1. Introduction
Plants are the source of many substances with therapeutic potential. Increasingly, we are returning to natural medicine in search of alternatives for the treatment of various diseases [
1]. Plant medicine is very popular for the treatment of minor ailments in societies with difficult access to medical help.
Kalanchoe daigremontiana Raym.-Hamet and H. Perrier, also named “mother of thousands”, is a succulent originating from Madagascar [
2]. This plant is widely distributed in North and South America, growing up to about one meter. Because of its rapid and easy spread, it is classified as an invasive species. The cultivation and research of kalanchoe is becoming increasingly popular due to its broad bioactivities. Antitumor, antimicrobial, and anti-inflammatory properties of
K. daigremontiana extracts in the treatment of gastric diseases, but also in disorders of the nervous system, such as anxiety and restlessness, have been described in the literature. The biological properties of
Kalanchoe species extracts are determined by the presence of numerous compounds, such as polyphenols and bufadienolides [
3]. The plant is also rich in phenolic acids such as gallic, chlorogenic, ferulic, caffeic, and p-coumaric acids (
Figure 1). The content of compounds in the extracts depends on the cultivation conditions and the extraction method [
3]. The antiviral properties of
K. daigremontiana extracts have not been extensively studied. So far, only
Kalanchoe pinniata extracts and their components have been proven to show antiviral properties [
2,
4].
Plant polyphenols are naturally occurring phytochemicals with different structures and properties that protect plants from infections, environmental stresses, etc. Their ability to inhibit viral infections is exhibited by their direct interaction with viral particles or by their inhibition of excessive oxidative stress caused by some viruses [
5,
6]. The antiviral activity of both flavonoid and non-flavonoid polyphenols against HHV-1 and HHV-2 (human herpes virus type 1 and 2; herpes simplex virus type 1 and 2) has been described. The flavonoids exerting anti-HHV activity include quercetin, kaempferol, luteolin, myrecitin, epicatechin, epigallocatechin, and genistein [
6,
7,
8,
9,
10]. Non-flavonoid polyphenols with proven antiviral activity in HHV infections belong to phenolic acids (ginkgolic acid, ellagic acid, trans-ferulic acid, gentisic acid, vanillic acid, syringic acid, and gallic acid), tannins and their derivatives (tannic acid, punicalagin, pentagalloylglucose), stilbenes (resveratrol), xanthones (mangiferin), curcuminoids (curcumin), coumarins, and furanocoumarins [
7,
8,
9,
10].
The World Health Organization (WHO) estimates that over 4 billion people are infected with HHV-1 (3.7 billion cases) and HHV-2 (400 million cases) [
11]. Infection caused by HHV is lifelong, due to its ability to establish a state of latency in nerve cell bodies. Reactivation of the infection usually occurs several times a year in situations of immunosuppression or stress. Herpesvirus infection is commonly associated with cold sores, genital ulceration, encephalitis, and corneal blindness [
11]. Mortality rates of HHV encephalitis are between 5 and 20%, depending on the immune status, treatment used, age, and co-morbidities [
11]. Moreover, the inflammatory changes in the CNS caused by herpes simplex encephalitis may lead to development of autoimmune encephalitis (AE) within 3 months of HHV encephalitis in up to 27% of cases [
12]. Available antiviral therapies, such as acyclovir, penciclovir, famciclovir, cidofovir, valacyclovir, trifluridine, and vidarabine are based on the inhibition of viral polymerase. Given the increasing resistance of HHV strains to nucleoside analogs, there is a need to search for substances based on other mechanisms of action [
13]. However, there are no effective drugs that inhibit the spread of the virus to neighboring cells. In addition, there is still no drug proposed to destroy the virus in its latent state. There are also no effective vaccines available, despite several expression models proposed. Due to the increasing resistance of the strains to available therapies and the lack of effective vaccines, there is a need to search for new substances with antiviral potential, which would also stimulate the immune system to fight the infection. The following work demonstrates the virucidal effect under in vitro conditions using a plant extract derived from
