Exploring Senolytic and Senomorphic Properties of Medicinal Plants for Anti-Aging Therapies
Abstract
:1. Introduction
2. Results
2.1. Definition of Reagents
2.1.1. Herbal Extracts and Solvents
2.1.2. Cell Lines and Establishment of the Senescent State
2.2. Toxicology of Herbal Extracts
2.3. Chronic Extract Treatment Cell Line 1
2.3.1. IL-6 Secretion (SASP Formation)
2.3.2. Cell Confluence and Morphology
2.3.3. qPCR Investigations of SASP-Related mRNA Expression
2.3.4. Cell Line 1 Receptors
2.3.5. Senescence-Related Genes (CL1)
2.4. Early and Late Treatment with Herbal Extracts
3. Discussion
4. Materials and Methods
4.1. Cells
4.1.1. Toxicity Testing and SA-β-Gal Assay
4.1.2. Main Experiment Chronic Extract Treatment for IL-6 ELISA and qPCR Investigations
4.2. Preparation of Extracts (Used Dilutions Can Be Found in Table 2)
Chamomile | Green Tea | Goldenrod | Reishi |
---|---|---|---|
1:1 means 3.8 mg/mL | 1:1 means 3.8 mg/mL | 1:1 means 1.875 mg/mL | 1:1 means 1.875 mg/mL |
1:3 means 1.2666 mg/mL | 1:3 means 1.2666 mg/mL | 1:3 means 0.6250 mg/mL | 1:3 means 0.6250 mg/mL |
1:9 means 0.4222 mg/mL | 1:9 means 0.4222 mg/mL | 1:9 means 0.2083 mg/mL | 1:9 means 0.2083 mg/mL |
1:18 means 0.2111 mg/mL | 1:27 means 0.1407 mg/mL | 1:18 means 0.1042 mg/mL | 1:27 means 0.0694 mg/mL |
1:27 means 0.1407 mg/mL | 1:54 means 0.0704 mg/mL | 1:27 means 0.0694 mg/mL | 1:81 means 0.0231 mg/mL |
1:81 means 0.0469 mg/mL | 1:81 means 0.0469 mg/mL | 1:81 means 0.0231 mg/mL |
4.3. DPPH Assays
4.4. Folin–Ciocâlteu Assay
4.5. XTT (2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide) Assay
4.6. Senescence-Associated β Galactosidase (SA-β-Gal) Assay
4.7. IL-6 ELISA
4.8. Presto Blue Assay
4.9. RNA Extraction, cDNA Synthesis, and qPCR
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp. Cell Res. 1965, 37, 614–636. [Google Scholar] [CrossRef] [PubMed]
- Hayflick, L.; Moorhead, P.S. The Serial Cultivation of Human Diploid Cell Strains. Exp. Cell Res. 1961, 25, 585–621. [Google Scholar] [CrossRef]
- Campisi, J.; d’Adda di Fagagna, F. Cellular Senescence: When Bad Things Happen to Good Cells. Nat. Rev. Mol. Cell Biol. 2007, 8, 729–740. [Google Scholar] [CrossRef] [PubMed]
- Sharpless, N.E.; Sherr, C.J. Forging a Signature of in Vivo Senescence. Nat. Rev. Cancer 2015, 15, 397–408. [Google Scholar] [CrossRef] [PubMed]
- Campisi, J. Aging, Cellular Senescence, and Cancer. Annu. Rev. Physiol. 2013, 75, 685–705. [Google Scholar] [CrossRef]
- Short, S.; Fielder, E.; Miwa, S.; Zglinicki, T. Senolytics and Senostatics as Adjuvant Tumour Therapy. EBioMedicine 2019, 41, 683–692. [Google Scholar] [CrossRef]
- Muñoz-Espín, D.; Serrano, M. Cellular Senescence: From Physiology to Pathology. Nat. Rev. Mol. Cell Biol. 2014, 15, 482–496. [Google Scholar] [CrossRef]
