Establishment of a Virus-Induced Gene-Silencing (VIGS) System in Tea Plant and Its Use in the Functional Analysis of CsTCS1
Abstract
:1. Introduction
2. Results
2.1. TRV Can Infect Fuding Dabaicha
2.2. TRV-Mediated VIGS System Was Successfully Used in the Tea plants
2.2.1. The TRV-Mediated VIGS System Was Successfully Used in the Tea Seedlings
2.2.2. TRV-Mediated VIGS System Was Successfully Used in the Tea Cuttings
2.3. Optimized VIGS System in Tea
2.4. Prediction of Gene Silencing Times by the Phenotypic Changes of CsPOR1-Silenced Plants
2.5. CsTCS1 Silencing Inhibited the Formation of Caffeine in the Leaves of Fuding Dabaicha
3. Discussion
4. Materials and Methods
4.1. Plant Material and Growing Conditions
4.2. Total RNA Extraction
4.3. Cloning of a Partial Sequence of CsPOR1
4.4. Vector Construction
4.5. Impact and Optimization of the Conversion Systems
4.5.1. Tea Plant Infection
4.5.2. Optimization of the Transformation System
4.6. Silencing and HPLC Analysis of CsTCS1 for Caffeine Content
4.7. Analysis of Expression by qRT-PCR
4.8. Data Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kumagai, M.H.; Donson, J.; Della-Cioppa, G.; Harvey, D.; Hanley, K.; Grill, L.K. Cytoplasmic inhibition of carotenoid biosynthesis with virus-derived RNA. Proc. Natl. Acad. Sci. USA 1995, 92, 1679–1683. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kjemtrup, S.; Sampson, K.S.; Peele, C.G.; Nguyen, L.V.; Conkling, M.A.; Thompson, W.F.; Robertson, D. Gene silencing from plant DNA carried by a Geminivirus. Plant J. Cell Mol. Biol. 1998, 14, 91–100. [Google Scholar] [CrossRef] [PubMed]
- Shen, J.; Si, W.; Wu, Y.; Xu, Y.; Wang, J.; Cheng, T.; Zhang, Q.; Pan, H. Establishment and Verification of An Efficient Virus-induced Gene Silencing System in Forsythia. Hortic. Plant J. 2021, 7, 81–88. [Google Scholar] [CrossRef]
- Mandar, R.G.; Arunima, P.; Indranil, D.; Prakash, P.K. RETRACTED ARTICLE: Virus-induced gene silencing for functional analysis of selected genes. Plant Cell Rep. 2008, 27, 209–219. [Google Scholar]
- Senthil-Kumar, M.; Mysore, K.S. New dimensions for VIGS in plant functional genomics. Trends Plant Sci. 2011, 16, 656–665. [Google Scholar] [CrossRef] [PubMed]
- Huang, C.; Qian, Y.; Li, Z.; Zhou, X. Virus-induced gene silencing and its application in plant functional genomics. Sci. China Life Sci. 2012, 55, 99–108. [Google Scholar] [CrossRef]
- Zhou, X.; Huang, C. Virus-induced gene silencing using begomovirus satellite molecules. Methods Mol. Biol. 2012, 894, 57–67. [Google Scholar] [CrossRef]
- Ji, T.; Li, C.; Zhen-yun, H.; Yun-cong, Y. Tobacco rattle virus mediated gene silencing in strawberry plants. Plant Cell Tissue Organ Cult. PCTOC 2015, 120, 1131–1138. [Google Scholar]
- Wang, J.T.Y.Y. Cotton Leaf Curl Multan Virus-Derived Viral Small RNAs Can Target Cotton Genes to Promote Viral Infection. Front. Plant Sci. 2016, 7, 1162. [Google Scholar] [CrossRef] [Green Version]
