Virulence and Metabolism Crosstalk: Impaired Activity of the Type Three Secretion System (T3SS) in a Pseudomonas aeruginosa Crc-Defective Mutant
Abstract
:1. Introduction
2. Results
2.1. Lack of Crc Precludes the Injection of the T3SS Effector ExoS by P. aeruginosa in HeLa Cells
2.2. Deletion of crc Reduces the Expression of T3SS-Related Genes
2.3. T3S Is Impaired in the crc-Deficient Mutant, While the Intracellular Amount of T3S-Associated Proteins Remains Unchanged
2.4. ExsE Exportation Is Impaired in the crc-Deficient Mutant
2.5. The Lack of Crc Impairs P. aeruginosa Proton Motive Force
3. Discussion
4. Materials and Methods
4.1. Bacterial Strains and Growth Conditions
4.2. Δhfq Mutant Construction
4.3. Complementation of the Δcrc Mutant
4.4. Detection of ExoS Injection in HeLa Cells by Immunofluorescence
4.5. T3SS Induction, RNA Preparation and Real Time RT-qPCR
4.6. Electrophoresis and Western Blotting
4.7. Parallel Reaction Monitoring Analysis for ExsE Quantification
4.8. Determination of the Proton Motive Force
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Laborda, P.; Sanz-García, F.; Hernando-Amado, S.; Martínez, J.L. Pseudomonas aeruginosa: An antibiotic resilient pathogen with environmental origin. Curr. Opin. Microbiol. 2021, 64, 125–132. [Google Scholar] [CrossRef]
- Obritsch, M.D.; Fish, D.N.; MacLaren, R.; Jung, R. Nosocomial infections due to multidrug-resistant Pseudomonas aeruginosa: Epidemiology and treatment options. Pharmacotherapy 2005, 25, 1353–1364. [Google Scholar] [CrossRef]
- Rossi, E.; La Rosa, R.; Bartell, J.A.; Marvig, R.L.; Haagensen, J.A.J.; Sommer, L.M.; Molin, S.; Johansen, H.K. Pseudomonas aeruginosa adaptation and evolution in patients with cystic fibrosis. Nat. Reviews. Microbiol. 2021, 19, 331–342. [Google Scholar] [CrossRef]
- Martinez-Solano, L.; Macia, M.D.; Fajardo, A.; Oliver, A.; Martinez, J.L. Chronic Pseudomonas aeruginosa infection in chronic obstructive pulmonary disease. Clin. Infect. Dis. 2008, 47, 1526–1533. [Google Scholar] [CrossRef] [Green Version]
- Brown, S.P.; Cornforth, D.M.; Mideo, N. Evolution of virulence in opportunistic pathogens: Generalism, plasticity, and control. Trends Microbiol. 2012, 20, 336–342. [Google Scholar] [CrossRef] [Green Version]
- Malecka, E.M.; Bassani, F.; Dendooven, T.; Sonnleitner, E.; Rozner, M.; Albanese, T.G.; Resch, A.; Luisi, B.; Woodson, S.; Bläsi, U. Stabilization of Hfq-mediated translational repression by the co-repressor Crc in Pseudomonas aeruginosa. Nucleic Acids Res. 2021, 49, 7075–7087. [Google Scholar] [CrossRef]
- Pei, X.Y.; Dendooven, T.; Sonnleitner, E.; Chen, S.; Bläsi, U.; Luisi, B.F. Architectural principles for Hfq/Crc-mediated regulation of gene expression. Elife 2019, 8, e43158. [Google Scholar] [CrossRef]
- Corona, F.; Martínez, J.L.; Nikel, P.I. The global regulator Crc orchestrates the metabolic robustness underlying oxidative stress resistance in Pseudomonas aeruginosa. Environ. Microbiol. 2019, 21, 898–912. [Google Scholar] [CrossRef] [Green Version]
- Molina, L.; La Rosa, R.A.-O.; Nogales, J.; Rojo, F.A.-O. Influence of the Crc global regulator on substrate uptake rates and the distribution of metabolic fluxes in Pseudomonas putida KT2440 growing in a complete medium. Environ. Microbiol. 2019, 21, 4446–4459. [Google Scholar] [CrossRef] [Green Version]
- Linares, J.F.; Moreno, R.; Fajardo, A.; Martinez-Solano, L.; Escalante, R.; Rojo, F.; Martinez, J.L. The global regulator Crc modulates metabolism, susceptibility to antibiotics and virulence in Pseudomonas aeruginosa. Environ. Microbiol. 2010, 12, 3196–3212. [Google Scholar] [CrossRef]