K. daigremontiana. We believe that the active substances that are components of the extracts or the extracts from
K. daigremontiana themselves can be used in the treatment of the human herpesvirus type 1 infection.
3. Discussion
The genus
Kalanchoe includes plants belonging to the
Crassulaceae family, mainly succulents living in Madagascar, Africa, Asia, and South America. In Madagascar, they occur as endemics, and are characterized by different CAM-type photosyntheses: Crassulacean acid metabolism, which is an adaptation to arid ecosystems [
17,
18]. Natural substances contained in plants constitute an important group of compounds with antiviral properties, including anti-herpesviral activity. Many compounds such as phenols, glycosides, alkaloids, saponins, steroids, and tannins that affect HHV-1 replication have been described in the literature [
9,
10].
Extracts from plants belonging to the genus
Kalanchoe are rich in numerous compounds including bufadienolides, bioactive flavonoids, and phenolic compounds. In addition, the presence of kaempferol 3-p-coumaroylarabinoside, named bryophylloside, is characteristic of
K. daigremontiana extract [
5,
19,
20,
21]. The antiviral activity of kaempferol and its derivatives was shown for SARS-CoV-2 [
22]. Interestingly, kaempferol inhibited SARS-CoV-2 invasion both in vitro and in vivo, mainly by binding to the SARS-CoV-2 S2 subunits and inhibiting viral fusion [
22]. Furthermore, kaempferol-3-O-rhamnoside was shown to reduce both in vitro and in vivo infection; inhibition of HHV-1 induced brain injury was achieved by a reduction in microglial pro-inflammatory factors [
23]. Apigenin isolated from
Ocimum basilicum (OB), has shown similar virucidal activity for HHV-1 and HHV-2. Moreover, apigenin has also proven to be effective against ACV-resistant strains of HHV [
24]. Quercetin is the most abundant dietary flavonoid, also present in
Kalanchoe extract, and it has been shown to inhibit transcription and translation of viral proteins [
6,
9,
10]. Lee et al. [
25] demonstrated that the anti-HHV-1 effects of quercetin are related to the suppression of TLR-3-dependent inflammatory responses in Raw 264.7 monocytes through the inhibition of inflammatory transcriptional factors (NF-κB and IRF3) [
26]. Gallic acid is the simplest phenolic acid, which may form esters with other flavonoids, but it also makes up the basis of hydrolysable tannins [
6,
7,
8]. The antiviral activity of gallic acid and its esters was demonstrated to be related with virus attachment and penetration in classical plaque assays with HHV-1 [
27]. The
K. daigremontiana extract studied also contained the bufiandiols bryophyllin A and bersaldegenin-3-acetate, which showed an inhibitory effect on Epstein–Barr virus early antigen (EBV-EA) activation in Raji cells induced by the tumor promoter, 12-O-tetradecanoylphorbol-13-acetate. Bryophyllin A proved to be the most effective. The results also suggest the possibility of using
K. diagremontaiana extract for other herpesviruses, belonging to a different family [
28].
