Nanorings to Probe Mechanical Stress of Single-Stranded DNA Mediated by the DNA Duplex
Abstract
:1. Introduction
2. Results
2.1. DNA Nanoring Design
2.2. Characterization of the Nanorings
2.3. Dynamics of the Nanorings
2.4. Theory of the DNA Nanoring Mechanics
3. Discussion
4. Materials and Methods
4.1. Oligonucleotides for Nanoring Assembly
- 190 nt pre-ring oligo: 5′-TCATGGAAGGATATGTACGATATCGAGATCTAGCTATCCCGGCTATGTGCATATCGAGCGCTGTCTACATATGGATACTCCTATGTCACCGGTCTCTAGTCTCGATGATCTTATGTCCTAGTGTCGCCATGCTGTGTGCGGTACCGTGAGACACAGATCGTATGCAGCTATACGGCAGTCCATAGGAGCC-3′
- 160 nt hybridization oligo: 5′-CATATGTAGACAGCGCTCGATATGCACATAGCCGGGATAGCTAGATCTCGATATCGTACATATCCTTCCATGAGGCTCCTATGGACTGCCGTATAGCTGCATACGATCTGTGTCTCACGGTACCGCACACAGCATGGCGACACTAGGACATAAGATCATC-3′
- 20 nt splinting oligo: 5′-AGTCCATAGGAGCCTCATGGAAGG-3′
- 80 nt hybridization oligo 1: 5′-ATGGACTGCCGTATAGCTGCATACGATCTGTGTCTCACGGTACCGCACACAGCATGGCGACACTAGGACATAAGATCATC-3′
- 80 nt hybridization oligo 2: 5′-CATATGTAGACAGCGCTCGATATGCACATAGCCGGGATAGCTAGATCTCGATATCGTACATATCCTTCCATGAGGCTCCT-3′
4.2. Preparation of Nanorings
4.3. Preparation of Gap Constructs
4.4. Static Atomic Force Microscopy Imaging in Air
4.5. Time-Lapse Atomic Force Microscopy Imaging in Aqueous Buffer
4.6. Image Analysis
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Pérez-Martín, J.; De Lorenzo, V. Clues and Consequences of DNA Bending in Transcription. Annu. Rev. Microbiol. 1997, 51, 593–628. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gubaev, A.; Klostermeier, D. The Mechanism of Negative DNA Supercoiling: A Cascade of DNA-Induced Conformational Changes Prepares Gyrase for Strand Passage. DNA Repair 2014, 16, 23–34. [Google Scholar] [CrossRef]
- Sharp, K.A.; Lu, X.J.; Cingolani, G.; Harvey, S.C. DNA Conformational Changes Play a Force-Generating Role during Bacteriophage Genome Packaging. Biophys. J. 2019, 116, 2172–2180. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Yang, H.; Pavletich, N.P. Mechanism of Homologous Recombination from the RecA–SsDNA/DsDNA Structures. Nature 2008, 453, 489–494. [Google Scholar] [CrossRef] [PubMed]
- Park, J.S.; Roberts, J.W. Role of DNA Bubble Rewinding in Enzymatic Transcription Termination. Proc. Natl. Acad. Sci. USA 2006, 103, 4870–4875. [Google Scholar] [CrossRef] [Green Version]
- Bednar, J.; Furrer, P.; Katritch, V.; Stasiak, A.Z.; Dubochet, J.; Stasiak, A. Determination of DNA Persistence Length by Cryo-Electron Microscopy. Separation of the Static and Dynamic Contributions to the Apparent Persistence Length of DNA. J. Mol. Biol. 1995, 254, 579–594. [Google Scholar] [CrossRef]
- Smith, S.B.; Cui, Y.; Bustamante, C. Overstretching B-DNA: The Elastic Response of Individual Double-Stranded and Single-Stranded DNA Molecules. Science 1996, 271, 795–799. [Google Scholar] [CrossRef] [Green Version]
- Roth, E.; Glick Azaria, A.; Girshevitz, O.; Bitler, A.; Garini, Y. Measuring the Conformation and Persistence Length of Single-Stranded DNA Using a DNA Origami Structure. Nano Lett. 2018, 18, 36. [Google Scholar] [CrossRef]
- Benham, C.J. Torsional Stress and Local Denaturation in Supercoiled DNA. Proc. Natl. Acad. Sci. USA 1979, 76, 3870–3874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bustamante, C.; Bryant, Z.; Smith, S.B. Ten Years of Tension: Single-Molecule DNA Mechanics. Nature 2003, 421, 423–427. [Google Scholar] [CrossRef] [PubMed]