- Reales-Calderon, J.A.; Corona, F.; Monteoliva, L.; Gil, C.; Martinez, J.L. Quantitative proteomics unravels that the post-transcriptional regulator Crc modulates the generation of vesicles and secreted virulence determinants of Pseudomonas aeruginosa. J. Proteom. 2015, 127 Pt B, 352–364. [Google Scholar] [CrossRef] [Green Version]
- O’Toole, G.A.; Gibbs, K.A.; Hager, P.W.; Phibbs, P.V., Jr.; Kolter, R. The global carbon metabolism regulator Crc is a component of a signal transduction pathway required for biofilm development by Pseudomonas aeruginosa. J. Bacteriol. 2000, 182, 425–431. [Google Scholar] [CrossRef] [Green Version]
- Carilla-Latorre, S.; Calvo-Garrido, J.; Bloomfield, G.; Skelton, J.; Kay, R.R.; Ivens, A.; Martinez, J.L.; Escalante, R. Dictyostelium transcriptional responses to Pseudomonas aeruginosa: Common and specific effects from PAO1 and PA14 strains. BMC Microbiol. 2008, 8, 109. [Google Scholar] [CrossRef] [Green Version]
- Filloux, A. Protein Secretion Systems in Pseudomonas aeruginosa: An Essay on Diversity, Evolution, and Function. Front. Microbiol. 2011, 2, 155. [Google Scholar] [CrossRef] [Green Version]
- Hauser, A.R. The type III secretion system of Pseudomonas aeruginosa: Infection by injection. Nat. Rev. Microbiol. 2009, 7, 654–665. [Google Scholar] [CrossRef] [Green Version]
- Anantharajah, A.; Mingeot-Leclercq, M.P.; Van Bambeke, F. Targeting the Type Three Secretion System in Pseudomonas aeruginosa. Trends Pharmacol. Sci. 2016, 37, 734–749. [Google Scholar] [CrossRef]
- Lee, V.T.; Smith, R.S.; Tummler, B.; Lory, S. Activities of Pseudomonas aeruginosa effectors secreted by the Type III secretion system in vitro and during infection. Infect. Immun. 2005, 73, 1695–1705. [Google Scholar] [CrossRef] [Green Version]
- van Mansfeld, R.; de Been, M.; Paganelli, F.; Yang, L.; Bonten, M.; Willems, R. Within-Host Evolution of the Dutch High-Prevalent Pseudomonas aeruginosa Clone ST406 during Chronic Colonization of a Patient with Cystic Fibrosis. PLoS ONE 2016, 11, e0158106. [Google Scholar] [CrossRef] [Green Version]
- Moradali, M.F.; Ghods, S.; Rehm, B.H. Pseudomonas aeruginosa Lifestyle: A Paradigm for Adaptation, Survival, and Persistence. Front. Cell Infect. Microbiol. 2017, 7, 39. [Google Scholar] [CrossRef] [Green Version]
- Soscia, C.; Hachani, A.; Bernadac, A.; Filloux, A.; Bleves, S. Cross talk between type III secretion and flagellar assembly systems in Pseudomonas aeruginosa. J. Bacteriol. 2007, 189, 3124–3132. [Google Scholar] [CrossRef] [Green Version]
- Buttner, D. Protein export according to schedule: Architecture, assembly, and regulation of type III secretion systems from plant- and animal-pathogenic bacteria. Microbiol. Mol. Biol. Rev. MMBR 2012, 76, 262–310. [Google Scholar] [CrossRef] [Green Version]
- Kosarewicz, A.; Konigsmaier, L.; Marlovits, T.C. The blueprint of the type-3 injectisome. Philos. Trans. R. Soc. London. Ser. B Biol. Sci. 2012, 367, 1140–1154. [Google Scholar] [CrossRef]
- Journet, L.; Agrain, C.; Broz, P.; Cornelis, G.R. The needle length of bacterial injectisomes is determined by a molecular ruler. Science 2003, 302, 1757–1760. [Google Scholar] [CrossRef]
- Radics, J.; Konigsmaier, L.; Marlovits, T.C. Structure of a pathogenic type 3 secretion system in action. Nat. Struct. Mol. Biol. 2014, 21, 82–87. [Google Scholar] [CrossRef]
- Chatterjee, S.; Chaudhury, S.; McShan, A.C.; Kaur, K.; De Guzman, R.N. Structure and biophysics of type III secretion in bacteria. Biochemistry 2013, 52, 2508–2517. [Google Scholar] [CrossRef] [Green Version]