This study demonstrates anti-HHV-1 activity of water extract from
K. daigremontiana in the in vitro infection of epithelial cells (Vero and HaCaT cell lines).
K. diagremontiana extract inhibits different stages of HHV-1 infection, such as attachment and penetration, but also cell-to-cell infection (
Figure 5,
Figure 6,
Figure 7,
Figure 8,
Figure 9,
Figure 10 and
Figure 11). Furthermore, we showed that the extract at selected concentrations reduces virus entry into the Vero 76 and HaCat cell lines. The antiviral activity of the polyphenols contained in plants depends on the chemical structure of the virus. The presence of phenolic groups, which exhibit antioxidant properties can have an inhibitory effect on the replication of viruses in host cells [
29]. In addition, some polyphenols can block the structural domains of the receptors, making virus adsorption to the cell impossible. Our results demonstrated that
K. daigremontiana water extract has the ability to prevent HHV-1 infection by direct inhibition of virus attachment, penetration, and blocking of infection when used pretreatment or post-treatment (
Figure 5,
Figure 6,
Figure 7,
Figure 8,
Figure 9,
Figure 10 and
Figure 11). In the literature data, only one report is present in which the effect of compounds from
K. daigremontiana extract against HHV-1 and HHV-2 were investigated. The authors of the study isolated individual fractions of the extract and tested the effects of the isolated flavonoids individually. The anti-herpesvirus activity was confirmed for two main flavonoids: kaempferol 3-O-β-d-xylopyranosyl-(1→2)-α-l-rhamnopyranoside and quercetin 3-O-β-d-xylopyranosyl-(1→2)-α-l-rhamnopyranoside [
21]. However, these studies did not examine to what extent the components affect the replication cycle of the virus, whether they inhibit its entry (attachment, penetration, and pretreatment test) or the release of progeny virions (post-treatment). This appears to be crucial in assessing the usefulness of the tested compounds. The isolated compounds, or the entire extract, should be capable of mimicry, blocking host cell receptors or virus surface proteins to maintain entry into the cell. It is also useful to look for chemical groups in the structure of these compounds that may bind to the cell or virus surface to inhibit adsorption into the cell. Moreover, it seems to be more effective to use complete or fractionated extracts, so that we can have the synergistic and complementary effects of many antiviral compounds. It is worth noting that in the paper by Ürményi et al. [
21],
K. daigremontiana extract was subjected to flavonoid extraction, leading to isolation of two flavonoids, which showed an about ten times lower selectivity index compared to the extract. The SI in our study showed a similar value but differed depending on the tested cell line. Also, Sochocka et al. showed that
Ginko biloba extract exhibits better anti-herpesvirus activity, compared to single polyphenols, such as quercetin and kaempferol [
30].
Our data demonstrate that
K. diagremontiana extract is a potent inhibitor of HHV-1 replication in keratinocytes and epithelial cells, which serve as the first line of defense during skin infections. However, the extract was much more effective for epithelial Vero cells than for HaCaT keratinocytes, and this effect correlates with the higher toxicity observed in HaCaT cells (the SI for the Vero 76 cell line reached higher values, compared to that of the HaCat cell line,
Table 2). The toxicity of the extract may be based on the presence of volatile compounds, thus prompting us to employ further purification to obtain the extract of the flavonoids themselves.
Its inhibition of HHV-1 infection was similar to that of ACV, the most frequently chosen antiviral drug for humans. However, one must remember that the extract and ACV act at different stages of virus replication. ACV is an inhibitor of HHV-1 DNA replication, while for the extract, experiments showed inhibition of HHV-1 replication both during virus entry into the cells (pretreatment test) and during the release of progeny virions (post-treatment). It is worth mentioning that many studies indicate that
Kalanchoe extract, in addition to its antiviral effects, exhibits anti-inflammatory and immunomodulatory effects, so we can influence the host’s antiviral response in a more complex manner [
2]. More literature data are available on the anti-herpesviral properties of
Kalanchoe pinnata extract. So far, the antiviral activity of the extract or its components against HHV-1, HHV-1, HCV, and EBV has been proven. Crayer et al. investigated the efficacy of two components contained in
Kalanchoe pinnata extract against HHV-1, HHV-2, and Vaccinia virus. Both components, KB-100 and KB-200, showed activity against alphaherpesviruses and Vaccinia virus, but the KB-100 compound showed a stronger effect [
4].
Our study also shows that the use of K. daigremontiana extract in combination with acyclovir significantly inhibits viral replication in both HaCat and Vero 76 cell cultures. Both pre-infection administration of the combination therapy and treatment of the infection were so effective that the level of viral replication did not exceed 10 copies/ng DNA.
Additional findings indicated that the K. daigremontiana extract acts as a post-entry inhibitor, likely affecting the stage between viral entry and replication of viral genomic DNA. During the HHV-1 life cycle, immediate early (IE), early (E), and late (L) genes are expressed once the viral DNA has entered the nucleus. The expression of IE genes is required for the transcription and subsequent expression of viral E and L genes, which play a critical role in the overall viral replication process. The study showed that K. daigremontiana extract reduced the expression of the ICP0 and ICP27 genes. These findings suggest that K. daigremontiana extract suppresses the expression of HHV IE genes by interfering with the expression of HHV-1 E and L genes, including glycoprotein B, which is critical for viral entry into cells. When the plant extract was administered prior to infection, it demonstrated a protective effect by reducing viral replication and inhibiting the expression of early and immediate early genes. A particularly strong therapeutic effect was observed in the HaCat cell line. Our hypothesis that the extract interferes with the processes between virus entry and exit from the cell is also supported by a study in which we used culture medium from over-infected cells treated with the extract in a pre-treatment assay to perform classical PFU in new cells.
