Galectin-3 Contributes to the Inhibitory Effect of lα,25-(OH)2D3 on Osteoclastogenesis
Abstract
:1. Introduction
2. Results
2.1. 1α,25-(OH)2D3 Had No Effect on Osteoclast Precursor Viability
2.2. 1α,25-(OH)2D3 Promoted Gal-3 Expression
2.3. Gal-3 Contributed to Osteoclasts Formation and Activation Regulated by 1α,25-(OH)2D3
2.4. Interaction between Gal-3 and VDR
3. Discussion
4. Materials and Methods
4.1. Isolation and Culture of Osteoclast Precursors
4.2. Cell Viability Detection by CCK-8
4.3. Cell Transfection
4.4. Formation and Identification of Osteoclasts
4.5. Western Blotting
4.6. Quantitative Real-Time Polymerase Chain Reaction (qPCR)
4.7. Co-immunoprecipitation
4.8. Immunofluorescent Staining of VDR and Gal-3
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
OCs | Osteoclasts |
RANKL | Receptor activator of NF-kB ligand |
M-CSF | Macrophage colony-stimulating factor |
TRAP | Tartrate-resistant acid phosphate |
MMP-9 | Matrix metalloproteinase-9 |
NFATc1 | Nuclear factor of activated T cells cytoplasmic 1 |
Ctsk | Cathepsin K |
BMMs | Bone marrow-derived monocytes |
OBs | Osteoblasts |
OCPs | Osteoclast precursors |
VDR | Vitamin D receptor |
References
- Boyle, W.J.; Simonet, W.S.; Lacey, D.L. Osteoclast differentiation and activation. Nature 2003, 423, 337–342. [Google Scholar] [CrossRef] [PubMed]
- Weivoda, M.M.; Chew, C.K.; Monroe, D.G.; Farr, J.N.; Atkinson, E.J.; Geske, J.R.; Eckhardt, B.; Thicke, B.; Ruan, M.; Tweed, A.J.; et al. Identification of osteoclast-osteoblast coupling factors in humans reveals links between bone and energy metabolism. Nat. Commun. 2020, 11, 87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boyce, B.F. Advances in osteoclast biology reveal potential new drug targets and new roles for osteoclasts. J. Bone Miner. Res. 2013, 28, 711–722. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Møller, A.M.J.; Delaissé, J.M.; Olesen, J.B.; Madsen, J.S.; Canto, L.M.; Bechmann, T.; Rogatto, S.R.; Søe, K. Aging and menopause reprogram osteoclast precursors for aggressive bone resorption. Bone Res. 2020, 8, 27. [Google Scholar] [CrossRef]
- McHugh, K.P.; Shen, Z.; Crotti, T.N.; Flannery, M.R.; O’Sullivan, R.P.; Purdue, P.E.; Goldring, S.R. The role of cell-substrate interaction in regulating osteoclast activation: Potential implications in targeting bone loss in rheumatoid arthritis. Ann. Rheum. Dis. 2010, 69 (Suppl. 1), i83–i85. [Google Scholar] [CrossRef] [Green Version]
- Ni, J.; Zhang, X.; Li, J.; Zheng, Z.; Zhang, J.; Zhao, W.; Liu, L. Tumour-derived exosomal lncRNA-SOX2OT promotes bone metastasis of non-small cell lung cancer by targeting the miRNA-194-5p/RAC1 signalling axis in osteoclasts. Cell Death Dis. 2021, 12, 662. [Google Scholar] [CrossRef]
