Serial Passaging of Seasonal H3N2 Influenza A/Singapore/G2-31.1/2014 Virus in MDCK-SIAT1 Cells and Primary Chick Embryo Cells Generates HA D457G Mutation and Other Variants in HA, NA, PB1, PB1-F2, and NS1
Abstract
:1. Introduction
2. Results
2.1. Differential Infectivity of A/Singapore/G2-31.1/2014 in MDCK-SIAT1 and CEF Cells
2.2. Specific Mutations of A/Singapore/G2-31.1/2014 Arise during Serial Passaging in MDCK-SIAT1 Cells
2.3. HA D457G Substitution Is Associated with Enhanced Viral Infectivity
2.4. Viral RNA Quasispecies Are Numerous in Serially Passaged H3N2 Influenza Virus
2.5. Homology Models of HA and PB1 Mutant Proteins Predict Their Structural Alterations
2.6. D457G Substitution in HA Does Not Alter the Susceptibility of A/Singapore/G2-31.1/2014 to Human Neutralizing Antibodies
3. Discussion
4. Materials and Methods
4.1. Establishment of CEF Cultures
4.2. Cells and Virus
4.3. Serial Passaging of A/Singapore/G2-31.1/2014(H3N2) Virus
4.4. Live Virus Quantification by Plaque Assays
4.5. RNA Extraction and Screening by HA1 RT-PCR Amplification
4.6. Real-Time Quantitative PCR to Determine Viral Load
4.7. Classical PCR and Sanger Sequencing
4.8. Viral Gene Sequence Construction and Quasispecies Analysis
4.9. Microneutralization Assays
4.10. Homology Modelling of Mutant HA and PB1 Proteins
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Allen, J.D.; Ross, T.M. H3N2 influenza viruses in humans: Viral mechanisms, evolution, and evaluation. Hum. Vaccin. Immunother. 2018, 14, 1840–1847. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jester, B.J.; Uyeki, T.M.; Jernigan, D.B. Fifty years of influenza A(H3N2) following the pandemic of 1968. Am. J. Public Health 2020, 110, 669–676. [Google Scholar] [CrossRef] [PubMed]
- Belongia, E.A.; McLean, H.Q. Influenza vaccine effectiveness: Defining the H3N2 problem. Clin. Infect. Dis. 2019, 69, 1817–1823. [Google Scholar] [CrossRef] [PubMed]
- Henry, C.; Palm, A.E.; Krammer, F.; Wilson, P.C. From original antigenic sin to the universal influenza virus vaccine. Trends Immunol. 2018, 39, 70–79. [Google Scholar] [CrossRef]
- Zhang, A.; Stacey, H.D.; Mullarkey, C.E.; Miller, M.S. Original antigenic sin: How first exposure shapes lifelong anti-influenza virus immune responses. J. Immunol. 2019, 202, 335–340. [Google Scholar] [CrossRef] [Green Version]
- Bull, M.B.; Cohen, C.A.; Leung, N.H.L.; Valkenburg, S.A. Universally immune: How infection permissive next generation vaccines may affect population immunity and viral spread. Viruses 2021, 13, 1779. [Google Scholar] [CrossRef]
- Arevalo, C.P.; Le Sage, V.; Bolton, M.J.; Eilola, T.; Jones, J.E.; Kormuth, K.A.; Nturibi, E.; Balmaseda, A.; Gordon, A.; Lakdawala, S.S.; et al. Original antigenic sin priming of influenza virus hemagglutinin stalk antibodies. Proc. Natl. Acad. Sci. USA 2020, 117, 17221–17227. [Google Scholar] [CrossRef]
- Liu, F.; Gross, F.L.; Jefferson, S.N.; Holiday, C.; Bai, Y.; Wang, L.; Zhou, B.; Levine, M.Z. Age-specific effects of vaccine egg adaptation and immune priming on A(H3N2) antibody responses following influenza vaccination. J. Clin. Investig. 2021, 131, e146138. [Google Scholar] [CrossRef]