In addition, many studies indicate that
K. daigremontiana extract or its individual components, such as quercetin, for example, influence the immune system. Studies have shown an enhanced antiparasitic immune response, using both in vitro and in vivo models. The anti-leishmanial, anti-inflammatory, anti-nociceptive, anti-edematogenic, wound-healing, and gastroprotective effects of flavonoids from
Kalanchoe genus extract were demonstrated in mice and rats [
31,
32].
The presented results indicate the antiviral potential of the K. diagremontiana water extract, which opens future possibilities to test it in other viral models, as well as using in vivo model.
4. Materials and Methods
4.1. Plant Materials and Extraction
The extract was produced on an industrial scale in greenhouse conditions to protect plants from harmful environmental influences. The plants were not subjected to any chemical treatments that could have a detrimental effect on the extract and, thus, on human health. Direct exposure of leaves to the sun during cultivation was avoided in order to maintain their chlorophyll content. Sunlight was moderate and the temperature in the greenhouse did not fall below 15 °C, as K. daigremontiana is sensitive to low temperatures. The above-ground parts of K. daigremontiana were cut down and shredded, then placed in a tank extractor and subjected to a solvent extraction process with water. Undesired components of the original mixture were removed in a separate process. Name according to INCI: Aqua, K. daigremontiana Extract, Sodium Benzoate, Potassium Sorbate Ratio of herbal raw material to extract 4:1. The extract was preserved with a mixture of sodium benzoate (0.3%) and potassium sorbate (0.15%).
4.2. UHPLC-DAD-MS Analysis
The analysis was conducted via UHPLC, utilizing the Ultimate 3000 series system (Dionex, Idstein, Germany), featuring a dual low-pressure gradient pump with a vacuum degasser, an autosampler, a column compartment, and a diode array detector coupled with an Amazon SL ion trap mass spectrometer (Bruker Daltonik GmbH, Bremen, Germany). Compound separation within the analyzed extracts was obtained on a Kinetex XB-C18 analytical column (150 mm × 2.1 mm × 1.9 μm) by Phenomenex (Torrance, CA, USA), with the column temperature maintained at 25 °C. Elution was performed using mobile phase A (0.1% formic acid in deionized water) and mobile phase B (0.1% formic acid in acetonitrile) via a multi-step gradient: starting at 1% B for 0 min, increasing to 30% B over 60 min, reaching 95% B at 90 min. The flow rate was set to 0.300 mL/min with 5 μL of the sample injected by the autosampler onto the column. Equilibration of the column was maintained for 10 min between injections. UV-vis spectra were recorded within the range of 200–450 nm, with chromatograms acquired at 280 and 350 nm. The eluate was directly introduced into the mass spectrometer without splitting. The ion trap Amazon SL mass spectrometer was equipped with an ESI interface, with the following parameters: nebulizer pressure of 38 psi, dry gas flow of 6.8 L/min, dry temperature of 134 °C, and capillary voltage of 4.5 kV. Analysis was conducted via scan from m/z 70–2200, with both compounds analyzed in negative ion mode. MS2 fragmentation was performed using Smart Frag mode. Detected compounds were identified based on UV-Vis and MS spectra in respect to existing literature reporting the chemical composition of Kalanchoe species and other closely related plants belonging to the Crassulaceae family. Elution order on reversed phase column was taken into account.
