Genome-Wide Analysis of LncRNA in Bovine Mammary Epithelial Cell Injuries Induced by Escherichia Coli and Staphylococcus Aureus
Abstract
:1. Introduction
2. Results
2.1. Cell Injuries Induced by Inactivated E. coli and S. aureus
2.2. Identification of lncRNAs in Bovine Mammary Cells Injured by Inactivated E. coli and S. aureus
2.3. Profiles of lncRNAs Differentially Expressed upon Injury of Bovine Mammary Cell by Inactivated E. coli and S. aureus
2.4. Comparison of lncRNA Characteristics in Bovine Mammary Cell Injuries by Inactivated E. coli and S. aureus
2.5. Target Predictions: LncRNA–miRNA–mRNA Regulatory Network Analysis
2.6. Differential Expression of lncRNA Was Verified by Quantitative PCR
3. Discussion
4. Materials and Methods
4.1. Cell and Bacteria
4.2. Construction of Mastitis Model in MAC-T Cells Induced by E. coli and S. aureus
4.3. Quantitative Real-Time PCR
4.4. Determination of Cell Cycle
4.5. Annexin V-FITC and PI Assay for Apoptosis
4.6. Measurement of the Levels of Intracellular ROS
4.7. Cell Viability Assay
4.8. Establishment of LncRNA Library
4.9. LncRNA Raw Data Processing and Identification
4.10. Analysis of Biological Information and Data Processing
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- De Vliegher, S.; Fox, L.; Piepers, S.; McDougall, S.; Barkema, H. Invited review: Mastitis in dairy heifers: Nature of the disease, potential impact, prevention, and control. J. Dairy Sci. 2012, 95, 1025–1040. [Google Scholar] [CrossRef]
- Liu, C.; Tang, X.; Zhang, W.; Li, G.; Chen, Y.; Guo, A.; Hu, C. 6-Bromoindirubin-3’-Oxime Suppresses LPS-Induced Inflammation via Inhibition of the TLR4/NF-κB and TLR4/MAPK Signaling Pathways. Inflammation 2019, 42, 2192–2204. [Google Scholar] [CrossRef]
- Burović, J. Isolation of bovine clinical mastitis bacterial pathogens and their antimicrobial susceptibility in the Zenica region in 2017. Vet. Stanica 2020, 51, 47–52. [Google Scholar] [CrossRef]
- Knežević, K.; Maćešić, N.; Mazić, M.; Cvetnić, M.; Butković, I.; Šavorić, J.; Cvetnić, L.; Efendić, M.; Getz, I.; Benić, M.; et al. Use of somatic cell count in the diagnosis of mastitis and its impacts on milk quality. Vet. Stanica 2021, 52, 751–764. [Google Scholar]
- Zadoks, R.N.; Middleton, J.R.; McDougall, S.; Katholm, J.; Schukken, Y. Molecular Epidemiology of Mastitis Pathogens of Dairy Cattle and Comparative Relevance to Humans. J. Mammary Gland. Biol. Neoplasia 2011, 16, 357–372. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vangroenweghe, F.; Lamote, I.; Burvenich, C. Physiology of the periparturient period and its relation to severity of clinical mastitis. Domest. Anim. Endocrinol. 2005, 29, 283–293. [Google Scholar] [CrossRef] [PubMed]
- Saidi, R.; Cantekin, Z.; Mimoune, N.; Ergun, Y.; Solmaz, H.; Khelef, D.; Kaidi, R. Investigation of the presence of slime production, Van A gene and antiseptic resistance genes in Staphylococci isolated from bovine mastitis in Algeria. Veter-Stanica 2020, 52, 57–63. [Google Scholar] [CrossRef]