- Faivre-Rampant, O.; Gilroy, E.M.; Hrubikova, K.; Hein, I.; Millam, S.; Loake, G.J.; Birch, P.; Taylor, M.; Lacomme, C. Potato virus X-induced gene silencing in leaves and tubers of potato. Plant Physiol. 2004, 134, 1308–1316. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Zhang, J.; Wu, Z.; Lai, B.; Huang, X.; Qin, Y.; Wang, H.; Hu, G. Functional characterization of a glucosyltransferase gene, LcUFGT1, involved in the formation of cyanidin glucoside in the pericarp of Litchi chinensis. Physiol. Plant. 2015, 156, 139–149. [Google Scholar] [CrossRef]
- Gabruk, M.; Mysliwa-Kurdziel, B. Light-Dependent Protochlorophyllide Oxidoreductase: Phylogeny, Regulation, and Catalytic Properties. Biochemistry 2015, 54, 5255–5262. [Google Scholar] [CrossRef] [PubMed]
- Scrutton, N.S.; Groot, M.L.; Heyes, D.J. Excited state dynamics and catalytic mechanism of the light-driven enzyme protochlorophyllide oxidoreductase. Phys. Chem. Chem. Phys. 2012, 14, 8818–8824. [Google Scholar] [CrossRef] [PubMed]
- Damien, S.; Bertrand, L.; Stéphan, C.; Stéphanie, B.; Solène, M.; Emmanuelle, B.; Pierre, R.; Sabine, B.; Yohann, C.; Didier, N.; et al. An algal photoenzyme converts fatty acids to hydrocarbons. Science 2017, 357, 903–907. [Google Scholar]
- Zhang, S.; Heyes, D.J.; Feng, L.; Sun, W.; Johannissen, L.O.; Liu, H.; Levy, C.W.; Li, X.; Yang, J.; Yu, X.; et al. Structural basis for enzymatic photocatalysis in chlorophyll biosynthesis. Nature 2019, 574, 722–725. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Lee, H.; Song, J.; Jung, Y.J.; Reinbothe, S.; Park, Y.; Lee, S.Y.; Pai, H. Cell Growth Defect Factor1/CHAPERONE-LIKE PROTEIN OF POR1 Plays a Role in Stabilization of Light-Dependent Protochlorophyllide Oxidoreductase in Nicotiana benthamiana and Arabidopsis. Plant Cell 2013, 25, 3944–3960. [Google Scholar] [CrossRef] [Green Version]
- Li, R.X.; Ma, J. Screening, Cloning and Functional Identification of POR Gene in the Albino of Ananas Comosus var Bracteatus Leaves Using VIGS Technique; Sichuan Agricultural University/Landscape Architecture: Chengdu, China, 2018. [Google Scholar]
- Xia, E.; Tong, W.; Hou, Y.; An, Y.; Chen, L.; Wu, Q.; Liu, Y.; Yu, J.; Li, F.; Li, R.; et al. The Reference Genome of Tea Plant and Resequencing of 81 Diverse Accessions Provide Insights into Its Genome Evolution and Adaptation. Mol. Plant. 2020, 13, 1013–1026. [Google Scholar] [CrossRef]
- Liu, Y.; Schiff, M.; Dinesh-Kumar, S.P. Virus-induced gene silencing in tomato. Plant J. Cell Mol. Biol. 2002, 31, 777–786. [Google Scholar] [CrossRef]
- Romero, I.; Tikunov, Y.; Bovy, A. Virus-induced gene silencing in detached tomatoes and biochemical effects of phytoene desaturase gene silencing. J. Plant Physiol. 2011, 168, 1129–1135. [Google Scholar] [CrossRef]
- Deng, W.; Jin, Y.; Li, M.; Ma, L.; Zhang, Z. Prokaryotic Expression of Caffeine Synthase Gene (TCS1), Its Polyclonal Antibody Preparation and Identification. Bull. Bot. Res. 2015, 35, 333–339. [Google Scholar]
- Yu, Y.; Jiang, C.; Wan, X.; Li, X. Expression of tea caffeine synthase cDNA in tobacco. J. Northwest A F Univ. 2007, 35, 181–186. [Google Scholar]
- Mohanpuria, P.; Kumar, V.; Ahuja, P.S.; Yadav, S.K. Producing low-caffeine tea through post-transcriptional silencing of caffeine synthase mRNA. Plant Mol.Biol. 2011, 76, 523–534. [Google Scholar] [CrossRef] [PubMed]