- Quinaud, M.; Chabert, J.; Faudry, E.; Neumann, E.; Lemaire, D.; Pastor, A.; Elsen, S.; Dessen, A.; Attree, I. The PscE-PscF-PscG complex controls type III secretion needle biogenesis in Pseudomonas aeruginosa. J. Biol. Chem. 2005, 280, 36293–36300. [Google Scholar] [CrossRef] [Green Version]
- Tomalka, A.G.; Stopford, C.M.; Lee, P.C.; Rietsch, A. A translocator-specific export signal establishes the translocator-effector secretion hierarchy that is important for type III secretion system function. Mol. Microbiol. 2012, 86, 1464–1481. [Google Scholar] [CrossRef]
- Galle, M.; Carpentier, I.; Beyaert, R. Structure and function of the Type III secretion system of Pseudomonas aeruginosa. Curr. Protein Pept. Sci. 2012, 13, 831–842. [Google Scholar] [CrossRef] [Green Version]
- Romano, F.B.; Tang, Y.; Rossi, K.C.; Monopoli, K.R.; Ross, J.L.; Heuck, A.P. Type 3 Secretion Translocators Spontaneously Assemble a Hexadecameric Transmembrane Complex. J. Biol. Chem. 2016, 291, 6304–6315. [Google Scholar] [CrossRef] [Green Version]
- Diaz, M.R.; King, J.M.; Yahr, T.L. Intrinsic and Extrinsic Regulation of Type III Secretion Gene Expression in Pseudomonas Aeruginosa. Front. Microbiol. 2011, 2, 89. [Google Scholar] [CrossRef] [Green Version]
- Brutinel, E.D.; Yahr, T.L. Control of gene expression by type III secretory activity. Curr. Opin. Microbiol. 2008, 11, 128–133. [Google Scholar] [CrossRef] [Green Version]
- Yahr, T.L.; Wolfgang, M.C. Transcriptional regulation of the Pseudomonas aeruginosa type III secretion system. Mol. Microbiol. 2006, 62, 631–640. [Google Scholar] [CrossRef]
- Rietsch, A.; Vallet-Gely, I.; Dove, S.L.; Mekalanos, J.J. ExsE, a secreted regulator of type III secretion genes in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 2005, 102, 8006–8011. [Google Scholar] [CrossRef]
- Wolfgang, M.C.; Lee, V.T.; Gilmore, M.E.; Lory, S. Coordinate regulation of bacterial virulence genes by a novel adenylate cyclase-dependent signaling pathway. Dev. Cell 2003, 4, 253–263. [Google Scholar] [CrossRef] [Green Version]
- Shen, D.K.; Filopon, D.; Chaker, H.; Boullanger, S.; Derouazi, M.; Polack, B.; Toussaint, B. High-cell-density regulation of the Pseudomonas aeruginosa type III secretion system: Implications for tryptophan catabolites. Microbiology 2008, 154 Pt 8 Pt 8, 2195–2208. [Google Scholar] [CrossRef] [Green Version]
- Dacheux, D.; Epaulard, O.; de Groot, A.; Guery, B.; Leberre, R.; Attree, I.; Polack, B.; Toussaint, B. Activation of the Pseudomonas aeruginosa type III secretion system requires an intact pyruvate dehydrogenase aceAB operon. Infect. Immun. 2002, 70, 3973–3977. [Google Scholar] [CrossRef] [Green Version]
- Rietsch, A.; Wolfgang, M.C.; Mekalanos, J.J. Effect of metabolic imbalance on expression of type III secretion genes in Pseudomonas aeruginosa. Infect. Immun. 2004, 72, 1383–1390. [Google Scholar] [CrossRef] [Green Version]
- Dong, Y.H.; Zhang, X.F.; Zhang, L.H. The global regulator Crc plays a multifaceted role in modulation of type III secretion system in Pseudomonas aeruginosa. Microbiologyopen 2013, 2, 161–172. [Google Scholar] [CrossRef]
- Yeung, A.T.; Bains, M.; Hancock, R.E. The Sensor Kinase CbrA Is a Global Regulator That Modulates Metabolism, Virulence, and Antibiotic Resistance in Pseudomonas aeruginosa. J. Bacteriol. 2011, 193, 918–931. [Google Scholar] [CrossRef] [Green Version]
- Ohgita, T.; Hayashi, N.; Hama, S.; Tsuchiya, H.; Gotoh, N.; Kogure, K. A novel effector secretion mechanism based on proton-motive force-dependent type III secretion apparatus rotation. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2013, 27, 2862–2872. [Google Scholar] [CrossRef]