- Cvetnić, L.; Samardžija, M.; Duvnjak, S.; Habrun, B.; Cvetnić, M.; Tkalec, V.J.; Đuričić, D.; Benić, M. Multi Locus Sequence Typing and spa Typing of Staphylococcus aureus Isolated from the Milk of Cows with Subclinical Mastitis in Croatia. Microorganism 2021, 9, 725. [Google Scholar] [CrossRef]
- Lamari, I.; Mimoune, N.; Khelef, D. Effect of feed additive supplementation on bovine subclinical mastitis. Veter-Stanica 2021, 52, 445–460. [Google Scholar] [CrossRef]
- Lai, J.-L.; Liu, Y.-H.; Peng, Y.-C.; Ge, P.; He, C.-F.; Liu, C.; Chen, Y.-Y.; Guo, A.-Z.; Hu, C.-M. Indirubin Treatment of Lipopolysaccharide-Induced Mastitis in a Mouse Model and Activity in Mouse Mammary Epithelial Cells. Mediat. Inflamm. 2017, 2017. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Zhou, E.; Liu, Z.; Li, F.; Liang, D.; Liu, B.; Song, X.; Zhao, F.; Fen, X.; Li, D.; et al. Staphylococcus aureus and Escherichia coli elicit different innate immune responses from bovine mammary epithelial cells. Veter. Immunol. Immunopathol. 2013, 155, 245–252. [Google Scholar] [CrossRef]
- Gunther, J.; Esch, K.; Poschadel, N.; Petzl, W.; Zerbe, H.; Mitterhuemer, S.; Blum, H.; Seyfert, H.M. Comparative kinetics of Escherichia coli- and Staphylococcus aureus-specific activation of key immune pathways in mammary epithelial cells demon-strates that S. aureus elicits a delayed response dominated by interleukin-6 (IL-6) but not by IL-1A or tumor necrosis factor alpha. Infect. Immun. 2011, 79, 695–707. [Google Scholar] [PubMed] [Green Version]
- Gilbert, F.B.; Cunha, P.; Jensen, K.; Glass, E.J.; Foucras, G.; Robert-Granié, C.; Rupp, R.; Rainard, P. Differential response of bovine mammary epithelial cells to Staphylococcus aureus or Escherichia coli agonists of the innate immune system. Veter-Res. 2013, 44, 1–23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ibeagha-Awemu, E.M.; Ibeagha, A.E.; Messier, S.; Zhao, X. Proteomics, genomics, and pathway analyses of Escherichia coli and Staphylococcus aureus infected milk whey reveal molecular pathways and networks involved in mastitis. J. Proteome Res. 2010, 9, 4604–4619. [Google Scholar] [CrossRef]
- Bannerman, D.D.; Paape, M.J.; Lee, J.W.; Zhao, X.; Hope, J.C.; Rainard, P. Escherichia coli and Staphylococcus aureus elicit differential innate immune responses following intramammary infection. Clin. Diagn. Lab. Immunol. 2004, 11, 463–472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sadek, K.; Saleh, E.; Ayoub, M. Selective, reliable blood and milk bio-markers for diagnosing clinical and subclinical bovine mastitis. Trop. Anim. Health Prod. 2017, 49, 431–437. [Google Scholar] [CrossRef] [PubMed]
- Rainard, P.; Cunha, P.; Bougarn, S.; Fromageau, A.; Rossignol, C.; Gilbert, F.B.; Berthon, P. T Helper 17-Associated Cytokines Are Produced during Antigen-Specific Inflammation in the Mammary Gland. PLoS ONE 2013, 8, e63471. [Google Scholar] [CrossRef] [Green Version]
- Capuco, A.V.; Wood, D.L.; Baldwin, R.; Mcleod, K.; Paape, M.J. Mammary cell number, proliferation, and apoptosis during a bovine lactation: Relation to milk production and effect of bST. J. Dairy Sci. 2001, 84, 2177–2187. [Google Scholar] [CrossRef]