- Marahleh, A.; Kitaura, H.; Ohori, F.; Kishikawa, A.; Ogawa, S.; Shen, W.R.; Qi, J.; Noguchi, T.; Nara, Y.; Mizoguchi, I. TNF-α Directly Enhances Osteocyte RANKL Expression and Promotes Osteoclast Formation. Front. Immunol. 2019, 10, 2925. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wei, C.M.; Su, Y.J.; Qin, X.; Ding, J.X.; Liu, Q.; Song, F.M.; Zong, S.H.; Xu, J.; Zhou, B.; Zhao, J.M. Monocrotaline Suppresses RANKL-Induced Osteoclastogenesis In Vitro and Prevents LPS-Induced Bone Loss In Vivo. Cell. Physiol. Biochem. 2018, 48, 644–656. [Google Scholar] [CrossRef] [PubMed]
- Teitelbaum, S.L.; Ross, F.P. Genetic regulation of osteoclast development and function. Nat. Rev. Genet. 2003, 4, 638–649. [Google Scholar] [CrossRef]
- Song, C.; Yang, X.; Lei, Y.; Zhang, Z.; Smith, W.; Yan, J.; Kong, L. Evaluation of efficacy on RANKL induced osteoclast from RAW264.7 cells. J. Cell. Physiol. 2019, 234, 11969–11975. [Google Scholar] [CrossRef]
- Christakos, S.; Dhawan, P.; Porta, A.; Mady, L.J.; Seth, T. Vitamin D and intestinal calcium absorption. Mol. Cell. Endocrinol. 2011, 347, 25–29. [Google Scholar] [CrossRef] [Green Version]
- Gu, J.; Tong, X.S.; Chen, G.H.; Wang, D.; Chen, Y.; Yuan, Y.; Liu, X.Z.; Bian, J.C.; Liu, Z.P. Effects of 1alpha,25-(OH)2D3 on the formation and activity of osteoclasts in RAW264.7 cells. J. Steroid Biochem. 2015, 152, 25–33. [Google Scholar] [CrossRef]
- Pike, J.W.; Christakos, S. Biology and Mechanisms of Action of the Vitamin D Hormone. Endocrinol. Metab. Clin. N. Am. 2017, 46, 815–843. [Google Scholar] [CrossRef]
- Mori, T.; Horibe, K.; Koide, M.; Uehara, S.; Yamamoto, Y.; Kato, S.; Yasuda, H.; Takahashi, N.; Udagawa, N.; Nakamichi, Y. The Vitamin D Receptor in Osteoblast-Lineage Cells Is Essential for the Proresorptive Activity of 1α,25(OH)2D3 In Vivo. Endocrinology 2020, 161. [Google Scholar] [CrossRef]
- Pereira, R.C.; Salusky, I.B.; Bowen, R.E.; Freymiller, E.G.; Wesseling-Perry, K. Vitamin D sterols increase FGF23 expression by stimulating osteoblast and osteocyte maturation in CKD bone. Bone 2019, 127, 626–634. [Google Scholar] [CrossRef]
- Takahashi, N.; Udagawa, N.; Suda, T. Vitamin D endocrine system and osteoclasts. Bonekey Rep. 2014, 3, 495. [Google Scholar] [CrossRef] [Green Version]
- Gu, J.; Tong, X.; Chen, Y.; Zhang, C.; Ma, T.; Li, S.; Min, W.; Yuan, Y.; Liu, X.; Bian, J.; et al. Vitamin D Inhibition of TRPV5 Expression During Osteoclast Differentiation. Int. J. Endocrinol. Metab. 2019, 17, e91583. [Google Scholar] [CrossRef]
- Teramachi, J.; Hiruma, Y.; Ishizuka, S.; Ishizuka, H.; Brown, J.P.; Michou, L.; Cao, H.; Galson, D.L.; Subler, M.A.; Zhou, H.; et al. Role of ATF7-TAF12 interactions in the vitamin D response hypersensitivity of osteoclast precursors in Paget’s disease. J. Bone Miner. Res. 2013, 28, 1489–1500. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kogawa, M.; Findlay, D.M.; Anderson, P.H.; Atkins, G.J. Modulation of osteoclastic migration by metabolism of 25OH-vitamin D3. J. Steroid Biochem. Mol. Biol. 2013, 136, 59–61. [Google Scholar] [CrossRef]
- Colnot, C.; Sidhu, S.S.; Poirier, F.; Balmain, N. Cellular and subcellular distribution of galectin-3 in the epiphyseal cartilage and bone of fetal and neonatal mice. Cell. Mol. Biol. 1999, 45, 1191–1202. [Google Scholar]