- Di Stilio, V.S.; Kumar, R.A.; Oddone, A.M.; Tolkin, T.R.; Salles, P.; McCarty, K. Virus-induced gene silencing as a tool for comparative functional studies in Thalictrum. PLoS ONE 2010, 5, e12064. [Google Scholar] [CrossRef]
- Kalbande, B.B.; Patil, A.S. Plant tissue culture independent Agrobacterium tumefaciens mediated In-planta transformation strategy for upland cotton (Gossypium hirsutum). J. Genet. Eng. Biotechnol. 2016, 14, 9–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shen, Z.; Yao, J.; Sun, J.; Chang, L.; Wang, S.; Ding, M.; Qian, Z.; Zhang, H.; Zhao, N.; Sa, G.; et al. Populus euphratica HSF binds the promoter of WRKY1 to enhance salt tolerance. Plant Sci. 2015, 235, 89–100. [Google Scholar] [CrossRef] [PubMed]
- Zhou, P.; Peng, J.; Zeng, M.; Wu, L.; Fan, Y.; Zeng, L. Virus-induced gene silencing (VIGS) in Chinese narcissus and its use in functional analysis of NtMYB3. Hortic. Plant J. 2021, 7, 565–572. [Google Scholar] [CrossRef]
- Ye, J.; Qu, J.; Bui, H.T.; Chua, N.H. Rapid analysis of Jatropha curcas gene functions by virus-induced gene silencing. Plant Biotechnol. J. 2009, 7, 964–976. [Google Scholar] [CrossRef]
- Jie, Z.; Ji, T.; De-qiang, T.; Ke-ting, L.; Yong-jun, Z.; Yun-cong, Y. An optimized TRV-based virus-induced gene silencing protocol for Malus crabapple. Plant Cell Tissue Organ Cult. PCTOC 2016, 126, 499–509. [Google Scholar]
- Chen, J.C.; Jiang, C.Z.; Gookin, T.E.; Hunter, D.A.; Clark, D.G.; Reid, M.S. Chalcone synthase as a reporter in virus-induced gene silencing studies of flower senescence. Plant Mol. Biol. 2004, 55, 521–530. [Google Scholar] [CrossRef]
- Xiao, Z.; Xing, M.; Liu, X.; Fang, Z.; Yang, L.; Zhang, Y.; Wang, Y.; Zhuang, M.; Lv, H. An efficient virus-induced gene silencing (VIGS) system for functional genomics in Brassicas using a cabbage leaf curl virus (CaLCuV)-based vector. Planta 2020, 252, 42. [Google Scholar] [CrossRef]
- Saitoh, H.; Terauchi, R. Virus-induced silencing of FtsH gene in Nicotiana benthmiana causes a striking bleached leaf phenotype. Genes Genet. Syst. 2002, 77, 335–340. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jia, H.; Guo, J.; Qin, L.; Shen, Y. Virus-induced PpCHL Hgene silencing in peach leaves (Prunus persica). Hortic. Sci. Biotechnol. 2010, 85, 528–532. [Google Scholar] [CrossRef]
- Liu, E.; Page, J.E. Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus. Plant Methods 2008, 4, 5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuanzhong, J.; Shenglong, Y.; Lijun, W.; Yanjiao, D.; Wanxiang, L.; Hong, L.; Di Fan; Faqi, Z.; Keming, L. Heterologous gene silencing induced by tobacco rattle virus (TRV) is efficient for pursuing functional genomics studies in woody plants. Plant Cell Tissue Organ Cult. PCTOC 2014, 116, 163–174. [Google Scholar]
- Yan, H.X.; Fu, D.Q.; Zhu, B.Z.; Liu, H.P.; Shen, X.Y.; Luo, Y.B. Sprout vacuum-infiltration: A simple and efficient agroinoculation method for virus-induced gene silencing in diverse solanaceous species. Plant Cell Rep. 2012, 31, 1713–1722. [Google Scholar] [CrossRef]