- Rajaram, S.; Wojcik, R.; Moore, C.; de Lejarazu, R.O.; de Lusignan, S.; Montomoli, E.; Rossi, A.; Pérez-Rubio, A.; Trilla, A.; Baldo, V.; et al. The impact of candidate influenza virus and egg-based manufacture on vaccine effectiveness: Literature review and expert consensus. Vaccine 2020, 38, 6047–6056. [Google Scholar] [CrossRef]
- Ito, T.; Suzuki, Y.; Takada, A.; Kawamoto, A.; Otsuki, K.; Masuda, H.; Yamada, M.; Suzuki, T.; Kida, H.; Kawaoka, Y. Differences in sialic acid-galactose linkages in the chicken egg amnion and allantois influence human influenza virus receptor specificity and variant selection. J. Virol. 1997, 71, 3357–3362. [Google Scholar] [CrossRef]
- De Graaf, M.; Fouchier, R.A.M. Role of receptor binding specificity in influenza A virus transmission and pathogenesis. EMBO J. 2014, 33, 823–841. [Google Scholar] [CrossRef] [Green Version]
- Zost, S.J.; Parkhouse, K.; Gumina, M.E.; Kim, K.; Perez, S.D.; Wilson, P.C.; Treanor, J.J.; Sant, A.J.; Cobey, S.; Hensley, S.E. Contemporary H3N2 influenza viruses have a glycosylation site that alters binding of antibodies elicited by egg-adapted vaccine strains. Proc. Natl. Acad. Sci. USA 2017, 114, 12578–12583. [Google Scholar] [CrossRef] [Green Version]
- Ping, J.; Lopes, T.J.S.; Nidom, C.A.; Ghedin, E.; Macken, C.A.; Fitch, A.; Imai, M.; Maher, E.A.; Neumann, G.; Kawaoka, Y. Development of high-yield influenza A virus vaccine viruses. Nat. Commun. 2015, 6, 8148. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.R.; Liu, Y.M.; Tseng, Y.C.; Ma, C. Better influenza vaccines: An industry perspective. J. Biomed. Sci. 2020, 27, 33. [Google Scholar] [CrossRef]
- Chambers, B.S.; Li, Y.; Hodinka, R.L.; Hensley, S.E. Recent H3N2 influenza virus clinical isolates rapidly acquire hemagglutinin or neuraminidase mutations when propagated for antigenic analyses. J. Virol. 2014, 88, 10986–10989. [Google Scholar] [CrossRef] [Green Version]
- Wu, N.C.; Lv, H.; Thompson, A.J.; Wu, D.C.; Ng, W.W.S.; Kadam, R.U.; Lin, C.W.; Nycholat, C.M.; McBride, R.; Liang, W.; et al. Preventing an antigenically disruptive mutation in egg-based H3N2 seasonal influenza vaccines by mutational incompatibility. Cell Host Microbe 2019, 25, 836–844. [Google Scholar] [CrossRef] [Green Version]
- Choi, E.J.; Lee, Y.J.; Lee, J.M.; Kim, Y.J.; Choi, J.H.; Ahn, B.; Kim, K.; Han, M.G. The effect of mutations derived from mouse-adapted H3N2 seasonal influenza A virus to pathogenicity and host adaptation. PLoS ONE 2020, 15, e0227516. [Google Scholar] [CrossRef]
- Narasaraju, T.; Sim, M.K.; Ng, H.H.; Phoon, M.C.; Shanker, N.; Lal, S.K.; Chow, V.T. Adaptation of human influenza H3N2 virus in a mouse pneumonitis model: Insights into viral virulence, tissue tropism and host pathogenesis. Microbes Infect. 2009, 11, 2–11. [Google Scholar] [CrossRef]
- Baz, M.; M’hamdi, Z.; Carbonneau, J.; Lavigne, S.; Couture, C.; Abed, Y.; Boivin, G. Synergystic PA and HA mutations confer mouse adaptation of a contemporary A/H3N2 influenza virus. Sci. Rep. 2019, 9, 16616. [Google Scholar] [CrossRef] [Green Version]
- Powell, H.; Pekosz, A. Neuraminidase antigenic drift of H3N2 clade 3c.2a viruses alters virus replication, enzymatic activity and inhibitory antibody binding. PLoS Pathog. 2020, 16, e1008411. [Google Scholar] [CrossRef]
