Agarwood Essential Oil Ameliorates Restrain Stress-Induced Anxiety and Depression by Inhibiting HPA Axis Hyperactivity
Abstract
:1. Introduction
2. Results
2.1. Effects of AEO on Restraint Stress-Induced Anxiety by the Elevated Plus Maze (EPM) Test in Mice
2.2. Effects of AEO on Restraint Stress-Induced Anxiety by the Light Dark Exploration (LDE) Test in Mice
2.3. Effects of AEO on Restraint Stress-Induced Anxiety by the Open Field (OF) Test in Mice
2.4. Effects of AEO on Restraint Stress-Induced Depression by the Tail Suspension (TS) Test in Mice
2.5. Effects of AEO on Restraint Stress-Induced Depression by the Forced Swimming (FS) Test in Mice
2.6. Effects of AEO on Inflammatory Cytokines in Restraint Stress-Induced Mice Serum
2.7. Effects of AEO on nNOS Gene Transcription and Protein Expression in Mice Brain
2.8. Effects of AEO on CRF and CRFR Expression in Mice Brain
2.9. Effects of AEO on ACTH and CORT Concentrations in the Serum of Restraint Stress-Induced Mice
3. Discussion
4. Materials and Methods
4.1. AEO Preparation and Chemical Analysis
4.2. Animals
4.3. Reagents
4.4. Experimental Design
4.5. Elevated Plus Maze Test
4.6. Light Dark Exploration Test
4.7. Open Field Test
4.8. Tail Suspension Test
4.9. Forced Swimming Test
4.10. RT-PCR
4.11. Western Blot Experiment
4.12. Statistics Analysis
Author Contributions
Funding
Conflicts of Interest
References
- CITES. Amendments to appendices I and II of CITES. In Proceedings of the Thirteenth Meeting of the Conference of the Parties, Bangkok, Thailand, 2 October 2004. [Google Scholar]
- Hashim, Y.Z.; Kerr, P.G.; Abbas, P.; Mohd Salleh, H. Aquilaria spp. (agarwood) as source of health beneficial compounds: A review of traditional use, phytochemistry and pharmacology. J. Ethnopharmacol. 2016, 189, 331–360. [Google Scholar] [CrossRef] [PubMed]
- Korinek, M.; Wagh, V.D.; Lo, I.W.; Hsu, Y.M.; Hsu, H.Y.; Hwang, T.L.; Wu, Y.C.; Cheng, Y.B.; Chen, B.H.; Chang, F.R. Antiallergic Phorbol Ester from the Seeds of Aquilaria malaccensis. Int. J. Mol. Sci. 2016, 17, 398. [Google Scholar] [CrossRef] [PubMed]
- National Pharmacopoeia Committee. Pharmacopoeia of the People’s Republic of China, 1st ed.; Chinese Medical Science and Technology Press: Beijing, China, 2015; pp. 185–186. [Google Scholar]
- Dahham, S.S.; Tabana, Y.M.; Iqbal, M.A.; Ahamed, M.B.; Ezzat, M.O.; Majid, A.S.; Majid, A.M. The Anticancer, antioxidant and antimicrobial properties of the sesquiterpene β-caryophyllene from the essential oil of Aquilaria crassna. Molecules 2015, 20, 11808–11829. [Google Scholar] [CrossRef] [PubMed]
- Lin, Z.; Li, H.; Mei, Q. Comparative study on antiinflammatory of agarwood leaves and resion. Chin. Arch. Tradit. Chin. Med. 2013, 31, 548–549. [Google Scholar]
- Peana, A.T.; D’Aquila, P.S.; Panin, F.; Serra, G.; Pippia, P.; Moretti, M.D. Anti-inflammatory activity of linalool and linalyl acetate constituents of essential oils. Phytomedicine 2002, 9, 721–726. [Google Scholar] [CrossRef] [PubMed]
- Yadav, D.K.; Mudgal, V.; Agrawal, J.; Maurya, A.K.; Bawankule, D.U.; Chanotiya, C.S.; Khan, F.; Thul, S.T. Molecular docking and ADME studies of natural compounds of Agarwood oil for topical anti-inflammatory activity. Curr. Comput.-Aided Drug Des. 2013, 9, 360–370. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Qiao, L.; Xie, D.; Yuan, Y.; Chen, N.; Dai, J.; Guo, S. 2-(2-phenylethyl)chromones from Chinese eaglewood. Phytochemistry 2012, 76, 92–97. [Google Scholar] [CrossRef] [PubMed]