- Fu, D.Q.; Zhu, B.Z.; Zhu, H.L.; Zhang, H.X.; Xie, Y.H.; Jiang, W.B.; Zhao, X.D.; Luo, K.B. Enhancement of virus-induced gene silencing in tomato by low temperature and low humidity. Mol. Cells 2006, 21, 153–160. [Google Scholar]
- Ali, Z.; Abul-faraj, A.; Li, L.; Ghosh, N.; Piatek, M.; Mahjoub, A.; Aouida, M.; Piatek, A.; Baltes, N.J.; Voytas, D.F.; et al. Efficient Virus-Mediated Genome Editing in Plants Using the CRISPR/Cas9 System. Mol. Plant. 2015, 8, 1288–1291. [Google Scholar] [CrossRef] [Green Version]
- Chen, X.; Duan, X.; Wang, S.; Wu, W.; Zhang, X. Virus-induced gene silencing (VIGS) for functional analysis of MYB80 gene involved in Solanum lycopersicum cold tolerance. Protoplasma 2019, 256, 409–418. [Google Scholar] [CrossRef]
- Li, H.; Zhang, D.; Xie, K.; Wang, Y.; Liao, Q.; Hong, Y.; Liu, Y. Efficient and high-throughput pseudorecombinant-chimeric Cucumber mosaic virus-based VIGS in maize. Plant Physiol. 2021, 187, 2865–2876. [Google Scholar] [CrossRef]
- Jing, J.L.; Cheng, H.W.; Qiao, J.X.; Yue, P.L.; Xian, F.L.; Hong, Y.Q. Overexpression and VIGS system for functional gene validation in oriental melon (Cucumis melo var. makuwa Makino). Plant Cell Tissue Organ Cult. PCTOC 2019, 137, 275–284. [Google Scholar]
- Zhang, J.; Wang, F.; Zhang, C.; Zhang, J.; Chen, Y.; Liu, G.; Zhao, Y.; Hao, F.; Zhang, J. A novel VIGS method by agroinoculation of cotton seeds and application for elucidating functions of GhBI-1 in salt-stress response. Plant Cell Rep. 2018, 37, 1091–1100. [Google Scholar] [CrossRef] [PubMed]
- Li, N.N.; Lu, J.L.; Li, Q.S.; Zheng, X.Q.; Wang, X.C.; Wang, L.; Wang, Y.C.; Ding, C.Q.; Liang, Y.R.; Yang, Y.J. Dissection of Chemical Composition and Associated Gene Expression in the Pigment-Deficient Tea Cultivar ‘Xiaoxueya’ Reveals an Albino Phenotype and Metabolite Formation. Front. Plant Sci. 2019, 10, 1543. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Ye, Z.; Fu, J.; Xu, Y.; Shen, Y.; Zhang, Y.; Tang, D.; Li, P.; Zuo, H.; Tong, W.; et al. CsMYB184 regulates caffeine biosynthesis in tea plants. Plant Biotechnol. J. 2022, 20, 1012–1014. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Zhang, J.; Su, J.; Wang, P.; Liu, J.; Liu, B.; Feng, D.; Wang, J.; Wang, H. The chloroplast min system functions differentially in two specific nongreen plastids in Arabidopsis thaliana. PLoS ONE 2013, 8, e71190. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Q.; Xu, K.; Yi, L.; Hou, Y.; Li, D.; Hu, H.; Zhou, F.; Song, P.; Yu, Y.; Wei, Q.; et al. A rapid, simple, and highly efficient method for VIGS and in vitro-inoculation of plant virus by INABS applied to crops that develop axillary buds and can survive from cuttings. BMC Plant Biol. 2021, 21, 545. [Google Scholar] [CrossRef]
- Liu, H.; Fu, D.; Zhu, B.; Yan, H.; Shen, X.; Zuo, J.; Zhu, Y.; Luo, Y. Virus-induced gene silencing in eggplant (Solanum melongena). J. Integr. Plant Biol. 2012, 54, 422–429. [Google Scholar] [CrossRef] [PubMed]
- Hua, X.; Leifeng, X.; Panpan, Y.; Yuwei, C.; Yuchao, T.; Guoren, H.; Suxia, Y.; Jingyi, L.; Jun, M. Virus-induced Phytoene Desaturase (PDS) Gene Silencing Using Tobacco Rattle Virus in Lilium × formolongi. Hortic. Plant J. 2019, 5, 31–38. [Google Scholar]