- Chen, H.; Deng, Q.; Ng, S.H.; Lee, R.T.C.; Maurer-Stroh, S.; Zhai, W. Dynamic convergent evolution drives passage adaptation across 48 years’ history of H3N2 influenza evolution. Mol. Biol. Evol. 2016, 33, 3133–3143. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.; Alvarez, J.J.S.; Ng, S.H.; Nielsen, R.; Zhai, W. Passage adaptation correlates with the reduced efficacy of the influenza vaccine. Clin. Infect. Dis. 2019, 69, 1198–1204. [Google Scholar] [CrossRef]
- Chen, H.; Wang, J.; Liu, Y.; Quek, I.; Shih, C.C.; Wu, D.; Fu, Z.; Lee, R.T.C.; Xu, M.; Chow, V.T.; et al. MADE: A computational tool for predicting vaccine effectiveness for the influenza A(H3N2) virus adapted to embryonated eggs. Vaccines 2022, 10, 907. [Google Scholar] [CrossRef]
- Hamamoto, I.; Takaku, H.; Tashiro, M.; Yamamoto, N. High yield production of influenza virus in Madin Darby canine kidney (MDCK) cells with stable knockdown of IRF7. PLoS ONE 2013, 8, e59892. [Google Scholar] [CrossRef]
- Kim, E.H.; Kwon, H.I.; Park, S.J.; Kim, Y.I.; Si, Y.J.; Lee, I.W.; Kim, S.M.; Kim, S.I.; Ahn, D.H.; Choi, Y.K. Generation of a high-growth influenza vaccine strain in MDCK cells for vaccine preparedness. J. Microbiol. Biotechnol. 2018, 28, 997–1006. [Google Scholar] [CrossRef] [Green Version]
- Park, Y.W.; Kim, Y.H.; Jung, H.U.; Jeong, O.S.; Hong, E.J.; Kim, H.; Lee, J.I. Comparison of antigenic mutation during egg and cell passage cultivation of H3N2 influenza virus. Clin. Exp. Vaccine Res. 2020, 9, 56–63. [Google Scholar] [CrossRef]
- Matsumoto, S.; Chong, Y.; Kang, D.; Ikematsu, H. High genetic stability in MDCK-SIAT1 passaged human influenza viruses. J. Infect. Chemother. 2019, 25, 222–224. [Google Scholar] [CrossRef]
- Peck, H.; Laurie, K.L.; Rockman, S.; Leung, V.; Lau, H.; Soppe, S.; Rynehart, C.; Baas, C.; Trusheim, H.; Barr, I.G. Enhanced isolation of influenza viruses in qualified cells improves the probability of well-matched vaccines. NPJ Vaccines 2021, 6, 149. [Google Scholar] [CrossRef]
- Oh, D.Y.; Barr, I.G.; Mosse, J.A.; Laurie, K.L. MDCK-SIAT1 cells show improved isolation rates for recent human influenza viruses compared to conventional MDCK cells. J. Clin. Microbiol. 2008, 46, 2189–2194. [Google Scholar] [CrossRef] [Green Version]
- Abdoli, A.; Soleimanjahi, H.; Jamali, A.; Mehrbod, P.; Gholami, S.; Kianmehr, Z.; Feizi, N.; Saleh, M.; Bahrami, F.; Mokhtari-Azad, T.; et al. Comparison between MDCK and MDCK-SIAT1 cell lines as preferred host for cell culture-based influenza vaccine production. Biotechnol. Lett. 2016, 38, 941–948. [Google Scholar] [CrossRef]
- Shahsavandi, S.; Ebrahimi, M.M.; Mohammadi, A.; Lebas, N.Z. Impact of chicken-origin cells on adaptation of a low pathogenic influenza virus. Cytotechnology 2013, 65, 419–424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, Y.; Ming, F.; Huang, H.; Guo, K.; Chen, H.; Jin, M.; Zhou, H. Proteome response of chicken embryo fibroblast cells to recombinant H5N1 avian influenza viruses with different neuraminidase stalk lengths. Sci. Rep. 2017, 7, 40698. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ivan, F.X.; Zhou, X.; Lau, S.H.; Rashid, S.; Teo, J.S.M.; Lee, H.K.; Koay, E.S.; Chan, K.P.; Leo, Y.S.; Chen, M.I.C.; et al. Molecular insights into evolution, mutations and receptor-binding specificity of influenza A and B viruses from outpatients and hospitalized patients in Singapore. Int. J. Infect. Dis. 2020, 90, 84–96. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, N.C.; Zost, S.J.; Thompson, A.J.; Oyen, D.; Nycholat, C.M.; McBride, R.; Paulson, J.C.; Hensley, S.E.; Wilson, I.A. A structural explanation for the low effectiveness of the seasonal influenza H3N2 vaccine. PLoS Pathog. 2017, 13, e1006682. [Google Scholar] [CrossRef] [Green Version]