4.3. Cell Lines and Virus Strains
Human HaCaT keratinocytes were obtained from CLS Cell Lines Service GmbH (Eppelheim, Germany), while Vero 76 (CRL-1587) cells were purchased from ATCC (Washington, DC, USA). Both cell lines were cultured in Dulbecco’s modified MEM (DMEM) supplemented with 10% fetal calf serum, 10 U/mL of penicillin, and 100 μg/mL of streptomycin (Gibco by Thermo Fisher Scientific, Carlsbad, CA, USA). The cells were seeded into 24 well plates at a density of 1 × 10
4/mL cells and cultured for 24 h before exposure to virus/extract, as described previously [
12,
13]. The McIntyre strain of HHV-1 was grown and titrated in Vero 76 cell cultures. The virus stocks (approximately 10
8 PFU/mL) were stored at −80 °C. The multiplicity of infection (MOI) used in all experiments was 1.
4.4. Cytotoxicity Assay
A cell proliferation reagent WST-1 (stable tetrazolium salt) assay was used to estimate the viability of the HaCaT and Vero 76 cell lines after treating the cells with K. daigremontiana water extract. The HaCaT and Vero 76 cells were seeded in 96-well plates at a density of 5 × 103 cells/well and treated for 24 h with the K. daigremontiana water extract (dilutions of 0.0001–1 g/mL). After treatment, the cells were incubated with WST-1 (10 μL/well, Sigma Aldrich, Burlington, MA, USA) for 3 h. The absorbance (570 nm) of the solution was measured in the plate reader (Omega Microplate Spectrophotometer BioTek Instruments, Inc., Winooski, VT, USA). The results (±standard error mean (SEM)) were obtained from six repeats in three independent experiments. All the data were analyzed in GraphPad Prism version 9.5.0.
4.5. Plaque Assay
Vero cells were maintained in a DMEM complete medium in 24-well plates until they reached full confluence (approximately 105 cells per well). To evaluate the antiviral activity of K. daigremontiana extract, both the extract and HHV-1 (105 PFU/mL) were incubated for 60 min at various extract concentrations. This mixture was then applied to the Vero cells and incubated for 60 min at 37 °C. Following this, the cultures were rinsed with cold PBS, and 2% methylcellulose in a complete culture medium was added to prevent viral spread through the culture medium. After 48 h, the plates were washed, stained with 1% crystal violet, and the plaques were counted. The same procedure was conducted with the cell culture medium from the cells infected and treated with K. daigremontiana extracts. The results were expressed as a percentage of plaque reduction inhibition, calculated using the following equation: 100 × [1 − (number of plaques with treatment/number of plaques without treatment)].
4.6. Antiviral Test
HaCaT and Vero 76 cells were cultured in 24-well plates. To analyze how
K. daigremontiana extract can influence viral attachment cells were pre-chilled at 4 °C for 15 min, then co-treated with
K. daigremontiana extract and HHV-1 for 1 h at 4 °C. Next, inoculum was removed, and cell monolayers were washed with ice-cold PBS and further incubated at 37 °C. At 24 h post-infection, virus titers were determined by qPCR as described previously [
12,
13]. The viral penetration assay started by pre-chilling the cells at 4 °C for 15 min, and then the cells were infected for 1 h at 4 °C to allow virus binding but not entry. The inoculum was removed, and cells were washed with ice-cold PBS before adding
K. diagremontiana extract for 2 h at 37 °C. The extract was afterwards removed, and cells were washed twice with cold PBS. After another 18 h at 37 °C, virus titers were determined by qPCR. To examine the post-entry treatment effects of
K. daigremontiana extract use, cells were infected at 37 °C, then the virus was removed, cells washed, and extract were added 3 h post-infection (p.i.). At 24 h post-infection, the infected cultures were analyzed by qPCR. Pre-treatment was performed by incubating cells with
K. daigremontiana extract (at 37 °C) for 3 h. Then, the cells were washed, infected, and further titered by qPCR. The positive control for all experiments was the reference drug acyclovir (ACV, 4 µg/mL). In the combination therapy, we treated the cell lines with both the plant extract and ACV (pretreatment, treatment, and preincubation acyclovir with
K. daigremontian extract and HHV-1 were incubated for one hour and then added to the cell culture). The negative control consisted of uninfected cells.