- Childs, B.G.; Baker, D.J.; Kirkland, J.L.; Campisi, J.; van Deursen, J.M. Senescence and Apoptosis: Dueling or Complementary Cell Fates? EMBO Rep. 2014, 15, 1139–1153. [Google Scholar] [CrossRef]
- Yosef, R.; Pilpel, N.; Tokarsky-Amiel, R.; Biran, A.; Ovadya, Y.; Cohen, S.; Vadai, E.; Dassa, L.; Shahar, E.; Condiotti, R.; et al. Directed Elimination of Senescent Cells by Inhibition of BCL-W and BCL-XL. Nat. Commun. 2016, 7, 11190. [Google Scholar] [CrossRef]
- Baker, D.J.; Wijshake, T.; Tchkonia, T.; LeBrasseur, N.K.; Childs, B.G.; van de Sluis, B.; Kirkland, J.L.; van Deursen, J.M. Clearance of P16Ink4apositive Senescent Cells Delays Ageingassociated Disorders. Nature 2011, 479, 232. [Google Scholar] [CrossRef]
- Baker, D.J.; Childs, B.G.; Durik, M.; Wijers, M.E.; Sieben, C.J.; Zhong, J.; Saltness, R.A.; Jeganathan, K.B.; Verzosa, G.C.; Pezeshki, A.; et al. Naturally Occurring P16Ink4a-Positive Cells Shorten Healthy Lifespan. Nature 2016, 530, 184–189. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.; Tchkonia, T.; Pirtskhalava, T.; Gower, A.C.; Ding, H.; Giorgadze, N.; Palmer, A.K.; Ikeno, Y.; Hubbard, G.B.; Lenburg, M.; et al. The Achilles’ Heel of Senescent Cells: From Transcriptome to Senolytic Drugs. Aging Cell 2015, 14, 644–658. [Google Scholar] [CrossRef]
- Kirkland, J.L.; Tchkonia, T. Cellular Senescence: A Translational Perspective. EBioMedicine 2017, 21, 21–28. [Google Scholar] [CrossRef]
- Jeon, O.H.; Kim, C.; Laberge, R.M.; Demaria, M.; Rathod, S.; Vasserot, A.P.; Chung, J.W.; Kim, D.H.; Poon, Y.; David, N.; et al. Local Clearance of Senescent Cells Attenuates the Development of Post-Traumatic Osteoarthritis and Creates a pro-Regenerative Environment. Nat. Med. 2017, 23, 775–781. [Google Scholar] [CrossRef]
- Xu, M.; Pirtskhalava, T.; Farr, J.N.; Weigand, B.M.; Palmer, A.K.; Weivoda, M.M.; Inman, C.L.; Ogrodnik, M.B.; Hachfeld, C.M.; Fraser, D.G.; et al. Senolytics Improve Physical Function and Increase Lifespan in Old Age. Nat. Med. 2018, 24, 1246–1256. [Google Scholar] [CrossRef]
- Kirkland, J.L.; Tchkonia, T. Senolytic Drugs: From Discovery to Translation. J. Intern. Med. 2020, 288, 518–536. [Google Scholar] [CrossRef]
- Park, J.; Shin, D.W. Senotherapeutics and Their Molecular Mechanism for Improving Aging. Biomol. Ther. 2022, 30, 490–500. [Google Scholar] [CrossRef]
- Lagoumtzi, S.M.; Chondrogianni, N. Senolytics and Senomorphics: Natural and Synthetic Therapeutics in the Treatment of Aging and Chronic Diseases. Free Radic. Biol. Med. 2021, 171, 169–190. [Google Scholar] [CrossRef]
- Birch, J.; Gil, J. Senescence and the SASP: Many Therapeutic Avenues. Genes Dev. 2020, 34, 1565–1576. [Google Scholar] [CrossRef]
- Kirkland, J.L. Translating the Science of Aging into Therapeutic Interventions. Cold Spring Harb. Perspect. Med. 2016, 6, a025908. [Google Scholar] [CrossRef]