- Aubin, J.E.; Liu, F.; Malaval, L.; Gupta, A.K. Osteoblast and chondroblast differentiation. Bone 1995, 17, 77S–83S. [Google Scholar] [CrossRef]
- Nakajima, K.; Kho, D.H.; Yanagawa, T.; Harazono, Y.; Hogan, V.; Chen, W.; Ali-Fehmi, R.; Mehra, R.; Raz, A. Galectin-3 Cleavage Alters Bone Remodeling: Different Outcomes in Breast and Prostate Cancer Skeletal Metastasis. Cancer Res. 2016, 76, 1391–1402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gu, J.; Kong, Q.; Wang, D.; Tong, X.; Bian, J.; Liu, X.; Yuan, Y.; Liu, Z. Deferential protein expressions and bioinformatic analysis of OC fromation regulated by vitamin F. Chin. J. Vet. Sci. 2019, 39, 2207–2214. (In Chinese) [Google Scholar] [CrossRef]
- Simon, D.; Derer, A.; Andes, F.T.; Lezuo, P.; Bozec, A.; Schett, G.; Herrmann, M.; Harre, U. Galectin-3 as a novel regulator of osteoblast-osteoclast interaction and bone homeostasis. Bone 2017, 105, 35–41. [Google Scholar] [CrossRef] [PubMed]
- Gu, J.; Zhang, C.; Min, W.; ZHao, Y.; Li, S.; Liu, Z. Effects of 1α,25-(OH)2D3 on osteoclastogenesis and activity in mice. Chin. J. Vet. Sci. 2019, 49, 593–600. (In Chinese) [Google Scholar] [CrossRef]
- Lacey, D.L.; Timms, E.; Tan, H.L.; Kelley, M.J.; Dunstan, C.R.; Burgess, T.; Elliott, R.; Colombero, A.; Elliott, G.; Scully, S.; et al. Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell 1998, 93, 165–176. [Google Scholar] [CrossRef] [Green Version]
- Spessotto, P.; Rossi, F.M.; Degan, M.; Di Francia, R.; Perris, R.; Colombatti, A.; Gattei, V. Hyaluronan-CD44 interaction hampers migration of osteoclast-like cells by down-regulating MMP-9. J. Cell Biol. 2002, 158, 1133–1144. [Google Scholar] [CrossRef] [PubMed]
- Nakagawa, S.; Omori, K.; Nakayama, M.; Mandai, H.; Yamamoto, S.; Kobayashi, H.; Sako, H.; Sakaida, K.; Yoshimura, H.; Ishii, S.; et al. The fungal metabolite (+)-terrein abrogates osteoclast differentiation via suppression of the RANKL signaling pathway through NFATc1. Int. Immunopharmacol. 2020, 83, 106429. [Google Scholar] [CrossRef] [PubMed]
- Takayanagi, H.; Kim, S.; Koga, T.; Nishina, H.; Isshiki, M.; Yoshida, H.; Saiura, A.; Isobe, M.; Yokochi, T.; Inoue, J.; et al. Induction and activation of the transcription factor NFATc1 (NFAT2) integrate RANKL signaling in terminal differentiation of osteoclasts. Dev. Cell 2002, 3, 889–901. [Google Scholar] [CrossRef] [Green Version]
- Kogawa, M.; Hisatake, K.; Atkins, G.J.; Findlay, D.M.; Enoki, Y.; Sato, T.; Gray, P.C.; Kanesaki-Yatsuka, Y.; Anderson, P.H.; Wada, S.; et al. The paired-box homeodomain transcription factor Pax6 binds to the upstream region of the TRAP gene promoter and suppresses receptor activator of NF-κB ligand (RANKL)-induced osteoclast differentiation. J. Biol. Chem. 2013, 288, 31299–31312. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duplat, D.; Gallet, M.; Berland, S.; Marie, A.; Dubost, L.; Rousseau, M.; Kamel, S.; Milet, C.; Brazier, M.; Lopez, E.; et al. The effect of molecules in mother-of-pearl on the decrease in bone resorption through the inhibition of osteoclast cathepsin K. Biomaterials 2007, 28, 4769–4778. [Google Scholar] [CrossRef]
