Identification and Validation of Quantitative Trait Loci Mapping for Spike-Layer Uniformity in Wheat
Abstract
:1. Introduction
2. Results
2.1. Phenotypic Characterization of Spike-Layer Uniformity
2.2. Identification of QTL Conferring Spike-Layer Uniformity
2.3. Validation of the Major and Stable QTL, with a Different Genetic Background and Its Effect on Yield-Related Traits
2.4. Candidate Genes for QSlu.sicau-2B-2
3. Discussion
4. Materials and Methods
4.1. Plant Materials, Trial Design, and Phenotype Evaluation
4.2. Phenotypic Data Analysis
4.3. Genotyping, Map Construction, QTL Mapping
4.4. Marker Development, QTL Validation, and Candidate Genes Prediction
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chaves, M.S.; Martinelli, J.A.; Wesp-Guterres, C.; Graichen, F.A.S.; Brammer, S.P.; Scagliusi, S.M.; Da Silva, P.R.; Wiethoelter, P.; Montan Torres, G.A.; Lau, E.Y.; et al. The importance for food security of maintaining rust resistance in wheat. Food Secur. 2013, 5, 157–176. [Google Scholar] [CrossRef] [Green Version]
- Sinchire, D.B.M.; Álvarez, L.S.J.; Valdivieso, J.I.B.; Mora, E.D.C. Oat and wheat forage production under hydroponic and conventional systems. Cienc. Tecnol. Agropecu. 2020, 21, 1–16. [Google Scholar] [CrossRef]
- Henkrar, F.; Udupa, S. Marker assisted selection in plant breeding. Moroccan J. Agric. Sci. 2020, 1, 237–247. [Google Scholar]
- Hu, X.; Wang, G.; Du, X.; Zhang, H.; Xu, Z.; Wang, J.; Chen, G.; Wang, B.; Li, X.; Chen, X. QTL analysis across multiple environments reveals promising chromosome regions associated with yield-related traits in maize under drought conditions. Crop J. 2020, 9, 759–766. [Google Scholar] [CrossRef]
- Wang, Z.; Hu, H.; Jiang, X.; Tao, Y.; Lin, Y.; Wu, F.; Hou, S.; Liu, S.; Li, C.; Chen, G. Identification and validation of a novel major quantitative trait locus for plant height in common wheat (Triticum aestivum L.). Front Genet. 2020, 11, 1314. [Google Scholar] [CrossRef]
- Zhao, M.; Ma, Z.; Wang, L.; Tang, Z.; Mao, T.; Liang, C.; Gao, H.; Zhang, L.; He, N.; Fu, L. SNP-based QTL mapping for panicle traits in the japonica super rice cultivar Liaoxing 1. Crop J. 2020, 8, 769–780. [Google Scholar] [CrossRef]
- Zhou, H.; Luo, W.; Gao, S.; Ma, J.; Zhou, M.; Wei, Y.; Zheng, Y.; Liu, Y.; Liu, C. Identification of loci and candidate genes controlling kernel weight in barley based on a population for which whole genome assemblies are available for both parents. Crop J. 2020, 9, 854–861. [Google Scholar] [CrossRef]
- Zhu, X.; Leiser, W.L.; Hahn, V.; Würschum, T. Identification of seed protein and oil related QTL in 944 RILs from a diallel of early-maturing European soybean. Crop J. 2020, 9, 238–247. [Google Scholar] [CrossRef]
- Song, J.; Li, B.; Cui, Y.; Zhuo, C.; Gu, Y.; Hu, K.; Wen, J.; Yi, B.; Shen, J.; Ma, C.; et al. QTL mapping and diurnal transcriptome analysis identify candidate genes regulating brassica napus flowering time. Int. J. Mol. Sci. 2021, 22, 7559. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Zhang, D.; Chen, X.; Li, Y.; Hu, M.; Sun, S.; Su, Q.; Su, Y.; Li, S. Identification of QTLs and a candidate gene for reducing pre-harvest sprouting in Aegilops tauschii-Triticum aestivum chromosome segment substitution lines. Int. J. Mol. Sci. 2021, 22, 3729. [Google Scholar] [CrossRef] [PubMed]