- Statello, L.; Guo, C.-J.; Chen, L.-L.; Huarte, M. Gene regulation by long non-coding RNAs and its biological functions. Nat. Rev. Mol. Cell Biol. 2021, 22, 96–118. [Google Scholar] [CrossRef]
- Beermann, J.; Piccoli, M.-T.; Viereck, J.; Thum, T. Non-coding RNAs in Development and Disease: Background, Mechanisms, and Therapeutic Approaches. Physiol. Rev. 2016, 96, 1297–1325. [Google Scholar] [CrossRef] [Green Version]
- Taniue, K.; Akimitsu, N. The Functions and Unique Features of LncRNAs in Cancer Development and Tumorigenesis. Int. J. Mol. Sci. 2021, 22, 632. [Google Scholar] [CrossRef] [PubMed]
- Quinn, J.J.; Chang, H.Y. Unique features of long non-coding RNA biogenesis and function. Nat. Rev. Genet. 2016, 17, 47–62. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Deng, L.; Huang, N.; Sun, F. The Biological Roles of lncRNAs and Future Prospects in Clinical Application. Diseases 2021, 9, 8. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.; Ming, Z.; Gong, A.Y.; Wang, Y.; Chen, X.; Hu, G.; Zhou, R.; Shibata, A.; Swanson, P.C.; Chen, X.M. A long noncoding RNA, lincRNA-Tnfaip3, acts as a coregulator of NF-kappaB to modulate inflammatory gene transcription in mouse macro-phages. FASEB J. 2017, 31, 1215–1225. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, Y.; Sun, H.; Zhu, L.; Ji, L.; Liu, H. Downregulating lncRNA PRNCR1 ameliorates LPS-induced pulmonary vascular endothelial cell injury by modulating miR-330-5p/TLR4 axis. J. Biochem. Mol. Toxicol. 2021, 35, e22644. [Google Scholar] [CrossRef]
- Maity, S.; Ambatipudi, K. Mammary microbial dysbiosis leads to the zoonosis of bovine mastitis: A One-Health perspective. FEMS Microbiol. Ecol. 2020, 97, 241. [Google Scholar] [CrossRef]
- Tsugami, Y.; Wakasa, H.; Kawahara, M.; Nishimura, T.; Kobayashi, K. Lipopolysaccharide and lipoteichoic acid influence milk production ability via different early responses in bovine mammary epithelial cells. Exp. Cell Res. 2021, 400, 112472. [Google Scholar] [CrossRef]
- Angelopoulou, A.; Warda, A.K.; Hill, C.; Ross, R.P. Non-antibiotic microbial solutions for bovine mastitis—Live biotherapeutics, bacteriophage, and phage lysins. Crit. Rev. Microbiol. 2019, 45, 564–580. [Google Scholar] [CrossRef]
- Gomes, F.; Henriques, M. Control of Bovine Mastitis: Old and Recent Therapeutic Approaches. Curr. Microbiol. 2015, 72, 377–382. [Google Scholar] [CrossRef] [Green Version]
- Krömker, V.; Leimbach, S. Mastitis treatment-Reduction in antibiotic usage in dairy cows. Reprod. Domest. Anim. 2017, 52, 21–29. [Google Scholar] [CrossRef] [Green Version]
- Mimoune, N.; Saidi, R.; Benadjel, O.; Khelef, D.; Kaidi, R. Alternative treatment of bovine mastitis. Veter-Stanica 2021, 52, 639–649. [Google Scholar] [CrossRef]
- Benić, M.; Maćešić, N.; Cvetnić, L.; Habrun, B.; Cvetnić, Ž.; Turk, R.; Đuričić, D.; Lojkić, M.; Dobranić, V.; Valpotić, H.; et al. Bovine mastitis: A persistent and evolving problem requiring novel approaches for its control—A review. Vet. Arhiv. 2018, 88, 535–557. [Google Scholar] [CrossRef]