- Fan, H.; Walker, A.P.; Carrique, L.; Keown, J.R.; Serna Martin, I.; Karia, D.; Sharps, J.; Hengrung, N.; Pardon, E.; Steyaert, J.; et al. Structures of influenza A virus RNA polymerase offer insight into viral genome replication. Nature 2019, 573, 287–290. [Google Scholar] [CrossRef]
- Tsang, T.K.; Cauchemez, S.; Perera, R.A.; Freeman, G.; Fang, V.J.; Ip, D.K.; Leung, G.M.; Malik Peiris, J.S.; Cowling, B.J. Association between antibody titers and protection against influenza virus infection within households. J. Infect. Dis. 2014, 210, 684–692. [Google Scholar] [CrossRef] [Green Version]
- Smith, K.A.; Colvin, C.J.; Weber, P.S.D.; Spatz, S.J.; Coussens, P.M. High titer growth of human and avian influenza viruses in an immortalized chick embryo cell line without the need for exogenous proteases. Vaccine 2008, 26, 3778–3782. [Google Scholar] [CrossRef]
- Coussens, P.M.; Smith, K.A.; Weber, P.S.D.; Colvin, C.J. Immortalized chick embryo cell line adapted to serum-free growth conditions and capable of replicating human and reassortant H5N1 influenza strains for vaccine production. Vaccine 2011, 29, 8661–8668. [Google Scholar] [CrossRef]
- Muvunyi, C.M.; Wilde, M.; Dennington, D.; Yates, C. Efficient replication but low titer growth of influenza virus in immortalised chick embryo fibroblasts cell line. Rwanda Med. J. 2016, 73, 5–12. [Google Scholar]
- Donis, R.O.; Chen, I.M.; Davis, C.T.; Foust, A.; Hossain, M.J.; Johnson, A.; Klimov, A.; Loughlin, R.; Xu, X.; Tsai, T.; et al. Performance characteristics of qualified cell lines for isolation and propagation of influenza viruses for vaccine manufacturing. Vaccine 2014, 32, 6583–6590. [Google Scholar] [CrossRef]
- Zhou, J.; Yang, F.; Yang, J.; Ma, L.; Cun, Y.; Song, S.; Liao, G. Reassortment of high-yield influenza viruses in vero cells and safety assessment as candidate vaccine strains. Hum. Vaccin. Immunother. 2017, 13, 111–116. [Google Scholar] [CrossRef]
- Evseev, D.; Magor, K.E. Molecular evolution of the influenza A virus non-structural protein 1 in interspecies transmission and adaptation. Front. Microbiol. 2021, 12, 693204. [Google Scholar] [CrossRef]
- Lee, R.T.C.; Chang, H.H.; Russell, C.A.; Lipstitch, M.; Maurer-Stroh, S. Influenza A hemagglutinin passage bias sites and host specificity mutations. Cells 2019, 8, 958. [Google Scholar] [CrossRef] [Green Version]
- Schuy, W.; Will, C.; Kuroda, K.; Scholtissek, C.; Garten, W.; Klenk, H.D. Mutations blocking the transport of the influenza virus hemagglutinin between the rough endoplasmic reticulum and the Golgi apparatus. EMBO J. 1986, 5, 2831–2836. [Google Scholar] [CrossRef]
- Byrd-Leotis, L.; Galloway, S.E.; Agbogu, E.; Steinhauer, D.A. Influenza hemagglutinin (HA) stem region mutations that stabilise or destabilise the structure of multiple HA subtypes. J. Virol. 2015, 89, 4504–4516. [Google Scholar] [CrossRef] [Green Version]