- Arif, M.A.R.; Attaria, F.; Shokat, S.; Akram, S.; Waheed, M.Q.; Arif, A.; Boenier, A. Mapping of QTLs associated with yield and yield related traits in durum wheat (Triticum durum Desf.) under irrigated and drought conditions. Int. J. Mol. Sci. 2020, 21, 2372. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Talukder, Z.I.; Underwood, W.; Ma, G.; Seiler, G.J.; Misar, C.G.; Cai, X.; Qi, L. Genetic dissection of phomopsis stem canker resistance in cultivated sunflower using high density SNP linkage map. Int. J. Mol. Sci. 2020, 21, 1497. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hina, A.; Cao, Y.; Song, S.; Li, S.; Sharmin, R.A.; Elattar, M.A.; Bhat, J.A.; Zhao, T. High-resolution mapping in two ril populations refines major “QTL hotspot” regions for seed size and shape in soybean (Glycine max L.). Int. J. Mol. Sci. 2020, 21, 1040. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, Y.; Jiang, X.; Hu, H.; Zhou, K.; Wang, Q.; Yu, S.; Yang, X.; Wang, Z.; Wu, F.; Liu, S. QTL mapping for grain number per spikelet in wheat using a high-density genetic map. Crop J. 2021, 9, 1108–1114. [Google Scholar] [CrossRef]
- Cui, F.; Zhang, N.; Fan, X.; Zhang, W.; Zhao, C.; Yang, L.; Pan, R.; Chen, M.; Han, J.; Zhao, X.; et al. Utilization of a Wheat660K SNP array-derived high-density genetic map for high-resolution mapping of a major QTL for kernel number. Sci. Rep. 2017, 7, 3788. [Google Scholar] [CrossRef] [PubMed]
- Winfield, M.O.; Allen, A.M.; Burridge, A.J.; Barker, G.L.; Benbow, H.R.; Wilkinson, P.A.; Coghill, J.; Waterfall, C.; Davassi, A.; Scopes, G.; et al. High-density SNP genotyping array for hexaploid wheat and its secondary and tertiary gene pool. Plant Biotechnol. J. 2016, 14, 1195–1206. [Google Scholar] [CrossRef]
- Wang, S.; Wong, D.; Forrest, K.; Allen, A.; Chao, S.; Huang, B.E.; Maccaferri, M.; Salvi, S.; Milner, S.G.; Cattivelli, L.; et al. Characterization of polyploid wheat genomic diversity using a high-density 90,000 single nucleotide polymorphism array. Plant Biotechnol. J. 2014, 12, 787–796. [Google Scholar] [CrossRef] [Green Version]
- Cavanagh, C.R.; Chao, S.; Wang, S.; Huang, B.E.; Stephen, S.; Kiani, S.; Forrest, K.; Saintenac, C.; Brown-Guedira, G.L.; Akhunova, A.; et al. Genome-wide comparative diversity uncovers multiple targets of selection for improvement in hexaploid wheat landraces and cultivars. Proc. Natl. Acad. Sci. USA 2013, 110, 8057–8062. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Z.; Liu, Y.; Shi, H.; Mo, H.; Wu, F.; Lin, Y.; Gao, S.; Wang, J.; Wei, Y.; Liu, C.; et al. Identification and validation of novel low-tiller number QTL in common wheat. Theor. Appl. Genet. 2016, 129, 603–612. [Google Scholar] [CrossRef]
- Ma, L.; Bao, J.; Guo, L.; Zeng, D.; Li, X.; Ji, Z.; Xia, Y.; Yang, C.; Qian, Q. Quantitative trait loci for panicle layer uniformity identified in doubled haploid lines of rice in two environments. J. Integr. Plant Biol. 2009, 51, 818–824. [Google Scholar] [CrossRef]
