, H.; Moilanen, E. Nitric Oxide Production and Signaling in Inflammation. Curr. Drug Targets Inflamm. Allergy 2005, 4, 471–479. [Google Scholar] [CrossRef]
- Longobardi, C.; Damiano, S.; Andretta, E.; Prisco, F.; Russo, V.; Pagnini, F.; Florio, S.; Ciarcia, R. Curcumin Modulates Nitrosative Stress, Inflammation, and DNA Damage and Protects against Ochratoxin A-Induced Hepatotoxicity and Nephrotoxicity in Rats. Antioxidants 2021, 10, 1239. [Google Scholar] [CrossRef] [PubMed]
- Valko, M.; Leibfritz, D.; Moncol, J.; Cronin, M.T.; Mazur, M.; Telser, J. Free radicals and antioxidants in normal physiological functions and human disease. Int. J. Biochem. Cell Biol. 2007, 39, 44–84. [Google Scholar] [CrossRef] [PubMed]
- Clerkin, J.S.; Naughton, R.; Quiney, C.; Cotter, T.G. Mechanisms of ROS modulated cell survival during carcinogenesis. Cancer Lett. 2008, 266, 30–36. [Google Scholar] [CrossRef]
- Irwin, M.E.; Rivera-Del Valle, N.; Chandra, J. Redox control of leukemia: From molecular mechanisms to therapeutic opportunities. Antioxid. Redox Signal. 2013, 18, 1349–1383. [Google Scholar] [CrossRef] [Green Version]
- Rizwan, A.; Tripathi, A.; Tripathi, P.; Singh, R.; Singh, S.; Singh, R. Oxidative stress and antioxidant status in patients with chronic myeloid leukemia. Indian J. Clin. Biochem. 2008, 23, 328–333. [Google Scholar]
- Slupianek, A.; Poplawski, T.; Jozwiakowski, S.K.; Cramer, K.; Pytel, D.; Stoczynska, E.; Nowicki, M.O.; Blasiak, J.; Skorski, T. BCR/ABL stimulates WRN to promote survival and genomic instability. Cancer Res. 2011, 71, 842–851. [Google Scholar] [CrossRef]
- Singh, M.M.; Irwin, M.E.; Gao, Y.; Ban, K.; Shi, P.; Arlinghaus, R.B.; Amin, H.M.; Chandra, J. Inhibition of the NADPH oxidase regulates heme oxygenase 1 expression in chronic myeloid leukemia. Cancer 2012, 118, 3433–3445. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Torres-Tiji, Y.; Fields, F.J.; Mayfield, S.P. Microalgae as a future food source. Biotechnology 2020, 41, 107536. [Google Scholar] [CrossRef]
- Fradique, M.; Batista, A.P.; Nunes, C.M.; Gouveia, L.; Bandarra, N.M.; Raymundo, A. Isochrysis galbana and Diacronema vlkianum biomass incorporation in pasta products as PUFA’s source. LWT—Food Sci. Technol. 2013, 50, 312–319. [Google Scholar] [CrossRef] [Green Version]
- Gouveia, L.; Coutinho, C.; Mendonça, E.; Batista, A.P.; Sousa, I.; Bandarra, N.M.; Raymundo, A. Functional biscuits with PUFA-ω3 from Isochrysis galbana. J. Sci. Food Agric. 2008, 88, 891–896. [Google Scholar] [CrossRef] [Green Version]
- Martínez, K.A.; Saide, A.; Crespo, G.; Martín, J.; Romano, G.; Reyes, F.; Lauritano, C.; Ianora, A. Promising Antiproliferative Compound From the Green Microalga Dunaliella tertiolecta Against Human Cancer Cells. Front. Mar. Sci. 2022, 9, 778108. [Google Scholar] [CrossRef]
- Montagnaro, S.; Damiano, S.; Ciarcia, R.; Puzio, M.V.; Ferrara, G.; Iovane, V.; Forte, I.M.; Giordano, A.; Pagnini, U. Caprine herpesvirus 1 (CpHV-1) as a potential candidate for oncolytic virotherapy. Cancer Biol. Ther. 2019, 20, 42–51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ohkawa, H.; Ohishi, N.; Yagi, K. Assay for lipid peroxide in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 1979, 95, 351–358. [Google Scholar] [CrossRef] [PubMed]
- Florio, S.; Ciarcia, R.; Crispino, L.; Pagnini, U.; Ruocco, A.; Kumar, C.; D’Andrilli, G.; Russo, F. Hydrocortisone has a protective effect on CyclosporinA-induced cardiotoxicity. J. Cell. Physiol. 2003, 195, 21–26. [Google Scholar] [CrossRef] [PubMed]
- Tsai, M.C.; Huang, T.L. Increased activities of both superoxide dismutase and catalase were indicators of acute depressive episodes in patients with major depressive disorder. Psychiatry Res. 2016, 235, 38–42. [Google Scholar] [CrossRef]
- Onuma, S.; Manabe, A.; Yoshino, Y.; Matsunaga, T.; Asai, T.; Ikari, A. Upregulation of Chemoresistance by Mg2+ Deficiency through Elevation of ATP Binding Cassette Subfamily B Member 1 Expression in Human Lung Adenocarcinoma A549 Cells. Cells 2021, 10, 1179. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene | Accession NO. | Sequences of Primer Pairs (5′→3′) | Amplicon Size |
---|---|---|---|
NOX2 | NM_000397.4 | F: CTACAACATCTACCTCACTGGCTG | 117 |
R: GGCCGTCCATACAAAGTCTTT | |||
p22-phox | NM_000101.4 | F: TGTGGCGGGCGTGTTTGTGT | 241 |
R: CAGTAGGTAGATGCCGCTCG | |||
Bax | NM_001291428.2 | F: TCAGGATGCGTCCACCAAGAAG | 103 |
R: TGTGTCCACGGCGGCAATCATC | |||
Bcl-2 | NM_000633.3 | F: TCGCCCTGTGGATGACTGA | 134 |
R: CAGAGACAGCCAGGAGAAATCA | |||
GAPDH | NM_001256799.3 | F: GAGTCAAGGGATTTGGTCGT | 138 |
R: GACAAGCTTCCCGTTCTCAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ciarcia, R.; Longobardi, C.; Ferrara, G.; Montagnaro, S.; Andretta, E.; Pagnini, F.; Florio, S.; Maruccio, L.; Lauritano, C.; Damiano, S. The Microalga Skeletonema marinoi Induces Apoptosis and DNA Damage in K562 Cell Line by Modulating NADPH Oxidase. Molecules 2022, 27, 8270. https://doi.org/10.3390/molecules27238270
Ciarcia R, Longobardi C, Ferrara G, Montagnaro S, Andretta E, Pagnini F, Florio S, Maruccio L, Lauritano C, Damiano S. The Microalga Skeletonema marinoi Induces Apoptosis and DNA Damage in K562 Cell Line by Modulating NADPH Oxidase. Molecules. 2022; 27(23):8270. https://doi.org/10.3390/molecules27238270
Chicago/Turabian StyleCiarcia, Roberto, Consiglia Longobardi, Gianmarco Ferrara, Serena Montagnaro, Emanuela Andretta, Francesco Pagnini, Salvatore Florio, Lucianna Maruccio, Chiara Lauritano, and Sara Damiano. 2022. "The Microalga Skeletonema marinoi Induces Apoptosis and DNA Damage in K562 Cell Line by Modulating NADPH Oxidase" Molecules 27, no. 23: 8270. https://doi.org/10.3390/molecules27238270