- Ohgita, T.; Saito, H. Biophysical Mechanism of Protein Export by Bacterial Type III Secretion System. Chem. Pharm. Bull. 2019, 67, 341–344. [Google Scholar] [CrossRef] [Green Version]
- Urbanowski, M.L.; Brutinel, E.D.; Yahr, T.L. Translocation of ExsE into Chinese hamster ovary cells is required for transcriptional induction of the Pseudomonas aeruginosa type III secretion system. Infect. Immun. 2007, 75, 4432–4439. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sonnleitner, E.; Wulf, A.; Campagne, S.; Pei, X.Y.; Wolfinger, M.T.; Forlani, G.; Prindl, K.; Abdou, L.; Resch, A.; Allain, F.H. Interplay between the catabolite repression control protein Crc, Hfq and RNA in Hfq-dependent translational regulation in Pseudomonas aeruginosa. Nucleic Acids Res. 2018, 46, 1470–1485. [Google Scholar] [CrossRef] [Green Version]
- Pusic, P.; Sonnleitner, E.; Krennmayr, B.; Heitzinger, D.A.; Wolfinger, M.T.; Resch, A.; Blasi, U. Harnessing Metabolic Regulation to Increase Hfq-Dependent Antibiotic Susceptibility in Pseudomonas aeruginosa. Front. Microbiol. 2018, 9, 2709. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rohmer, L.; Hocquet, D.; Miller, S.I. Are pathogenic bacteria just looking for food? Metabolism and microbial pathogenesis. Trends Microbiol. 2011, 19, 341–348. [Google Scholar] [CrossRef] [Green Version]
- Martinez, J.L. Bacterial pathogens: From natural ecosystems to human hosts. Environ. Microbiol. 2013, 15, 325–333. [Google Scholar] [CrossRef]
- Peyraud, R.; Cottret, L.; Marmiesse, L.; Genin, S. Control of primary metabolism by a virulence regulatory network promotes robustness in a plant pathogen. Nat. Commun. 2018, 9, 418. [Google Scholar] [CrossRef] [Green Version]
- Levin, B.R.; Antia, R. Why we don’t get sick: The within-host population dynamics of bacterial infections. Science 2001, 292, 1112–1115. [Google Scholar] [CrossRef]
- Corona, F.; Reales-Calderón, J.A.; Gil, C.; Martínez, J.L. The development of a new parameter for tracking post-transcriptional regulation allows the detailed map of the Pseudomonas aeruginosa Crc regulon. Sci. Rep. 2018, 8, 16793. [Google Scholar] [CrossRef] [Green Version]
- Linares, J.F.; Lopez, J.A.; Camafeita, E.; Albar, J.P.; Rojo, F.; Martinez, J.L. Overexpression of the multidrug efflux pumps MexCD-OprJ and MexEF-OprN is associated with a reduction of type III secretion in Pseudomonas aeruginosa. J. Bacteriol. 2005, 187, 1384–1391. [Google Scholar] [CrossRef] [Green Version]
- Sonnleitner, E.; Prindl, K.; Bläsi, U. The Pseudomonas aeruginosa CrcZ RNA interferes with Hfq-mediated riboregulation. PLoS ONE 2017, 12, e0180887. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moreno, R.; Hernández-Arranz, S.; La Rosa, R.; Yuste, L.; Madhushani, A.; Shingler, V.; Rojo, F. The Crc and Hfq proteins of Pseudomonas putida cooperate in catabolite repression and formation of ribonucleic acid complexes with specific target motifs. Environ. Microbiol. 2015, 17, 105–118. [Google Scholar] [CrossRef]
- Paulsen, I.T.; Brown, M.H.; Skurray, R.A. Proton-dependent multidrug efflux systems. Microbiol. Rev. 1996, 60, 575–608. [Google Scholar] [CrossRef]
- Schweizer, H.P. Efflux as a mechanism of resistance to antimicrobials in Pseudomonas aeruginosa and related bacteria: Unanswered questions. Genet. Mol. Res. 2003, 2, 48–62. [Google Scholar] [PubMed]
- Baquero, F.; Martinez, J.L. Interventions on Metabolism: Making Antibiotic-Susceptible Bacteria. MBio 2017, 8, 10–1128. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hoang, T.T.; Karkhoff-Schweizer, R.R.; Kutchma, A.J.; Schweizer, H.P. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: Application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 1998, 212, 77–86. [Google Scholar] [CrossRef]