- Fang, F.; Ye, S.; Tang, J.; Bennett, M.J.; Liang, W. DWT1/DWL2 act together with OsPIP5K1 to regulate plant uniform growth in rice. New Phytol. 2020, 225, 1234–1246. [Google Scholar] [CrossRef]
- Wang, W.; Li, G.; Zhao, J.; Chu, H.; Lin, W.; Zhang, D.; Wang, Z.; Liang, W. DWARF TILLER1, a WUSCHEL-related homeobox transcription factor, is required for tiller growth in rice. PLoS Genet. 2014, 10, e1004154. [Google Scholar] [CrossRef]
- Zhao, C.; Zhang, N.; Wu, Y.; Sun, H.; Liu, C.; Fan, X.; Yan, X.; Xu, H.; Ji, J.; Cui, F. QTL for spike-layer uniformity and their influence on yield-related traits in wheat. BMC Genet. 2019, 20, 23. [Google Scholar] [CrossRef] [PubMed]
- Malik, P.; Kumar, J.; Sharma, S.; Sharma, R.; Sharma, S. Multi-locus genome-wide association mapping for spike-related traits in bread wheat (Triticum aestivum L.). BMC Genom. 2021, 22, 597. [Google Scholar] [CrossRef] [PubMed]
- International Wheat Genome Sequencing Consortium (IWGSC). Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science 2018, 361, 7191. [Google Scholar] [CrossRef] [Green Version]
- Zhu, T.; Wang, L.; Rimbert, H.; Rodriguez, J.C.; Deal, K.R.; De Oliveira, R.; Choulet, F.; Keeble-Gagnère, G.; Tibbits, J.; Rogers, J.; et al. Optical maps refine the bread wheat Triticum aestivum cv. Chinese Spring genome assembly. Plant J. 2021, 107, 303–314. [Google Scholar] [CrossRef]
- Jain, M.; Ghanashyam, C.; Bhattacharjee, A. Comprehensive expression analysis suggests overlapping and specific roles of rice glutathione S-transferase genes during development and stress responses. BMC Genom. 2010, 11, 73. [Google Scholar] [CrossRef] [Green Version]
- Yao, W. Studies on inheritance of spike layer uniformity of wheat. Seed 2000, 3, 19–21. [Google Scholar]
- Hu, Y. The difference of the spike-layer architecture and its relation to yield in winter wheat cultivars. Seed 2001, 119, 19–21. [Google Scholar]
- Li, J.; Yan, Q. Studies on the relationship between the evenness degree and yield characters of hybrid early rice. Hunan Agric. Sci. 2005, 1, 14–17. [Google Scholar]
- Zhao, D.H.; Yan, Q.Q.; Wang, J.R.; Wan, H.Q. Study on relationship between population uniformity and yield characters of late hybrid rice. Guangxi Agric. Sci. 2005, 36, 205–207. [Google Scholar]
- Liu, Y.; Lin, Y.; Gao, S.; Li, Z.; Ma, J.; Deng, M.; Chen, G.; Wei, Y.; Zheng, Y. A genome-wide association study of 23 agronomic traits in Chinese wheat landraces. Plant J. 2017, 91, 861–873. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Piepho, H.P.; Möhring, J.; Melchinger, A.E.; Büchse, A. BLUP for phenotypic selection in plant breeding and variety testing. Euphytica 2008, 161, 209–228. [Google Scholar] [CrossRef]
- Smith, S.E.; Kuehl, R.O.; Ray, I.M.; Hui, R.; Soleri, D. Evaluation of simple methods for estimating broad-sense heritability in stands of randomly planted genotypes. Crop Sci. 1998, 38, 1125–1129. [Google Scholar] [CrossRef]