- Yousefzadeh, M.J.; Zhu, Y.; McGowan, S.J.; Angelini, L.; Fuhrmann-Stroissnigg, H.; Xu, M.; Ling, Y.Y.; Melos, K.I.; Pirtskhalava, T.; Inman, C.L.; et al. Fisetin Is a Senotherapeutic That Extends Health and Lifespan. EBioMedicine 2018, 36, 18–28. [Google Scholar] [CrossRef] [PubMed]
- Zoico, E.; Nori, N.; Darra, E.; Tebon, M.; Rizzatti, V.; Policastro, G.; De Caro, A.; Rossi, A.P.; Fantin, F.; Zamboni, M. Senolytic Effects of Quercetin in an in Vitro Model of Pre-Adipocytes and Adipocytes Induced Senescence. Sci. Rep. 2021, 11, 23237. [Google Scholar] [CrossRef]
- Hwang, H.V.; Tran, D.T.; Rebuffatti, M.N.; Li, C.-S.; Knowlton, A.A. Investigation of Quercetin and Hyperoside as Senolytics in Adult Human Endothelial Cells. PLoS ONE 2018, 13, e0190374. [Google Scholar] [CrossRef] [PubMed]
- Kumar, R.; Sharma, A.; Kumari, A.; Gulati, A.; Padwad, Y.; Sharma, R. Epigallocatechin Gallate Suppresses Premature Senescence of Preadipocytes by Inhibition of PI3K/Akt/MTOR Pathway and Induces Senescent Cell Death by Regulation of Bax/Bcl-2 Pathway. Biogerontology 2019, 20, 171–189. [Google Scholar] [CrossRef]
- Lammermann, I.; Terlecki-Zaniewicz, L.; Weinmullner, R.; Schosserer, M.; Dellago, H.; de Matos Branco, A.D.; Autheried, D.; Sevcnikar, B.; Kleissl, L.; Berlin, I.; et al. Blocking Negative Effects of Senescence in Human Skin Fibroblasts with a Plant Extract. NPJ Aging Mech. Dis. 2018, 4, 4. [Google Scholar] [CrossRef]
- Srivastava, J.K.; Shankar, E.; Gupta, S. Chamomile: A Herbal Medicine of the Past with a Bright Future (Review). Mol. Med. Rep. 2010, 3, 895–901. [Google Scholar] [CrossRef]
- Singh, O.; Khanam, Z.; Misra, N.; Srivastava, M.K. Chamomile (Matricaria chamomilla L.): An Overview. Pharmacogn. Rev. 2011, 5, 82–95. [Google Scholar] [CrossRef]
- El Mihyaoui, A.; Esteves Da Silva, J.C.G.; Charfi, S.; Castillo, M.E.C.; Lamarti, A.; Arnao, M.B. Chamomile (Matricaria chamomilla L.): A Review of Ethnomedicinal Use, Phytochemistry and Pharmacological Uses. Life 2022, 12, 479. [Google Scholar] [CrossRef]
- Avonto, C.; Rua, D.; Lasonkar, P.B.; Chittiboyina, A.G.; Khan, I.A. Identification of a Compound Isolated from German Chamomile (Matricaria Chamomilla) with Dermal Sensitization Potential. Toxicol. Appl. Pharmacol. 2017, 318, 16–22. [Google Scholar] [CrossRef]
- McKay, D.L.; Blumberg, J.B. A Review of the Bioactivity and Potential Health Benefits of Chamomile Tea (Matricaria recutita L.). Phytother. Res. 2006, 20, 519–530. [Google Scholar] [CrossRef]
- De Cicco, P.; Ercolano, G.; Sirignano, C.; Rubino, V.; Rigano, D.; Ianaro, A.; Formisano, C. Chamomile Essential Oils Exert Anti-Inflammatory Effects Involving Human and Murine Macrophages: Evidence to Support a Therapeutic Action. J. Ethnopharmacol. 2023, 311, 116391. [Google Scholar] [CrossRef] [PubMed]
- Shevchuk, Y.; Kuypers, K.; Janssens, G.E. Fungi as a Source of Bioactive Molecules for the Development of Longevity Medicines. Ageing Res. Rev. 2023, 87, 101929. [Google Scholar] [CrossRef] [PubMed]