- Suntronwong, N.; Klinfueng, S.; Vichiwattana, P.; Korkong, S.; Thongmee, T.; Vongpunsawad, S.; Poovorawan, Y. Genetic and antigenic divergence in the influenza A(H3N2) virus circulating between 2016 and 2017 in Thailand. PLoS ONE 2017, 12, e0189511. [Google Scholar] [CrossRef]
- Jagadesh, A.; Krishnan, A.; Nair, S.; Sivadas, S.; Arunkumar, G. Genetic characterization of hemagglutinin (HA) gene of influenza A viruses circulating in Southwest India during 2017 season. Virus Genes 2019, 55, 458–464. [Google Scholar] [CrossRef]
- Wu, K.W.; Chien, C.Y.; Li, S.W.; King, C.C.; Chang, C.H. Highly conserved influenza A virus epitope sequences as candidates of H3N2 flu vaccine targets. Genomics 2012, 100, 102–109. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.S.; Chowdhury, M.Y.E.; Moon, H.J.; Choi, Y.K.; Talactac, M.R.; Kim, J.H.; Park, M.E.; Son, H.Y.; Shin, K.S.; Kim, C.J. The highly conserved HA2 protein of the influenza A virus induces a cross protective immune response. J. Virol. Methods 2013, 194, 280–288. [Google Scholar] [CrossRef]
- Fan, X.; Hashem, A.M.; Chen, Z.; Li, C.; Doyle, T.; Zhang, Y.; Yi, Y.; Farnsworth, A.; Xu, K.; Li, Z.; et al. Targeting the HA2 subunit of influenza A virus hemagglutinin via CD40L provides universal protection against diverse subtypes. Mucosal Immunol. 2014, 8, 211–220. [Google Scholar] [CrossRef] [Green Version]
- Varga, Z.T.; Grant, A.; Manicassamy, B.; Palese, P. Influenza virus protein PB1-F2 inhibits the induction of type I interferon by binding to MAVS and decreasing mitochondrial membrane potential. J. Virol. 2012, 86, 8359–8366. [Google Scholar] [CrossRef]
- Mazur, I.; Anhlan, D.; Mitzner, D.; Wixler, L.; Schubert, U.; Ludwig, S. The proapoptotic influenza A virus protein PB1-F2 regulates viral polymerase activity by interaction with the PB1 protein. Cell. Microbiol. 2008, 10, 1140–1152. [Google Scholar] [CrossRef]
- Cheng, Y.Y.; Yang, S.R.; Wang, Y.T.; Lin, Y.H.; Chen, C.J. Amino acid residues 68–71 contribute to influenza A virus PB1-F2 protein stability and functions. Front. Microbiol. 2017, 8, 692. [Google Scholar] [CrossRef] [Green Version]
- Alymova, I.V.; Samarasinghe, A.; Vogel, P.; Green, A.M.; Weinlich, R.; McCullers, J.A. A novel cytotoxic sequence contributes to influenza A viral protein PB1-F2 pathogenicity and predisposition to secondary bacterial infection. J. Virol. 2014, 88, 503–515. [Google Scholar] [CrossRef] [Green Version]
- Varga, Z.T.; Ramos, I.; Hai, R.; Schmolke, M.; García-Sastre, A.; Fernandez-Sesma, A.; Palese, P. The influenza virus protein PB1-F2 inhibits the induction of type I interferon at the level of the MAVS adaptor protein. PLoS Pathog. 2011, 7, e1002067. [Google Scholar] [CrossRef]
- Zeng, Y.; Xu, S.; Wei, Y.; Zhang, X.; Wang, Q.; Jia, Y.; Wang, W.; Han, L.; Chen, Z.; Wang, Z.; et al. The PB1 protein of influenza A virus inhibits the innate immune response by targeting MAVS for NBR1-mediated selective autophagic degradation. PLoS Pathog. 2021, 17, e1009300. [Google Scholar] [CrossRef] [PubMed]