- Veldurthy, V.; Wei, R.; Oz, L.; Dhawan, P.; Jeon, Y.H.; Christakos, S. Vitamin D, calcium homeostasis and aging. Bone Res. 2016, 4, 16041. [Google Scholar] [CrossRef] [Green Version]
- Kitazawa, R.; Mori, K.; Yamaguchi, A.; Kondo, T.; Kitazawa, S. Modulation of mouse RANKL gene expression by Runx2 and vitamin D3. J. Cell. Biochem. 2008, 105, 1289–1297. [Google Scholar] [CrossRef]
- Wang, D.; Gu, J.H.; Chen, Y.; Zhao, H.Y.; Liu, W.; Song, R.L.; Bian, J.C.; Liu, X.Z.; Yuan, Y.; Liu, Z.P. 1α,25-Dihydroxyvitamin D3 inhibits the differentiation and bone resorption by osteoclasts generated from Wistar rat bone marrow-derived macrophages. Exp. Ther. Med. 2015, 10, 1039–1044. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sakai, S.; Takaishi, H.; Matsuzaki, K.; Kaneko, H.; Furukawa, M.; Miyauchi, Y.; Shiraishi, A.; Saito, K.; Tanaka, A.; Taniguchi, T.; et al. 1-Alpha, 25-dihydroxy vitamin D3 inhibits osteoclastogenesis through IFN-beta-dependent NFATc1 suppression. J. Bone Miner. Metab. 2009, 27, 643–652. [Google Scholar] [CrossRef] [PubMed]
- Kikuta, J.; Kawamura, S.; Okiji, F.; Shirazaki, M.; Sakai, S.; Saito, H.; Ishii, M. Sphingosine-1-phosphate-mediated osteoclast precursor monocyte migration is a critical point of control in antibone-resorptive action of active vitamin D. Proc. Natl. Acad. Sci. USA 2013, 110, 7009–7013. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gong, H.C.; Honjo, Y.; Nangia-Makker, P.; Hogan, V.; Mazurak, N.; Bresalier, R.S.; Raz, A. The NH2 terminus of galectin-3 governs cellular compartmentalization and functions in cancer cells. Cancer Res. 1999, 59, 6239–6245. [Google Scholar]
- Velickovic, M.; Arsenijevic, A.; Acovic, A.; Arsenijevic, D.; Milovanovic, J.; Dimitrijevic, J.; Todorovic, Z.; Milovanovic, M.; Kanjevac, T.; Arsenijevic, N. Galectin-3, Possible Role in Pathogenesis of Periodontal Diseases and Potential Therapeutic Target. Front. Pharmacol. 2021, 12, 638258. [Google Scholar] [CrossRef]
- Tang, H.; Zhang, P.; Zeng, L.; Zhao, Y.; Xie, L.; Chen, B. Mesenchymal stem cells ameliorate renal fibrosis by galectin-3/Akt/GSK3β/Snail signaling pathway in adenine-induced nephropathy rat. Stem. Cell Res. Ther. 2021, 12, 409. [Google Scholar] [CrossRef]
- Fu, G.; Polyakova, O.; Chazen, R.S.; Freeman, J.L.; Witterick, I.J. Diagnostic Value of Galectin-3 in Distinguishing Invasive Encapsulated Carcinoma from Noninvasive Follicular Thyroid Neoplasms with Papillary-Like Nuclear Features (NIFTP). Cancers 2021, 13, 2988. [Google Scholar] [CrossRef]
- Jia, W.; Kong, L.; Kidoya, H.; Naito, H.; Muramatsu, F.; Hayashi, Y.; Hsieh, H.Y.; Yamakawa, D.; Hsu, D.K.; Liu, F.T.; et al. Indispensable role of Galectin-3 in promoting quiescence of hematopoietic stem cells. Nat. Commun. 2021, 12, 2118. [Google Scholar] [CrossRef]