- Kühnel, H.; Pasztorek, M.; Kuten-Pella, O.; Kramer, K.; Bauer, C.; Lacza, Z.; Nehrer, S. Effects of Blood-Derived Products on Cellular Senescence and Inflammatory Response: A Study on Skin Rejuvenation. Curr. Issues Mol. Biol. 2024, 46, 1865–1885. [Google Scholar] [CrossRef]
- Varesi, A.; Chirumbolo, S.; Irene Maria Campagnoli, L.; Pierella, E.; Bavestrello Piccini, G.; Carrara, A.; Ricevuti, G.; Scassellati, C.; Bonvicini, C.; Pascale, A. The Role of Antioxidants in the Interplay between Oxidative Stress and Senescence. Antioxidants 2022, 11, 1224. [Google Scholar] [CrossRef]
- Kuhnel, H.; Adilijiang, A.; Dadak, A.; Wieser, M.; Upur, H.; Stolze, K.; Grillari, J.; Strasser, A. Investigations into Cytotoxic Effects of the Herbal Preparation Abnormal Savda Munziq. Chin. J. Integr. Med. 2015, 1–9. [Google Scholar] [CrossRef]
- Petrova, N.V.; Velichko, A.K.; Razin, S.V.; Kantidze, O.L. Small Molecule Compounds That Induce Cellular Senescence. Aging Cell 2016, 15, 999–1017. [Google Scholar] [CrossRef]
- Odeh, A.; Dronina, M.; Domankevich, V.; Shams, I.; Manov, I. Downregulation of the Inflammatory Network in Senescent Fibroblasts and Aging Tissues of the Long-Lived and Cancer-Resistant Subterranean Wild Rodent, Spalax. Aging Cell 2020, 19, e13045. [Google Scholar] [CrossRef]
- Bientinesi, E.; Lulli, M.; Becatti, M.; Ristori, S.; Margheri, F.; Monti, D. Doxorubicin-Induced Senescence in Normal Fibroblasts Promotes in Vitro Tumour Cell Growth and Invasiveness: The Role of Quercetin in Modulating These Processes. Mech. Ageing Dev. 2022, 206, 111689. [Google Scholar] [CrossRef]
- Tayeh, Z.; Ofir, R. Asteriscus Graveolens Extract in Combination with Cisplatin/Etoposide/Doxorubicin Suppresses Lymphoma Cell Growth through Induction of Caspase-3 Dependent Apoptosis. Int. J. Mol. Sci. Commun. 2018, 19, 2219. [Google Scholar] [CrossRef]
- Kluska, M.; Wo’zniak, K.W. Molecular Sciences Natural Polyphenols as Modulators of Etoposide Anti-Cancer Activity. Int. J. Mol. Sci. 2021, 22, 6602. [Google Scholar] [CrossRef]
- Jamil, S.; Lam, I.; Majd, M.; Tsai, S.-H.; Duronio, V. Etoposide Induces Cell Death via Mitochondrial-Dependent Actions of P53. Cancer Cell Int. 2015, 15, 79. [Google Scholar] [CrossRef] [PubMed]
- OyetakinWhite, P.; Tribout, H.; Baron, E. Protective Mechanisms of Green Tea Polyphenols in Skin. Oxidative Med. Cell. Longev. 2012, 2012, 560682. [Google Scholar] [CrossRef] [PubMed]
- Türkoğlu, M.; Uğurlu, T.; Gedik, G.; Yılmaz, A.M.; Süha Yalçin, A. In Vivo Evaluation of Black and Green Tea Dermal Products against UV Radiation. Drug Discov. Ther. 2010, 4, 362–367. [Google Scholar]
- Unno, K. Prevention of Brain Aging by Green Tea Components: Role of Catechins and Theanine. J. Phys. Fit. Sports Med. 2016, 5, 117–122. [Google Scholar] [CrossRef]