4.7. Real-Time PCR (qPCR)
For detection and quantification of HHV-1 DNA, a real-time PCR assay with a fluorescent TaqMan probe was used. DNA isolation was performed using a High Pure Viral Nucleic Acid Kit
® (Roche Diagnostics, San Jose, CA, USA), according to the manufacturer’s protocol. PCR was run on the LightCycler 480 instrument (Roche Diagnostics) with the modified in-house method described below [
14]. A conservative region of HSV-1 genome encoding the viral glycoprotein B (gB) gene was chosen (GenBank: AB 297670), and a set of primers, as well as a probe labeled with the fluorophore reporter JOE on its 5′-end and with a BHQ-1 quencher on its 3′-end (Oligo
®), were developed. Reaction was performed using TaqMan Master Kit
® (Roche Diagnostics). Final reaction mixture contained 5 µL of isolated viral DNA, 3.25 µmol/L of HSV1_A primer [5′-ATC CAC ACC TTA TCG TTT TTG T-3′], 3.25 µmol/L of HSV1_B primer [5′-CGT AAC GCA CGC TAG GGT-3′], and 1.50 µmol/L of HSV1_JOE probe [5′-JOE—GGC GGT TGG TCC AGA CGC–BHQ1-3′], in a total volume of 20 µL. Fluorescence levels were detected at 560 nm wavelength, specific for JOE fluorophore dye.
RNA extracted from cells was transcribed into cDNA utilizing GoScript™ Reverse Transcriptase (Promega). qPCR assays for viral genes were performed using GoTaq® Probe qPCR Master Mix (Promega) and specific primers as follows: gB_F: 5′TCTGCACCATGACCAAGTG3′; gB_R: 5′TGGTGAAGGTGGTGGATATG3′; ICP0_F: 5′GGTCCCCACTGACTCATACG3′; ICP0_R: 5′ATCCCGACCCCTCTTCTTC3′; ICP27_F: 5′TTCTCCAGTGCTACCTGAACC3′; ICP27_R: 5′TCAACTCGCAGACACGACTCG3′; GAPDH_F: 5′TGCACCACCAACTGCTTAGC3′;GAPDH_R: ′GGCATGGACTGTGGTCATGAG3′.
The procedures were conducted according to the manufacturer’s guidelines using the QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific). The data were analyzed using the 2−∆∆Ct method for quantifying relative gene expression.
4.8. High-Content Screening Assay (HCS)
The human keratinocytes cells were seeded in 96-well plates (at a density of 5 × 103 cells/well), and treated with the water extract of K. daigremontiana at concentrations of 0.0001–1 mg/mL and infected with HHV-1. At 24 p.i., cells were fixed in 3.7% paraformaldehyde in PBS (Sigma-Aldrich) for 15 min in room temperature (RT). Next, the cells were permeabilized with 0.5% Triton X-100 (Sigma-Aldrich) in PBS (15 min in RT) and blocked with 1.5% bovine serum albumin (BSA, Sigma-Aldrich) in 0.1% Triton X-100 PBS solution (30 min) to prevent nonspecific binding. The presence of viral antigens was determined by direct IF, using FITC-conjugated Polyclonal Rabbit Anti-Herpes Simplex Virus 1 serum (Dako, dilution 1:200). Cell nuclei were stained with Hoechst 33258 (Sigma-Aldrich Chemicals Co., 2 µg/mL) in PBS. Non-infected cells were used as negative control and acyclovir-treated HHV-1-infected cells served as positive control. The fluorescent signals were detected and analyzed via high-content screening (Array Scan XTI, Thermo Fisher) at 10× magnification. The percentage of the infected cells in each well was automatically obtained from 9 images per well (8 wells per concentration) using HCS studio software version 2.0 using Spot detector protocols.
4.9. Statistical Evaluation
The results were statistically evaluated by one-way analysis of variation (ANOVA) followed by &Tukey’s multiple comparison test with GraphPad Prism™ version 9 software (GraphPad Software Inc., San Diego, CA, USA). Statistical differences were interpreted as significant at p ≤ 0.05 *, highly significant at p ≤ 0.01 **, and extremely significant at p ≤ 0.001 *** or p ≤ 0.0001 ****.