- Lyons, D.M.; Lauring, A.S. Mutation and epistasis in influenza virus evolution. Viruses 2018, 10, 407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koel, B.F.; Burke, D.F.; van der Vliet, S.; Bestebroer, T.M.; Rimmelzwaan, G.F.; Osterhaus, A.D.M.E.; Smith, D.J.; Fouchier, R.A.M. Epistatic interactions can moderate the antigenic effect of substitutions in haemagglutinin of influenza H3N2 virus. J. Gen. Virol. 2019, 100, 773–777. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hsu, J.P.; Phoon, M.C.; Koh, G.C.; Chen, M.I.; Lee, V.J.; Wu, Y.; Xie, M.L.; Cheong, A.; Leo, Y.S.; Chow, V.T. Comparison of neutralizing antibody and cell-mediated immune responses to pandemic H1N1 2009 influenza virus before and after H1N1 2009 influenza vaccination of elderly subjects and healthcare workers. Int. J. Infect. Dis. 2012, 16, e621–e627. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.M.; Huddleston, J.; Doud, M.B.; Hooper, K.A.; Wu, N.C.; Bedford, T.; Bloom, J.D. Deep mutational scanning of hemagglutinin helps predict evolutionary fates of human H3N2 influenza variants. Proc. Natl. Acad. Sci. USA 2018, 115, E8276–E8285. [Google Scholar] [CrossRef] [Green Version]
- Hernandez, R.; Brown, D.T. Growth and maintenance of chick embryo fibroblasts (CEF). Curr. Protoc. Microbiol. 2010, 4, A-4I. [Google Scholar] [CrossRef]
- Takahashi, T.; Song, J.; Suzuki, T.; Kawaoka, Y. Mutations in NA that induced low pH-stability and enhanced the replication of pandemic (H1N1) 2009 influenza A virus at an early stage of the pandemic. PLoS ONE 2013, 8, e64439. [Google Scholar] [CrossRef]
- Deng, Y.M.; Spirason, N.; Iannello, P.; Jelley, L.; Lau, H.; Barr, I.G. A simplified Sanger sequencing method for full genome sequencing of multiple subtypes of human influenza A viruses. J. Clin. Virol. 2015, 68, 43–48. [Google Scholar] [CrossRef] [Green Version]
- Lwin, M.O.; Lu, J.; Sheldenkar, A.; Panchapakesan, C.; Tan, Y.R.; Yap, P.; Chen, M.I.; Chow, V.T.; Thoon, K.C.; Yung, C.F.; et al. Effectiveness of a mobile-based influenza-like illness surveillance system (FluMob) among health care workers: Longitudinal study. JMIR Mhealth Uhealth 2020, 8, e19712. [Google Scholar] [CrossRef]
- Webb, B.; Sali, A. Comparative protein structure modeling using MODELLER. Curr. Protoc. Bioinform. 2014, 47, 5.6.1–5.6.32. [Google Scholar] [CrossRef]
HA | NS1 | NA | PB1 | |||||
---|---|---|---|---|---|---|---|---|
Virus Passage | MDCK-SIAT1 | CEF | MDCK-SIAT1 | CEF | MDCK-SIAT1 | CEF | MDCK-SIAT1 | CEF |
1 | – | – | – | – | – | N.D. | – | N.D. |
2 | – | N.D. | – | N.D. | – | N.D. | – | N.D. |
3 | – | N.D. | – | N.D. | A736G (silent) | N.D. | A275C (Q84P) | N.D. |
G325T (G101C) | ||||||||
4 | – | N.D. | – | N.D. | – | N.D. | – | N.D. |
5 | A1399G (D457G) | N.D. | – | N.D. | – | N.D. | – | N.D. |
Serum Code | Neutralizing Antibody Titers against P0 and P5 Viruses | |
---|---|---|
P0 | P5 | |
FMT167 | 160 | 160 |
FMT486 | 160 | 160 |
FMK138 | 160 | 160 |
FMK025 | 160 | 160 |
FMK041 | 160 | 160 |
FMT018 | 160 | 160 |
FMK123 | 320 | 320 |
FMT034 | 160 | 320 |
FMT048 | 160 | 320 |
FMT052 | 320 | 320 |
FMT071 | 160 | 320 |
FMT108 | 160 | 160 |
FMT163 | 160 | 320 |
FMT182 | 320 | 320 |
FMT190 | 320 | 320 |
FMT239 | 320 | 320 |
FMT416 | 160 | 160 |
FMT448 | 160 | 160 |
FMT468 | 160 | 160 |
FMK013 | 160 | 160 |
Code Name | Primer Sequence (5′-3′) | Purpose |
---|---|---|
HA1F | AGCAGGGGATATTTTTATTAACC | Forward primer for preliminary HA1 screening |
HA1R | CAACCATCCACCATTCCCTC | Reverse primer for preliminary HA1 screening |