- Yang, Z.; Jiang, S.; Shang, J.; Jiang, Y.; Dai, Y.; Xu, B.; Yu, Y.; Liang, Z.; Yang, Y. LncRNA: Shedding light on mechanisms and opportunities in fibrosis and aging. Ageing Res. Rev. 2019, 52, 17–31. [Google Scholar] [CrossRef] [PubMed]
- Liao, K.; Xu, J.; Yang, W.; You, X.; Zhong, Q.; Wang, X. The research progress of LncRNA involved in the regulation of inflammatory diseases. Mol. Immunol. 2018, 101, 182–188. [Google Scholar] [CrossRef] [PubMed]
- Batista, P.J.; Chang, H.Y. Long Noncoding RNAs: Cellular Address Codes in Development and Disease. Cell 2013, 152, 1298–1307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zuo, X.; Chen, Z.; Gao, W.; Zhang, Y.; Wang, J.; Wang, J.; Cao, M.; Cai, J.; Wu, J.; Wang, X. M6A-mediated upregulation of LINC00958 increases lipogenesis and acts as a nanotherapeutic target in hepatocellular carcinoma. J. Hematol. Oncol. 2020, 13, 1–20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lai, J.L.; Liu, Y.H.; Liu, C.; Qi, M.P.; Liu, R.N.; Zhu, X.F.; Zhou, Q.G.; Chen, Y.Y.; Guo, A.Z.; Hu, C.M. Indirubin inhibits LPS-Induced inflammation via TLR4 abrogation mediated by the NF-kB and MAPK signaling pathways. Inflammation 2017, 40, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Li, T.; Lin, C.; Zhu, Y.; Xu, H.; Yin, Y.; Wang, C.; Tang, X.; Song, T.; Guo, A.; Chen, Y.; et al. Transcriptome Profiling of m6A mRNA Modification in Bovine Mammary Epithelial Cells Treated with Escherichia coli. Int. J. Mol. Sci. 2021, 22, 6254. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Liu, C.; Li, T.; Lin, C.; Hao, Z.; Zhang, H.; Zhao, G.; Chen, Y.; Guo, A.; Hu, C. Gambogic acid alleviates inflammation and apoptosis and protects the blood-milk barrier in mastitis induced by LPS. Int. Immunopharmacol. 2020, 86, 106697. [Google Scholar] [CrossRef]
- Kopp, F.; Mendell, J.T. Functional Classification and Experimental Dissection of Long Noncoding RNAs. Cell 2018, 172, 393–407. [Google Scholar] [CrossRef] [Green Version]
- Wang, X.; Wang, H.; Zhang, R.; Li, D.; Gao, M.-Q. LRRC75A antisense lncRNA1 knockout attenuates inflammatory responses of bovine mammary epithelial cells. Int. J. Biol. Sci. 2020, 16, 251–263. [Google Scholar] [CrossRef] [Green Version]
- Kim, H.-Y.; Jeon, H.; Bae, C.H.; Lee, Y.; Kim, H.; Kim, S. Rumex japonicus Houtt. alleviates dextran sulfate sodium-induced colitis by protecting tight junctions in mice. Integr. Med. Res. 2020, 9, 100398. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Chen, H.; Shu, R.; Zhang, X.; Yu, Y.; Liu, X.; Xu, K. Hydrogen treatment prevents lipopolysaccharide-induced pulmonary endothelial cell dysfunction through RhoA inhibition. Biochem. Biophys. Res. Commun. 2020, 522, 499–505. [Google Scholar] [CrossRef] [PubMed]
- Khan, A.A.; Alanazi, A.M.; Alsaif, N.; Al-Anazi, M.; Sayed, A.Y.; Bhat, M.A. Potential cytotoxicity of silver nanoparticles: Stimulation of autophagy and mitochondrial dysfunction in cardiac cells. Saudi J. Biol. Sci. 2021, 28, 2762–2771. [Google Scholar] [CrossRef] [PubMed]