- Li, H.; Hearne, S.; Banziger, M.; Li, Z.; Wang, J. Statistical properties of QTL linkage mapping in biparental genetic populations. Heredity 2010, 105, 257–267. [Google Scholar] [CrossRef] [Green Version]
- Meng, L.; Li, H.; Zhang, L.; Wang, J. QTL IciMapping: Integrated software for genetic linkage map construction and quantitative trait locus mapping in biparental populations. Crop J. 2015, 3, 269–283. [Google Scholar] [CrossRef] [Green Version]
- Deng, M.; Wu, F.; Zhou, W.; Li, J.; Shi, H.; Wang, Z.; Lin, Y.; Yang, X.; Wei, Y.; Zheng, Y.; et al. Mapping of QTL for total spikelet number per spike on chromosome 2D in wheat using a high-density genetic map. Genet. Mol. Biol. 2019, 42, 603–610. [Google Scholar] [CrossRef] [Green Version]
- Rice, J.P.; Saccone, N.L.; Corbett, J. Model-based methods for linkage analysis. Adv. Genet. 2008, 60, 155–173. [Google Scholar] [CrossRef]
- Lebrec, J.; Putter, H.; Houwelingen, J.C. Score test for detecting linkage to complex traits in selected samples. Genet Epidemiol 2004, 27, 97–108. [Google Scholar] [CrossRef] [PubMed]
- Lin, Y.; Jiang, X.; Tao, Y.; Yang, X.; Wang, Z.; Wu, F.; Liu, S.; Li, C.; Deng, M.; Ma, J.; et al. Identification and validation of stable quantitative trait loci for grain filling rate in common wheat (Triticum aestivum L.). Theor. Appl. Genet. 2020, 133, 2377–2385. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, Y.; Sekiya, T.; Hayashi, K. Allele-specific polymerase chain reaction: A method for amplification and sequence determination of a single component among a mixture of sequence variants. Anal. Biochem. 1991, 192, 82–84. [Google Scholar] [CrossRef]
- Bu, D.; Luo, H.; Huo, P.; Wang, Z.; Zhang, S.; He, Z.; Wu, Y.; Zhao, L.; Liu, J.; Guo, J.; et al. KOBAS-i: Intelligent prioritization and exploratory visualization of biological functions for gene enrichment analysis. Nucleic. Acids Res. 2021, 49, W317–W325. [Google Scholar] [CrossRef] [PubMed]
- Yao, W.; Li, G.; Yu, Y.; Ouyang, Y. FunRiceGenes dataset for comprehensive understanding and application of rice functional genes. Gigascience 2017, 7, 119. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Variable | DF a | Type III Sum of Square | Mean Square | F Value | Significance b |
---|---|---|---|---|---|
Environment | 3 | 3.76 | 1.25 | 141.77 | ** |
Replication | 4 | 0.02 | 0.005 | 0.52 | ns |
Genotype | 298 | 32.51 | 0.11 | 12.35 | ** |
Environment × Genotype | 885 | 10.29 | 0.01 | 1.32 | ** |
Environment a | Parents | Recombinant Inbred Line (RIL) Population | |||||||
---|---|---|---|---|---|---|---|---|---|
H461 | Chinese Spring | Difference b | Mean | Min | Max | SD c | CV (%) d | Heritability | |
CZ2019 | 0.66 | 0.18 | 0.49 ** | 0.41 | 0.17 | 1.00 | 0.15 | 37.61 | |
WJ2019 | 0.78 | 0.24 | 0.53 ** | 0.45 | 0.22 | 1.00 | 0.15 | 32.84 | |
CZ2020 | 0.83 | 0.24 | 0.59 ** | 0.48 | 0.17 | 1.00 | 0.12 | 25.11 | |
WJ2020 | 0.80 | 0.23 | 0.57 ** | 0.52 | 0.28 | 1.00 | 0.13 | 24.34 | |
BLUP | 0.80 | 0.22 | 0.58 ** | 0.58 | 0.29 | 0.95 | 0.11 | 18.69 | 0.88 |
QTL | Environment a | Chromosome | Genetic Distance (cM) | Physical Positions (Mb) | Flanking Marker | LOD b | PVE (%) c | AE d |