- Sambrook, J.; Russell, D.W. Molecular Cloning. A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 2001. [Google Scholar]
- de Lorenzo, V.; Timmis, K.N. Analysis and construction of stable phenotypes in gram-negative bacteria with Tn5- and Tn10-derived minitransposons. Methods Enzymol. 1994, 235, 386–405. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Hritonenko, V.; Metruccio, M.; Evans, D.; Fleiszig, S. Epithelial cell lysates induce ExoS expression and secretion by Pseudomonas aeruginosa. FEMS Microbiol. Lett. 2018, 365, fny053. [Google Scholar] [CrossRef]
- Shen, D.K.; Filopon, D.; Kuhn, L.; Polack, B.; Toussaint, B. PsrA is a positive transcriptional regulator of the type III secretion system in Pseudomonas aeruginosa. Infect. Immun. 2006, 74, 1121–1129. [Google Scholar] [CrossRef] [Green Version]
- MacLean, B.; Tomazela, D.M.; Shulman, N.; Chambers, M.; Finney, G.L.; Frewen, B.; Kern, R.; Tabb, D.L.; Liebler, D.C.; MacCoss, M.J. Skyline: An open source document editor for creating and analyzing targeted proteomics experiments. Bioinformatics 2010, 26, 966–968. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Oligonucleotide | Sequence | Utilization |
---|---|---|
rplU-fw | CGCAGTGATTGTTACCGGTG | Check DNA contamination in RNA samples |
rplU-rv | AGGCCTGAATGCCGGTGATC | |
RT-rpoN-fw | GCAGAAATACATGCATACG | Internal control gene for RT-PCR |
RT-rpoN-rv | TGTGCCTCCAGTAAACCAG | |
RT-exsA-fw | TCAAGGGGTTGAAGGAATTG | RT-PCR for exsA |
RT-exsA-rv | TCCATGAATAGCTGCAGACG | |
RT-exsC-fw | GTCACCCTGTTGCTGCTC | RT-PCR for exsC |
RT-exsC-rv | ATCTGCGCATACAACTGGAC | |
RT-exsD-fw | AACTGTTCCGCTGCGAGT | RT-PCR for exsD |
RT-exsD-rv | TTTCCCACCAGCCATAGAC | |
RT-exsE-fw | AATCGATTTCGCCGGTGC | RT-PCR for exsE |
RT-exsE-rv | GATCGCCAGCCACGTT | |
RT-pscF-fw | CGCAGATATTCAACCCCAAC | RT-PCR for pscF |
RT-pscF-rv | ATCTTCTGCAGGATGCCTTG | |
RT-exoS-fw | AGAGAGCGAGGTCAGCAGAG | RT-PCR for exoS |
RT-exoS-rv | ATGCCGGTGTAGAGACCAAG | |
HindIII-hfq-ups-fw | AAGCTTCGATGCGCTGCCCTGCGAGC | Amplification of the DNA flanking region upstream of hfq |
hfq-ups-rv | GCGGACTCCCGTCAAGCGTTGCTTTTGACATGTGCCGCACT | |
hfq-down-fw | AGTGCGGCACATGTCAAAAGCAACGCTTGACGGGAGTCCGC | Amplification of the DNA flanking region downstream of hfq |
HindIII-hfq-down-rv | AAGCTTTGTGCGGCTCGACCGAGGGT | |
pVLT35-fw | GCGGATAACAATTTCACACAGGA | Check complementation of Δcrc |
pVLT35-rv | CTCATCCGCCAAAACAGCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gil-Gil, T.; Cuesta, T.; Hernando-Amado, S.; Reales-Calderón, J.A.; Corona, F.; Linares, J.F.; Martínez, J.L. Virulence and Metabolism Crosstalk: Impaired Activity of the Type Three Secretion System (T3SS) in a Pseudomonas aeruginosa Crc-Defective Mutant. Int. J. Mol. Sci. 2023, 24, 12304. https://doi.org/10.3390/ijms241512304
Gil-Gil T, Cuesta T, Hernando-Amado S, Reales-Calderón JA, Corona F, Linares JF, Martínez JL. Virulence and Metabolism Crosstalk: Impaired Activity of the Type Three Secretion System (T3SS) in a Pseudomonas aeruginosa Crc-Defective Mutant. International Journal of Molecular Sciences. 2023; 24(15):12304. https://doi.org/10.3390/ijms241512304
Chicago/Turabian StyleGil-Gil, Teresa, Trinidad Cuesta, Sara Hernando-Amado, Jose Antonio Reales-Calderón, Fernando Corona, Juan F. Linares, and José L. Martínez. 2023. "Virulence and Metabolism Crosstalk: Impaired Activity of the Type Three Secretion System (T3SS) in a Pseudomonas aeruginosa Crc-Defective Mutant" International Journal of Molecular Sciences 24, no. 15: 12304. https://doi.org/10.3390/ijms241512304