- Ueda, J.Y.; Imamura, L.; Tezuka, Y.; Tran, Q.L.; Tsuda, M.; Kadota, S. New sesquiterpene from Vietnamese agarwood and its induction effect on brain-derived neurotrophic factor mRNA expression in vitro. Bioorg. Med. Chem. 2006, 14, 3571–3574. [Google Scholar] [CrossRef] [PubMed]
- Supasuteekul, C.; Tadtong, S.; Putalun, W.; Tanaka, H.; Likhitwitayawuid, K.; Tengamnuay, P.; Sritularak, B. Neuritogenic and neuroprotective constituents from Aquilaria crassna leaves. J. Food Biochem. 2017, 41, e12365. [Google Scholar] [CrossRef]
- Yang, L.; Qiao, L.R.; Zhang, J.J.; Dai, J.G.; Guo, S.X. Two new sesquiterpene derivatives from Chinese eaglewood. J. Asian Nat. Prod. Res. 2012, 14, 1054–1058. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.; Qiao, L.; Ji, C.; Xie, D.; Gong, N.B.; Lu, Y.; Zhang, J.; Dai, J.; Guo, S. Antidepressant abietane diterpenoids from Chinese eaglewood. J. Nat. Prod. 2013, 76, 216–222. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Wang, C.; Peng, D.; Liu, X.; Wu, C.; Guo, P.; Wei, J. Agarwood essential oil displays sedative-hypnotic effects through the GABAergic system. Molecules 2017, 22, 2190. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Zhou, Y.; Ma, F.; Zhang, Q.; Liu, Y.; Gong, B.; Guo, P.; Wei, J. Effect of agarwood produced by whole-tree agarwood-inducing technique on hypnotic and spontaneous activity inhibition of mice. J. Int. Pharm. Res. 2016, 43, 1082–1087. [Google Scholar]
- Takemoto, H.; Ito, M.; Shiraki, T.; Yagura, T.; Honda, G. Sedative effects of vapor inhalation of agarwood oil and spikenard extract and identification of their active components. J. Nat. Med. 2008, 62, 41–46. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Wang, W.; Fang, H.; Liu, Q.; Zhang, W. Agarofuan Derivatives, Their Preparation, Pharmaceutical Composition Containing Them and Their Use as Medicine. U.S. Patent 6,486,201, 26 November 2002. [Google Scholar]
- Liu, Q.; Wang, D.; Li, C.; Lv, D. The synthensis and centrol nervous system activity of agarofuran. Chin. J. Med. Chem. 2003, 13, 125–130. [Google Scholar]
- Griebel, G.; Holmes, A. 50 years of hurdles and hope in anxiolytic drug discovery. Nat. Rev. Drug Discov. 2013, 12, 667–687. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wittchen, H.U.; Jacobi, F.; Rehm, J.; Gustavsson, A.; Svensson, M.; Jonsson, B.; Olesen, J.; Allgulander, C.; Alonso, J.; Faravelli, C.; et al. The size and burden of mental disorders and other disorders of the brain in Europe 2010. Eur. Neuropsychopharmacol. 2011, 21, 655–679. [Google Scholar] [CrossRef] [PubMed]
- Gadek, A.; Tadeusz, J.; Rachwalska, P.; Bugajski, J. Cytokines, prostaglandins and nitric oxide in the regulation of stress-response systems. Pharmacol. Rep. 2013, 65, 1655–1662. [Google Scholar] [CrossRef]
- Sanders, J.; Nemeroff, C. The CRF system as a therapeutic target for neuropsychiatric disorders. Trends Pharmacol. Sci. 2016, 37, 1045–1054. [Google Scholar] [CrossRef] [PubMed]
- Chalmers, D.; Lovenberg, T.; Souza, E.D. Localization of novel corticotropin-releasing factor receptor (CRF,) mRNA expression to specific subcortical nuclei in rat brain comparison with CRF, receptor mRNA expression. J. Neurosci. 1995, 15, 6340–6350. [Google Scholar] [CrossRef] [PubMed]