---|---|---|---|---|---|---|---|---|
QSlu.sicau-1B | CZ2020 | 1B | 6.87–7.22 | 572.94–577.58 | AX-109490843 and AX-111619113 | 3.73 | 3.43 | 0.024 |
BLUP | 1B | 6.87–7.22 | 572.94–577.58 | AX-109490843 and AX-111619113 | 5.96 | 3.55 | 0.024 | |
QSlu.sicau-2B-1 | WJ2019 | 2B | 137.91–139.55 | 755.21–777.78 | AX-111487903 and AX-111457622 | 6.17 | 3.91 | −0.034 |
BLUP | 2B | 137.91–139.55 | 755.21–777.78 | AX-111487903 and AX-111457622 | 3.47 | 2.05 | −0.018 | |
QSlu.sicau-2B-2 | CZ2019 | 2B | 165.70–166.40 | 798.21–802.29 | AX-108770043 and AX-108927717 | 17.66 | 17.98 | 0.070 |
WJ2019 | 2B | 165.70–166.40 | 788.13–792.19 | AX-108770043 and AX-108927717 | 28.76 | 21.21 | 0.078 | |
CZ2020 | 2B | 165.70–166.40 | 788.13–792.20 | AX-108770043 and AX-108927717 | 14.06 | 13.89 | 0.048 | |
WJ2020 | 2B | 165.70–166.40 | 788.13–792.21 | AX-108770043 and AX-108927717 | 16.12 | 16.73 | 0.055 | |
BLUP | 2B | 165.70–166.40 | 788.13–792.22 | AX-108770043 and AX-108927717 | 32.70 | 23.97 | 0.062 | |
QSlu.sicau-2D | CZ2019 | 2D | 231.72–235.60 | 565.41–640.84 | AX-110554181 and AX-111921261 | 13.61 | 13.67 | 0.062 |
WJ2019 | 2D | 230.67–231.02 | 633.66–634.41 | AX-110440599 and AX-95093952 | 18.98 | 12.93 | 0.061 | |
CZ2020 | 2D | 231.72–235.60 | 565.41–640.84 | AX-110554181 and AX-111921261 | 14.46 | 14.88 | 0.050 | |
WJ2020 | 2D | 231.72–235.60 | 565.41–640.84 | AX-110554181 and AX-111921261 | 14.84 | 15.39 | 0.053 | |
BLUP | 2D | 230.67–231.02 | 633.66–634.41 | AX-110440599 and AX-95093952 | 23.75 | 15.98 | 0.051 |
SNP | Primer a | Primer sequence (5’ to 3’) | Allele b |
---|---|---|---|
AX-108927717 | FAM | TTGGAATGTCTCCATCCCAC | aa |
HEX | TTGGAATGTCTCCATCCCAG | AA | |
Common reverse | CCTCTCCTATATCTGGCTTCTGTTG |
Environment a | Allele | Plant Height (cm) | Spike Length (cm) b | Spikelet Number | Thousand Kernel Weight (g) |
---|---|---|---|---|---|
CZ2019 | aa | 84.22 | 13.60 * | 22.11 ** | 50.15 ** |
AA | 84.22 | 13.23 | 20.81 | 45.84 | |
WJ2019 | aa | 82.01 | 13.45 ** | 20.92 ** | 50.15 ** |
AA | 82.01 | 12.80 | 19.74 | 45.84 | |
BLUP | aa | 83.10 | 13.50 * | 21.48 ** | 47.58 ** |
AA | 81.25 | 13.05 | 20.35 | 44.60 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, K.; Lin, Y.; Jiang, X.; Zhou, W.; Wu, F.; Li, C.; Wei, Y.; Liu, Y. Identification and Validation of Quantitative Trait Loci Mapping for Spike-Layer Uniformity in Wheat. Int. J. Mol. Sci. 2022, 23, 1052. https://doi.org/10.3390/ijms23031052
Zhou K, Lin Y, Jiang X, Zhou W, Wu F, Li C, Wei Y, Liu Y. Identification and Validation of Quantitative Trait Loci Mapping for Spike-Layer Uniformity in Wheat. International Journal of Molecular Sciences. 2022; 23(3):1052. https://doi.org/10.3390/ijms23031052
Chicago/Turabian StyleZhou, Kunyu, Yu Lin, Xiaojun Jiang, Wanlin Zhou, Fangkun Wu, Caixia Li, Yuming Wei, and Yaxi Liu. 2022. "Identification and Validation of Quantitative Trait Loci Mapping for Spike-Layer Uniformity in Wheat" International Journal of Molecular Sciences 23, no. 3: 1052. https://doi.org/10.3390/ijms23031052