- Maier, B.; Bensimon, D.; Croquette, V. Replication by a Single DNA Polymerase of a Stretched Single-Stranded DNA. Proc. Natl. Acad. Sci. USA 2000, 97, 12002–12007. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, J.; Le, S.; Basu, A.; Chazin, W.J.; Yan, J. Mechanochemical Regulations of RPA’s Binding to SsDNA. Sci. Rep. 2015, 5, 9296. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Newton, M.D.; Taylor, B.J.; Driessen, R.P.C.; Roos, L.; Cvetesic, N.; Allyjaun, S.; Lenhard, B.; Cuomo, M.E.; Rueda, D.S. DNA Stretching Induces Cas9 Off-Target Activity. Nat. Struct. Mol. Biol. 2019, 26, 185–192. [Google Scholar] [CrossRef]
- Lyubchenko, Y.L.; Shlyakhtenko, L.S.; Ando, T. Imaging of Nucleic Acids with Atomic Force Microscopy. Methods 2011, 54, 274–283. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lyubchenko, Y.L. Direct AFM Visualization of the Nanoscale Dynamics of Biomolecular Complexes. J. Phys. D Appl. Phys. 2018, 51, 403001. [Google Scholar] [CrossRef]
- Main, K.H.S.; Provan, J.I.; Haynes, P.J.; Wells, G.; Hartley, J.A.; Pyne, A.L.B. Atomic Force Microscopy—A Tool for Structural and Translational DNA Research. APL Bioeng. 2021, 5, 031504. [Google Scholar] [CrossRef]
- Shlyakhtenko, L.S.; Gall, A.A.; Lyubchenko, Y.L. Mica Functionalization for Imaging of DNA and Protein-DNA Complexes with Atomic Force Microscopy. In Cell Imaging Techniques: Methods in Molecular Biology (Methods and Protocols); Humana Press: Totowa, NJ, USA, 2012; pp. 295–312. [Google Scholar]
- Geggier, S.; Vologodskii, A.; Levitt, M. Sequence Dependence of DNA Bending Rigidity. Proc. Natl. Acad. Sci. USA 2010, 107, 15421–15426. [Google Scholar] [CrossRef] [Green Version]
- Wuite, G.J.L.; Smith, S.B.; Young, M.; Keller, D.; Bustamante, C. Single-Molecule Studies of the Effect of Template Tension on T7 DNA Polymerase Activity. Nature 2000, 404, 103–106. [Google Scholar] [CrossRef]
- An, R.; Li, Q.; Fan, Y.; Li, J.; Pan, X.; Komiyama, M.; Liang, X. Highly Efficient Preparation of Single-Stranded DNA Rings by T4 Ligase at Abnormally Low Mg(II) Concentration. Nucleic Acids Res. 2017, 45, e139. [Google Scholar] [CrossRef] [Green Version]
- Adams, J.D.; Nievergelt, A.; Erickson, B.W.; Yang, C.; Dukic, M.; Fantner, G.E. High-Speed Imaging Upgrade for a Standard Sample Scanning Atomic Force Microscope Using Small Cantilevers. Rev. Sci. Instrum. 2014, 85, 093702. [Google Scholar] [CrossRef]
- Nievergelt, A.P.; Banterle, N.; Andany, S.H.; Gönczy, P.; Fantner, G.E. High-Speed Photothermal off-Resonance Atomic Force Microscopy Reveals Assembly Routes of Centriolar Scaffold Protein SAS-6. Nat. Nanotechnol. 2018, 13, 696–701. [Google Scholar] [CrossRef] [PubMed]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zagorski, K.; Stormberg, T.; Hashemi, M.; Kolomeisky, A.B.; Lyubchenko, Y.L. Nanorings to Probe Mechanical Stress of Single-Stranded DNA Mediated by the DNA Duplex. Int. J. Mol. Sci. 2022, 23, 12916. https://doi.org/10.3390/ijms232112916
Zagorski K, Stormberg T, Hashemi M, Kolomeisky AB, Lyubchenko YL. Nanorings to Probe Mechanical Stress of Single-Stranded DNA Mediated by the DNA Duplex. International Journal of Molecular Sciences. 2022; 23(21):12916. https://doi.org/10.3390/ijms232112916
Chicago/Turabian StyleZagorski, Karen, Tommy Stormberg, Mohtadin Hashemi, Anatoly B. Kolomeisky, and Yuri L. Lyubchenko. 2022. "Nanorings to Probe Mechanical Stress of Single-Stranded DNA Mediated by the DNA Duplex" International Journal of Molecular Sciences 23, no. 21: 12916. https://doi.org/10.3390/ijms232112916