M1-M2F | CATCCTGTTGTATATGAGGCCCAT | Forward primer for real-time qPCR |
M1-M2R | GGACTGCAGCGTTAGACGCTT | Reverse primer for real-time qPCR |
NS1-M13F | TGTAAAACGACGGCCAGTAGCAAAAGCAGGGTGACAAAGACA | Forward primer for NS1 amplification |
NS1-M13R | CAGGAAACAGCTATGACCAGTAGAAACAAGGGTGTTTTTTAT | Reverse primer for NS1 amplification |
HA-F1-M13F | TGTAAAACGACGGCCAGTAAAGCAGGGGATAATTCTA | Forward primer for HA Fragment 1 |
HA-F1-M13R | CAGGAAACAGCTATGACCATTGCTGCTTGAGTGCTT | Reverse primer for HA Fragment 1 |
HA-F2-M13F | TGTAAAACGACGGCCAGTGGTTACTTCAAAATAC | Forward primer for HA Fragment 2 |
HA-F2-M13R | CAGGAAACAGCTATGACCAGTAGAAACAAGGGTGTTTT | Reverse primer for HA Fragment 2 |
NA-F1-M13F | TGTAAAACGACGGCCAGTAGCAAAAGCAGGAGT | Forward primer for NA Fragment 1 |
NA-F1-M13R | CAGGAAACAGCTATGACCCGACATGCTGAGCACTYCCTGAC | Reverse primer for NA Fragment 1 |
NA-F2-M13F | TGTAAAACGACGGCCAGTGAACTTGTRCAGTRGTAATG | Forward primer for NA Fragment 2 |
NA-F2-M13R | CAGGAAACAGCTATGACCAGTAGAAACAAGGAG | Reverse primer for NA Fragment 2 |
PB1-F1-M13F | TGTAAAACGACGGCCAGTAGCRAAAGCAGGCAAACCAT | Forward primer for PB1 Fragment 1 |
PB1-F1-M13R | CAGGAAACAGCTATGACCTGTTCAAGCTTTTCRCAWATGC | Reverse primer for PB1 Fragment 1 |
PB1-F2-M13F | TGTAAAACGACGGCCAGTCRATGACCAAAGATGCWGA | Forward primer for PB1 Fragment 2 |
PB1-F2-M13R | CAGGAAACAGCTATGACCAAGGTCATTGTTTATCATRTTG | Reverse primer for PB1 Fragment 2 |
PB1-F3-M13F | TGTAAAACGACGGCCAGTGTGGCYAATTTYAGCATGGAG | Forward primer for PB1 Fragment 3 |
PB1-F3-M13R | CAGGAAACAGCTATGACCAGTAGAAACAAGGCATTT | Reverse primer for PB1 Fragment 3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aw, D.Z.H.; Heng, K.K.; Heok, J.Y.H.; Kong, X.Y.; Chen, H.; Zhang, T.; Zhai, W.; Chow, V.T.K. Serial Passaging of Seasonal H3N2 Influenza A/Singapore/G2-31.1/2014 Virus in MDCK-SIAT1 Cells and Primary Chick Embryo Cells Generates HA D457G Mutation and Other Variants in HA, NA, PB1, PB1-F2, and NS1. Int. J. Mol. Sci. 2022, 23, 12408. https://doi.org/10.3390/ijms232012408
Aw DZH, Heng KK, Heok JYH, Kong XY, Chen H, Zhang T, Zhai W, Chow VTK. Serial Passaging of Seasonal H3N2 Influenza A/Singapore/G2-31.1/2014 Virus in MDCK-SIAT1 Cells and Primary Chick Embryo Cells Generates HA D457G Mutation and Other Variants in HA, NA, PB1, PB1-F2, and NS1. International Journal of Molecular Sciences. 2022; 23(20):12408. https://doi.org/10.3390/ijms232012408
Chicago/Turabian StyleAw, Daryl Zheng Hao, Keng Kai Heng, Jovian Yee Han Heok, Xin Yang Kong, Hui Chen, Tong Zhang, Weiwei Zhai, and Vincent T. K. Chow. 2022. "Serial Passaging of Seasonal H3N2 Influenza A/Singapore/G2-31.1/2014 Virus in MDCK-SIAT1 Cells and Primary Chick Embryo Cells Generates HA D457G Mutation and Other Variants in HA, NA, PB1, PB1-F2, and NS1" International Journal of Molecular Sciences 23, no. 20: 12408. https://doi.org/10.3390/ijms232012408
APA StyleAw, D. Z. H., Heng, K. K., Heok, J. Y. H., Kong, X. Y., Chen, H., Zhang, T., Zhai, W., & Chow, V. T. K. (2022). Serial Passaging of Seasonal H3N2 Influenza A/Singapore/G2-31.1/2014 Virus in MDCK-SIAT1 Cells and Primary Chick Embryo Cells Generates HA D457G Mutation and Other Variants in HA, NA, PB1, PB1-F2, and NS1. International Journal of Molecular Sciences, 23(20), 12408. https://doi.org/10.3390/ijms232012408