- Yamamoto, T.; Lewis, J.; Wataha, J.; Dickinson, D.; Singh, B.; Bollag, W.B.; Ueta, E.; Osaki, T.; Athar, M.; Schuster, G.; et al. Roles of Catalase and Hydrogen Peroxide in Green Tea Polyphenol-Induced Chemopreventive Effects. J. Pharmacol. Exp. Ther. 2004, 308, 317–323. [Google Scholar] [CrossRef]
- Bientinesi, E.; Ristori, S.; Lulli, M.; Monti, D. Quercetin Induces Senolysis of Doxorubicin-Induced Senescent Fibroblasts by Reducing Autophagy, Preventing Their pro-Tumour Effect on Osteosarcoma Cells. Mech. Ageing Dev. 2024, 220, 111957. [Google Scholar] [CrossRef]
- Matos, L.; Gouveia, A.M.; Almeida, H. Resveratrol Attenuates Copper-Induced Senescence by Improving Cellular Proteostasis. Oxidative Med. Cell. Longev. 2017, 2017, 3793817. [Google Scholar] [CrossRef]
- Matos, L.; Gouveia, A.; Almeida, H. Copper Ability to Induce Premature Senescence in Human Fibroblasts. Age 2012, 34, 783–794. [Google Scholar] [CrossRef]
- Severino, J.; Allen, R.G.; Balin, S.; Balin, A.; Cristofalo, V.J. Is β-Galactosidase Staining a Marker of Senescence in Vitro and in Vivo? Exp. Cell Res. 2000, 257, 162–171. [Google Scholar] [CrossRef]
- Russo, C.; Edwards, K.D.; Margetts, G.; Kleidonas, S.; Zaibi, N.S.; Clapham, J.C.; Zaibi, M.S. Effects of Salvia officinalis L. and Chamaemelum nobile (L.) Extracts on Inflammatory Responses in Two Models of Human Cells: Primary Subcutaneous Adipocytes and Neuroblastoma Cell Line (SK-N-SH). J. Ethnopharmacol. 2021, 268, 113614. [Google Scholar] [CrossRef]
- Sagiv, A.; Burton, D.G.A.; Moshayev, Z.; Vadai, E.; Wensveen, F.; Ben-Dor, S.; Golani, O.; Polic, B.; Krizhanovsky, V. NKG2D Ligands Mediate Immunosurveillance of Senescent Cells. Aging 2016, 8, 328–344. [Google Scholar] [CrossRef] [PubMed]
- Chinta, S.J.; Woods, G.; Demaria, M.; Rane, A.; Zou, Y.; McQuade, A.; Rajagopalan, S.; Limbad, C.; Madden, D.T.; Campisi, J.; et al. Cellular Senescence Is Induced by the Environmental Neurotoxin Paraquat and Contributes to Neuropathology Linked to Parkinson’s Disease. Cell Rep. 2018, 22, 930–940. [Google Scholar] [CrossRef]
- Velichutina, I.; Shaknovich, R.; Geng, H.; Johnson, N.A.; Gascoyne, R.D.; Melnick, A.M.; Elemento, O. EZH2-Mediated Epigenetic Silencing in Germinal Center B Cells Contributes to Proliferation and Lymphomagenesis. J. Am. Soc. Hematol. 2010, 116, 5247–5255. [Google Scholar] [CrossRef]
- Cappellano, G.; Ploner, C.; Lobenwein, S.; Sopper, S.; Hoertnagl, P.; Mayerl, C.; Wick, N.; Pierer, G.; Wick, G.; Wolfram, D. Immunophenotypic Characterization of Human T Cells after in Vitro Exposure to Different Silicone Breast Implant Surfaces. PLoS ONE 2018, 13, e0192108. [Google Scholar] [CrossRef]
- Peng, D.-F.; Hu, T.-L.; Soutto, M.; Belkhiri, A.; El-Rifai, W. Glutathione Peroxidase 7 Suppresses Bile Salt-Induced Expression of Pro-Inflammatory Cytokines in Barrett’s Carcinogenesis. J. Cancer 2014, 5, 510–517. [Google Scholar] [CrossRef]