- Sun, K.; Luo, J.; Guo, J.; Yao, X.; Jing, X.; Guo, F. The PI3K/AKT/mTOR signaling pathway in osteoarthritis: A narrative re-view. Osteoarthr. Cartil. 2020, 28, 400–409. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, C.; Xu, C.; Feng, L.; Li, A.; Jin, X.; Guo, S.; Jiao, X.; Liu, J.; Guo, Y.; et al. H2S mediates apoptosis in response to inflammation through PI3K/Akt/NFkappaB signaling pathway. Biotechnol. Lett. 2020, 42, 375–387. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.S.; Huo, C.Y.; Cao, H.H.; Fan, C.L.; Hu, J.Y.; Deng, L.J.; Lu, Z.B.; Yang, H.Y.; Yu, L.Z.; Mo, Z.X.; et al. Aloperine induces apoptosis and G2/M cell cycle arrest in hepatocellular carcinoma cells through the PI3K/Akt signaling pathway. Phytomedicine 2019, 61, 152843. [Google Scholar] [CrossRef] [PubMed]
- Salmena, L.; Poliseno, L.; Tay, Y.; Kats, L.; Pandolfi, P.P. A ceRNA Hypothesis: The Rosetta Stone of a Hidden RNA Language? Cell 2011, 146, 353–358. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Li, X.; Zhou, D.; Zhi, H.; Wang, P.; Gao, Y.; Guo, M.; Yue, M.; Wang, Y.; Shen, W.; et al. Inferences of individual drug responses across diverse cancer types using a novel competing endogenous RNA network. Mol. Oncol. 2018, 12, 1429–1446. [Google Scholar] [CrossRef] [Green Version]
- Zhao, Y.; Ai, Y. Overexpression of lncRNA Gm15621 alleviates apoptosis and inflammation response resulting from sevoflurane treatment through inhibiting miR-133a/Sox4. J. Cell. Physiol. 2020, 235, 957–965. [Google Scholar] [CrossRef]
- Lei, Z.; Guo, H.; Zou, S.; Jiang, J.; Song, J.; Kui, Y. Long noncoding RNA maternally expressed gene regulates cigarette smoke extract induced lung inflammation and human bronchial epithelial apoptosis via miR1493p. Exp. Therap. Med. 2020, 21, 60. [Google Scholar] [CrossRef]
- Wang, A.-H.; Fan, W.-J.; Fu, L.; Wang, X.-T. LncRNA PCAT-1 regulated cell proliferation, invasion, migration and apoptosis in colorectal cancer through targeting miR-149-5p. Eur. Rev. Med. Pharmacol. Sci. 2019, 23, 8310–8320. [Google Scholar]
- Kyriakis, J.M.; Avruch, J. Mammalian MAPK Signal Transduction Pathways Activated by Stress and Inflammation: A 10-Year Update. Physiol. Rev. 2012, 92, 689–737. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hao, Y.; Yuan, H.; Yu, H. RETRACTED ARTICLE: Downregulation of miR-483-5p decreases hypoxia-induced injury in human cardiomyocytes by targeting MAPK3. Cell Mol. Biol. Lett. 2020, 25, 20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pan, W.; Wei, N.; Xu, W.; Wang, G.; Gong, F.; Li, N. MicroRNA-124 alleviates the lung injury in mice with septic shock through inhibiting the activation of the MAPK signaling pathway by downregulating MAPK14. Int. Immunopharmacol. 2019, 76, 105835. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; He, Y.; Jiang, Y.; He, B.; Deng, X.; Zhang, Z.; Yuan, X.; Li, J. MiR-126-3p inhibits apoptosis and promotes proliferation by targeting phosphatidylinositol 3-kinase regulatory subunit 2 in porcine ovarian granulosa cells. Asian-Aust. J. Anim. Sci. 2020, 33, 879–887. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ling, Z.; Chen, M.; Li, T.; Qian, Y.; Li, C. MiR-141-3p downregulation promotes tube formation, migration, invasion and inhibits apoptosis in hypoxia-induced human umbilical vein endothelial cells by targeting Notch2. Reprod. Biol. 2021, 21, 100483. [Google Scholar] [CrossRef]