- Bispo, M.S.; Veloso, M.C.C.; Pinheiro, H.L.C.; De Oliveira, R.F.S.; Reis, J.O.N.; De Andrade, J.B. Simultaneous determination of caffeine, theobromine, and theophylline by high-performance liquid chromatography. J. Chromatogr. Sci. 2002, 40, 45–48. [Google Scholar] [CrossRef]
Combinations of Infiltration Buffer | OD600 | Vacuum Pressure | Number of Infected Seedlings | Number of Successful Infected Seedlings | Infection Efficiency (%) |
---|---|---|---|---|---|
4.74 g·L−1 MS + 2 mol·L−1 6-benzylaminopurine + 2 mol·L−1 acetosyringone + 100 umol·L−1 1-naphthylacetic acid | 1.0 | 0.6 | 40 | 0 | 0 |
1.2 | 0.6 | 40 | 0 | 0 | |
1.5 | 0.6 | 40 | 0 | 0 | |
1.0 | 0.7 | 40 | 0 | 0 | |
1.2 | 0.7 | 40 | 5 | 12.5 | |
1.5 | 0.7 | 40 | 0 | 0 | |
1.0 | 0.8 | 40 | 0 | 0 | |
1.2 | 0.8 | 40 | 1 | 2.5 | |
1.5 | 0.8 | 40 | 0 | 0 |
Combinations of Infiltration Buffer | OD600 | Vacuum Pressure | Number of Infected Cuttings | Number of Successful Infected Cuttings | Infection Efficiency (%) |
---|---|---|---|---|---|
4.74 g·L−1 MS + 2 mol·L−1 6-benzylaminopurine + 2 mol·L−1 acetosyringone + 100 umol·L−1 1-naphthylacetic acid + 16 g·L−1 MgCl2 | 1.0 | 0.6 | 25 | 0 | 0 |
1.2 | 0.6 | 24 | 0 | 0 | |
1.5 | 0.6 | 20 | 0 | 0 | |
1.0 | 0.7 | 25 | 0 | 0 | |
1.2 | 0.7 | 25 | 0 | 0 | |
1.5 | 0.7 | 26 | 0 | 0 | |
1.0 | 0.8 | 24 | 1 | 4.16 | |
1.2 | 0.8 | 23 | 8 | 34.7 | |
1.5 | 0.8 | 26 | 2 | 7.69 |
Usage | Primer Name | Primer Sequence |
---|---|---|
Partial gene cloning | CsPOR1 | F: CCAAGGCTCTAGCTGAAACA R: GAAAGGAGGAAGTGTCCAAGAT |
Partial gene cloning | CsTCS1 | F: CTGAATTGGTTTCACAGGGATTG R: TGTGGTCTTCGGTAGCTTTG |
TRV virus testing | pTRV1 | F: AAAGTGACTGGTGTGCCTAAA R: CTTGCAGAGCAGGAACTCTATC |
TRV virus testing | pTRV2 | F: CTACTACTACCAAGGCGAACAC R: GTCGTCAAGCCACTTCCTAA |
Vector construction | pTRV2-CsPOR1 | F: GAGGGTGGGTGATACCATATTC R: GCTGCTGTTTGTGCTCTTATAG |
Vector construction | pTRV2-CsTCS1 | F: GACACCTTCAATATACCCAGCTA R: ACTAGGATGATACTTGTGGTCTTC |
qRT -PCR | qRT -PCR CsPOR1 | F: CCAAGGCTCTAGCTGAAACA R: GTCAAGTGAGGCAAGGTCTAA |
qRT -PCR | qRT -PCR CsTCS1 | F: ACAAGCCCTCCTGTTGTAAG R: CCTCTTGGGATCTAGCATTGAG |
qRT-PCR | qRT -PCR CsTIDH | F: GCGCCATCCGACTATGATTT R: CCACTACTTGTCCTCCATCTTTC |
qRT-PCR | qRT -PCR CsSAM | F: CGATGAGACCGTGACAAATGA R: GAAGGGTTGAGGTGGAAGATG |
qRT-PCR | Actin | F: CAGACCGTATGAGCAAGGAAAT R: GTGCTTAGGGATGCAAGGATAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, G.; Li, Y.; Yao, X.; Lu, L. Establishment of a Virus-Induced Gene-Silencing (VIGS) System in Tea Plant and Its Use in the Functional Analysis of CsTCS1. Int. J. Mol. Sci. 2023, 24, 392. https://doi.org/10.3390/ijms24010392
Li G, Li Y, Yao X, Lu L. Establishment of a Virus-Induced Gene-Silencing (VIGS) System in Tea Plant and Its Use in the Functional Analysis of CsTCS1. International Journal of Molecular Sciences. 2023; 24(1):392. https://doi.org/10.3390/ijms24010392
Chicago/Turabian StyleLi, Guodong, Yan Li, Xinzhuan Yao, and Litang Lu. 2023. "Establishment of a Virus-Induced Gene-Silencing (VIGS) System in Tea Plant and Its Use in the Functional Analysis of CsTCS1" International Journal of Molecular Sciences 24, no. 1: 392. https://doi.org/10.3390/ijms24010392