- Iacobini, C.; Blasetti Fantauzzi, C.; Bedini, R.; Pecci, R.; Bartolazzi, A.; Amadio, B.; Pesce, C.; Pugliese, G.; Menini, S. Galectin-3 is essential for proper bone cell differentiation and activity, bone remodeling and biomechanical competence in mice. Metabolism 2018, 83, 149–158. [Google Scholar] [CrossRef] [PubMed]
- Lepur, A.; Carlsson, M.C.; Novak, R.; Dumic, J.; Nilsson, U.J.; Leffler, H. Galectin-3 endocytosis by carbohydrate independent and dependent pathways in different macrophage like cell types. Biochim. Biophys. Acta 2012, 1820, 804–818. [Google Scholar] [CrossRef]
- Liu, W.; Le, C.C.; Wang, D.; Ran, D.; Wang, Y.; Zhao, H.; Gu, J.; Zou, H.; Yuan, Y.; Bian, J.; et al. Ca(2+)/CaM/CaMK signaling is involved in cadmium-induced osteoclast differentiation. Toxicology 2020, 441, 152520. [Google Scholar] [CrossRef] [PubMed]
- Tong, X.; Zhang, C.; Wang, D.; Song, R.; Ma, Y.; Cao, Y.; Zhao, H.; Bian, J.; Gu, J.; Liu, Z. Suppression of AMP-activated protein kinase reverses osteoprotegerin-induced inhibition of osteoclast differentiation by reducing autophagy. Cell Prolif. 2020, 53, e12714. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tong, X.; Gu, J.; Chen, M.; Wang, T.; Zou, H.; Song, R.; Zhao, H.; Bian, J.; Liu, Z. p53 positively regulates osteoprotegerin-mediated inhibition of osteoclastogenesis by downregulating TSC2-induced autophagy in vitro. Differentiation 2020, 114, 58–66. [Google Scholar] [CrossRef]
- Hasbi, A.; Perreault, M.L.; Shen, M.Y.F.; Fan, T.; Nguyen, T.; Alijaniaram, M.; Banasikowski, T.J.; Grace, A.A.; O’Dowd, B.F.; Fletcher, P.J.; et al. Activation of Dopamine D1-D2 Receptor Complex Attenuates Cocaine Reward and Reinstatement of Cocaine-Seeking through Inhibition of DARPP-32, ERK, and ΔFosB. Front. Pharmacol. 2017, 8, 924. [Google Scholar] [CrossRef]
Genes | Sequences | |
---|---|---|
Lgals3 | Forward (5′-3′) | GTACAGCTAGCGGAGCGG |
Reverse(5′-3′) | CGGATATCCTTGAGGGTTTG | |
Ctsk | Forward (5′-3′) | CGCCTGCGGCATTACCAA |
Reverse(5′-3′) | TAGCATCGCTGCGTCCCT | |
Mmp-9 | Forward (5′-3′) | GCCCTGGAACTCACACGACA |
Reverse(5′-3′) | TTGGAAACTCACACGCCAGAAG | |
Gapdh | Forward (5′-3′) | AAATGGTGAAGGTCGGTGTG |
Reverse(5′-3′) | TGAAGGGGTCGTTGATGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gu, J.; Zhang, X.; Zhang, C.; Li, Y.; Bian, J.; Liu, X.; Yuan, Y.; Zou, H.; Tong, X.; Liu, Z. Galectin-3 Contributes to the Inhibitory Effect of lα,25-(OH)2D3 on Osteoclastogenesis. Int. J. Mol. Sci. 2021, 22, 13334. https://doi.org/10.3390/ijms222413334
Gu J, Zhang X, Zhang C, Li Y, Bian J, Liu X, Yuan Y, Zou H, Tong X, Liu Z. Galectin-3 Contributes to the Inhibitory Effect of lα,25-(OH)2D3 on Osteoclastogenesis. International Journal of Molecular Sciences. 2021; 22(24):13334. https://doi.org/10.3390/ijms222413334
Chicago/Turabian StyleGu, Jianhong, Xueqing Zhang, Chuang Zhang, Yawen Li, Jianchun Bian, Xuezhong Liu, Yan Yuan, Hui Zou, Xishuai Tong, and Zongping Liu. 2021. "Galectin-3 Contributes to the Inhibitory Effect of lα,25-(OH)2D3 on Osteoclastogenesis" International Journal of Molecular Sciences 22, no. 24: 13334. https://doi.org/10.3390/ijms222413334