- Bourin, M. Animal models for screening anxiolytic-like drugs: A perspective. Dialogues Clin. Neurosci. 2015, 17, 295–303. [Google Scholar] [PubMed]
- Bourin, M.; Hascoët, M. The mouse light/dark box test. Eur. J. Pharmacol. 2003, 463, 55–65. [Google Scholar] [CrossRef]
- Novaes, L.S.; Dos Santos, N.B.; Batalhote, R.F.P.; Malta, M.B.; Camarini, R.; Scavone, C.; Munhoz, C.D. Environmental enrichment protects against stress-induced anxiety: Role of glucocorticoid receptor, ERK, and CREB signaling in the basolateral amygdala. Neuropharmacology 2017, 113, 457–466. [Google Scholar] [CrossRef] [PubMed]
- Bredt, D.S.; Glatt, C.E.; Hwang, P.M.; Fotuhi, M.; Dawson, T.M.; Snyder, S.H. Nitric oxide synthase protein and mRNA are discretely localized in neuronal populations of the mammalian CNS together with NADPH diaphorase. Neuron 1991, 7, 615–624. [Google Scholar] [CrossRef]
- Ota, Y.; Ago, Y.; Tanaka, T.; Hasebe, S.; Toratani, Y.; Onaka, Y.; Hashimoto, H.; Takuma, K.; Matsuda, T. Anxiolytic-like effects of restraint during the dark cycle in adolescent mice. Behav. Brain Res. 2015, 284, 103–111. [Google Scholar] [CrossRef] [PubMed]
- Turnbull, A.V.; Rivier, C.L. Regulation of the hypothalamic-pituitary-adrenal axis by cytokines: Actions and mechanisms of action. Physiol. Rev. 1999, 79, 1–71. [Google Scholar] [CrossRef] [PubMed]
- Marsland, A.L.; Walsh, C.; Lockwood, K.; John-Henderson, N.A. The effects of acute psychological stress on circulating and stimulated inflammatory markers: A systematic review and meta-analysis. Brain Behav. Immun. 2017, 64, 208–219. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.R.; Zhang, Y.; Rao, Y.B.; Chen, X.; Lou, H.F.; Zhang, Y.; Xie, H.Y.; Fang, P.; Hu, L.W. The changes in, and relationship between, plasma nitric oxide and corticotropin-releasing hormone in patients with major depressive disorder. Clin. Exp. Pharmacol. Physiol. 2017, 45, 10–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nelson, R.J.; Trainor, B.C.; Chiavegatto, S.; Demas, G.E. Pleiotropic contributions of nitric oxide to aggressive behavior. Neurosci. Biobehav. Rev. 2006, 30, 346–355. [Google Scholar] [CrossRef] [PubMed]
- Gadek, A.; Tadeusz, J.; Rachwalska, P.; Spyrka, J.; Bugajski, J. Effect of repeated restraint on homotypic stress-induced nitric oxide synthases expression in brain structures regulating HPA axis. Pharmacol. Rep. 2012, 64, 1381–1390. [Google Scholar] [CrossRef]
- Joung, H.Y.; Jung, E.Y.; Kim, K.; Lee, M.S.; Her, S.; Shim, I. The differential role of NOS inhibitors on stress-induced anxiety and neuroendocrine alterations in the rat. Behav. Brain Res. 2012, 235, 176–181. [Google Scholar] [CrossRef] [PubMed]
- Belzung, C.; Yalcin, I.; Griebel, G.; Surget, A.; Leman, S. Neuropeptides in psychiatric diseases: An overview with a particular focus on depression and anxiety disorders. CNS Neurol. Disord. Drug Targets 2006, 5, 135–145. [Google Scholar] [PubMed]
- Henckens, M.J.; Deussing, J.M.; Chen, A. Region-specific roles of the corticotropin-releasing factor-urocortin system in stress. Nat. Rev. Neurosci. 2016, 17, 636–651. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Chen, H.; Yang, Y.; Zhang, Z.; Wei, J.; Meng, H.; Chen, W.; Feng, J.; Gan, B.; Chen, X.; et al. Whole-tree agarwood-inducing technique: An efficient novel technique for producing high-quality agarwood in cultivated Aquilaria sinensis trees. Molecules 2013, 18, 3086–3106. [Google Scholar] [CrossRef] [PubMed]