- Lescoat, A.; Lelong, M.; Jeljeli, M.; Piquet-Pellorce, C.; Morzadec, C.; Ballerie, A.; Jouneau, S.; Jego, P.; Vernhet, L.; Batteux, F.; et al. Combined anti-fibrotic and anti-inflammatory properties of JAK-inhibitors on macrophages in vitro and in vivo: Perspectives for scleroderma-associated interstitial lung disease. Biochem. Pharmacol. 2020, 178, 114103. [Google Scholar] [CrossRef]
- Quero, L.; Tiaden, A.N.; Hanser, E.; Roux, J.; Laski, A.; Hall, J.; Kyburz, D. miR-221-3p Drives the Shift of M2-Macrophages to a Pro-Inflammatory Function by Suppressing JAK3/STAT3 Activation. Front. Immunol. 2020, 10, 3087. [Google Scholar] [CrossRef] [Green Version]
- Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar]
- Krüger, J.; Rehmsmeier, M. RNAhybrid: MicroRNA target prediction easy, fast and flexible. Nucleic Acids Res. 2006, 34 (Suppl. 2), W451–W454. [Google Scholar] [CrossRef] [PubMed]
Gene | Primers Sequence (5′ → 3′) | |
---|---|---|
β-actin | F: TGCTGTCCCTGTATGCCTCT | R: GGTCTTTACGGATGTCAACG |
LOC104971359 | F: GCTGACCGCTCCTCTCTAAT | R: GTTCTGGCTGGTTCCTGTCA |
LOC104971369 | F: ACGTGACAAAGTCTGCCGAT | R: TGGTCGCCTGTCCTGTTATG |
LOC112444199 | F: AAGCAAGGCAGCTCGAGTT | R: CCCCCAGTCCTCATCAAAGT |
LOC112444776 | F: AGCTTCTCCCCTGGTTTTCC | R: GCACCTTGTCACTCTCCTGA |
LOC112446712 | F: AGCAGCTGGATAACATGGCA | R: CTTTGGTTTGGTGCACAGGG |
LOC112443417 | F: CTGCCAGCAACGTGACATTT | R: CTTTGGTTTGGTGCACAGGG |
LOC100140121 | F: TTTGCGATGACAGGGAAGCT | R: GCGAAATGTAACGCGGGAAA |
LOC112442353 | F: TGGCAAGAGTCTGGAATGGG | R: CCTCATGGTCACGATGCTCA |
LOC112444650 | F: AAGACAGTGGATTCGTGGGG | R: TCTGTAAGAATCCCACCGGC |
IL-1β | F: TTCCATATTCCTCTTGGGGTAGA | R: AAATGAACCGAGAAGTGGTGTT |
IL-6 | F: CAGCAGGTCAGTGTTTGTGG | R: CTGGGTTCAATCAGGCGAT |
TNF-α | F: CTTCTCAAGCCTCAAGTAACAAGC | R: CCATGAGGGCATTGGCATAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, C.; Zhu, Y.; Hao, Z.; Xu, H.; Li, T.; Yang, J.; Chen, X.; Chen, Y.; Guo, A.; Hu, C. Genome-Wide Analysis of LncRNA in Bovine Mammary Epithelial Cell Injuries Induced by Escherichia Coli and Staphylococcus Aureus. Int. J. Mol. Sci. 2021, 22, 9719. https://doi.org/10.3390/ijms22189719
Lin C, Zhu Y, Hao Z, Xu H, Li T, Yang J, Chen X, Chen Y, Guo A, Hu C. Genome-Wide Analysis of LncRNA in Bovine Mammary Epithelial Cell Injuries Induced by Escherichia Coli and Staphylococcus Aureus. International Journal of Molecular Sciences. 2021; 22(18):9719. https://doi.org/10.3390/ijms22189719
Chicago/Turabian StyleLin, Changjie, Yifan Zhu, Zhiyu Hao, Haojun Xu, Ting Li, Jinghan Yang, Xi Chen, Yingyu Chen, Aizhen Guo, and Changmin Hu. 2021. "Genome-Wide Analysis of LncRNA in Bovine Mammary Epithelial Cell Injuries Induced by Escherichia Coli and Staphylococcus Aureus" International Journal of Molecular Sciences 22, no. 18: 9719. https://doi.org/10.3390/ijms22189719