- Terlecki-Zaniewicz, L.; Lämmermann, I.; Latreille, J.; Bobbili, M.R.; Pils, V.; Schosserer, M.; Weinmüllner, R.; Dellago, H.; Skalicky, S.; Pum, D.; et al. Small Extracellular Vesicles and Their MiRNA Cargo Are Anti-Apoptotic Members of the Senescence-Associated Secretory Phenotype. Aging 2018, 10, 1103–1132. [Google Scholar] [CrossRef]
- Chhunchha, B.; Fatma, N.; Kubo, E.; Singh, D.P.; Singh, D.P. Aberrant Sumoylation Signaling Evoked by Reactive Oxygen Species Impairs Protective Function of Prdx6 by Destabilization and Repression of Its Transcription. FEBS J. 2014, 281, 3357–3381. [Google Scholar] [CrossRef]
- Seliger, B.; Jasinski-Bergner, S.; Quandt, D.; Stoehr, C.; Bukur, J.; Wach, S.; Legal, W.; Taubert, H.; Wullich, B.; Hartmann, A. HLA-E Expression and Its Clinical Relevance in Human Renal Cell Carcinoma. Oncotarget 2016, 7, 67360. [Google Scholar] [CrossRef]
Chamomile | Goldenrod | Reishi | Green Tea | |
---|---|---|---|---|
IC50 (young cells) | 1719 µg/mL | 841.6 µg/mL | Not stable | 250.1 µg/mL |
IC50 (etoposide treated old cells) | 533.8 µg/mL | 530.5 µg/mL | 38.5 µg/mL | 91.97 µg/mL |
Name | Forward (5′-3′) | Reverse (5′-3′) | Ref. |
---|---|---|---|
p16INK4a | GAGCAGCATGGAGCCTTC | CGTAACTATTCGGTGCGTTG | [52] |
p21 | GGCAGACCAGCATGACAGATTTC | CGGATTAGGGCTTCCTCTTGG | [53] |
IL-1α | GGTTGAGTTTAAGCCAATCCA | TGCTGACCTAGGCTTGATGA | [52] |
IL-1β | ACAGATGAAGTGCTCCTTCCA | GTCGGAGATTCGTAGCTGGAT | [54] |
IL-6 | GCCCAGCTATGAACTCCTTCT | GAAGGCAGCAGGCAACAC | [52] |
IL-8 | AGACAGCAGAGCACACAAGC | ATGGTTCCTTCCGGTGGT | [52] |
CXCL1 | GAAAGCTTGCCTCAATCCTG | CACCAGTGAGCTTCCTCCTC | [55] |
GAPDH | CGACCACTTTGTCAAGCTCA | TGTGAGGAGGGGAGATTCAG | [56] |
Actin β | CCAACCGCGAGAAGATGA | CCAGAGGCGTACAGGGATAG | [57] |
MMP-3 | CAAAACATATTTCTTTGTAGAGGACAA | TTCAGCTATTTGCTTGGGAAA | [52] |
HLA-E | TGCGCGGCTACTACAATCAG | TGTCGCTCCACTCAGCCTTC | [58] |
MICA | ATGGAACACAGCGGGAATCA | GCACTTTCCCAGAGGGCAC | [51] |
ULBP2 | TCCAGGCTCTCCTTCCATCA | AGAAGGATCTTGGTAGCGGC | [51] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Imb, M.; Véghelyi, Z.; Maurer, M.; Kühnel, H. Exploring Senolytic and Senomorphic Properties of Medicinal Plants for Anti-Aging Therapies. Int. J. Mol. Sci. 2024, 25, 10419. https://doi.org/10.3390/ijms251910419
Imb M, Véghelyi Z, Maurer M, Kühnel H. Exploring Senolytic and Senomorphic Properties of Medicinal Plants for Anti-Aging Therapies. International Journal of Molecular Sciences. 2024; 25(19):10419. https://doi.org/10.3390/ijms251910419
Chicago/Turabian StyleImb, Monika, Zsolt Véghelyi, Michael Maurer, and Harald Kühnel. 2024. "Exploring Senolytic and Senomorphic Properties of Medicinal Plants for Anti-Aging Therapies" International Journal of Molecular Sciences 25, no. 19: 10419. https://doi.org/10.3390/ijms251910419