- Pellow, S.; Chopin, P.; File, S.E.; Briley, M. Validation of open: Closed arm entries in an elevated plus-maze as a measure of anxiety in the rat. J. Neurosci. Methods 1985, 14, 149–167. [Google Scholar] [CrossRef]
- Crawley, J.; Goodwin, F.K. Preliminary report of a simple animal behavior model for the anxiolytic effects of benzodiazepines. Pharmacol. Biochem. Behav. 1980, 13, 167–170. [Google Scholar] [CrossRef]
- Yan, M.Z.; Chang, Q.; Zhong, Y.; Xiao, B.X.; Feng, L.; Cao, F.R.; Pan, R.L.; Zhang, Z.S.; Liao, Y.H.; Liu, X.M. Lotus leaf alkaloid extract displays sedative-hypnotic and anxiolytic effects through GABAA Receptor. J. Agric. Food Chem. 2015, 63, 9277–9285. [Google Scholar] [CrossRef] [PubMed]
- Xu, P.; Wang, K.; Lu, C.; Dong, L.; Gao, L.; Yan, M.; Aibai, S.; Yang, Y.; Liu, X. Protective effects of linalool against amyloid β-induced cognitive deficits and damages in mice. Life Sci. 2017, 174, 21–27. [Google Scholar] [CrossRef] [PubMed]
- Steru, L.; Chermat, R.; Thierry, B.; Simon, P. The tail suspension test: A new method for screening antidepressants in mice. Psychopharmacology 1985, 85, 367–370. [Google Scholar] [CrossRef] [PubMed]
- Porsolt, R.D.; Bertin, A.; Jalfre, M. Behavioral despair in mice: A primary screening test for antidepressants. Arch. Int. Pharmacodyn. Ther. 1977, 229, 327–336. [Google Scholar] [PubMed]
- Wang, S.; Zhang, X.; Liu, M.; Luan, H.; Ji, Y.; Guo, P.; Wu, C. Chrysin inhibits foam cell formation through promoting cholesterol efflux from RAW264.7 macrophages. Pharm. Biol. 2015, 53, 1481–1487. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tabebordbar, M.; Zhu, K.; Cheng, J.K.W.; Chew, W.L.; Widrick, J.J.; Yan, W.X.; Maesner, C.; Wu, E.Y.; Xiao, R.; Ran, F.A.; et al. In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science 2016, 351, 407–411. [Google Scholar] [CrossRef] [PubMed]
- Roshan, A.; Murai, K.; Fowler, J.; Simons, B.D.; Nikolaidou, V.; Jones, P.H. Human keratinocytes have two interconvertible modes of proliferation. Nat. Cell Biol. 2016, 18, 145–156. [Google Scholar] [CrossRef] [PubMed]
Name | Forward (5′-3′) | Reverse (3′-5′) |
---|---|---|
nNOS | CCGATCATTGACGGCGAGAAT | CTGGTGAAGGAACGGGTCAG |
CRF | CCTCAGCCGGTTCTGATCC | GCGGAAAAAGTTAGCCGCAG |
CRFR | GGGCAGCCCGTGTGAATTATT | ATGACGGCAATGTGGTAGTGC |
β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, S.; Wang, C.; Yu, Z.; Wu, C.; Peng, D.; Liu, X.; Liu, Y.; Yang, Y.; Guo, P.; Wei, J. Agarwood Essential Oil Ameliorates Restrain Stress-Induced Anxiety and Depression by Inhibiting HPA Axis Hyperactivity. Int. J. Mol. Sci. 2018, 19, 3468. https://doi.org/10.3390/ijms19113468
Wang S, Wang C, Yu Z, Wu C, Peng D, Liu X, Liu Y, Yang Y, Guo P, Wei J. Agarwood Essential Oil Ameliorates Restrain Stress-Induced Anxiety and Depression by Inhibiting HPA Axis Hyperactivity. International Journal of Molecular Sciences. 2018; 19(11):3468. https://doi.org/10.3390/ijms19113468
Chicago/Turabian StyleWang, Shuai, Canhong Wang, Zhangxin Yu, Chongming Wu, Deqian Peng, Xinmin Liu, Yangyang Liu, Yun Yang, Peng Guo, and Jianhe Wei. 2018. "Agarwood Essential Oil Ameliorates Restrain Stress-Induced Anxiety and Depression by Inhibiting HPA Axis Hyperactivity" International Journal of Molecular Sciences 19, no. 11: 3468. https://doi.org/10.3390/ijms19113468