Real-Time Monitoring on the Chinese Giant Salamander Using RPA-LFD
Abstract
:1. Introduction
2. Results
2.1. Selecting Optimal Primer/Probe Sets for RPA Reaction
2.2. Specificity and Sensitivity Test on the Primer and Probe Sets
2.3. Testing the Primer/Probe Sets on Mock Environmental Samples
2.4. Field Tests
3. Discussion
4. Materials and Methods
4.1. DNA Samples
4.2. Design of Primers and Probes
4.3. Test of Specificity
4.4. Test of Sensitivity
4.5. Examination on Mock Environmental Samples
4.6. Application of the Developed Primes/Probes and RPA-LFD Method in Field
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Turvey, S.T.; Chen, S.; Tapley, B.; Wei, G.; Xie, F.; Yan, F.; Yang, J.; Liang, Z.Q.; Tian, H.F.; Wu, M.Y.; et al. Imminent extinction in the wild of the world’s largest amphibian. Curr. Biol. 2018, 28, R592–R594. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.; Zhao, C.L.; Xiong, S.; Wang, J.; Zhao, T.; Li, C.; Xie, F. Population monitoring and effect evaluation of the stock enhancement of Chinese giant salamander in the Gutian Mountain National Nature Reserve. Chin. J. Appl. Environ. Biol. 2021, 27, 823–830. (In Chinese) [Google Scholar] [CrossRef]
- Cunningham, A.A.; Turvey, S.T.; Zhou, F.; Meredith, H.M.R.; Guan, W.; Liu, X.L.; Sun, C.M.; Wang, Z.Q.; Wu, M.Y. Development of the Chinese giant salamander Andrias davidianus farming industry in Shaanxi Province, China: Conservation threats and opportunities. Oryx 2016, 50, 265–273. [Google Scholar] [CrossRef]
- Geng, X.F.; Wei, H.; Shang, H.T.; Zhou, M.H.; Chen, B.; Zhang, F.C.; Zang, X.Y.; Li, P.F.; Sun, J.Y.; Che, J.; et al. Proteomic analysis of the skin of Chinese giant salamander (Andrias davidianus). J. Proteom. 2015, 119, 196–208. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.M.; Zhang, K.J.; Wang, Z.H.; Ding, Y.Z.; Wu, W.; Huang, S. The decline of the Chinese giant salamander Andrias davidianus and implications for its conservation. Oryx 2004, 38, 197–202. [Google Scholar] [CrossRef]
- Jiang, W.; Tian, H.; Zhang, L. Husbandry, Captive Breeding, and Field Survey of Chinese Giant Salamander (Andrias davidianus). Methods Mol. Biol. 2023, 2562, 75–92. [Google Scholar] [CrossRef] [PubMed]
- Browne, R.K.; Li, H.; Wang, Z.H.; Hime, P.; McMillan, A.; Wu, M.; Diaz, R.; Zhang, H.X.; McGinnity, D.; Briggler, J.T. The giant salamanders (Cryptobranchidae): Part A. palaeontology, phylogeny, genetics, and morphology. Amphib. Reptile Conserv. 2012, 5, 17–29. [Google Scholar]
- Yao, L.F.; Li, Q.Y.; Huang, Y.H.; He, Z.S.; He, R.F.; Li, S. Monitoring, Pre-warning and Regulation System of the Environment Parameters of the Andrias Davidianus Based on the Internet of Things. In Proceedings of the International Conference on Electronic Information Technology and Smart Agriculture (ICEITSA), Huaihua, China, 10–12 December 2021; pp. 83–88. [Google Scholar] [CrossRef]
- Marcec, R.; Kouba, A.; Zhang, L.; Zhang, H.X.; Wang, Q.J.; Zhao, H.; Jiang, W.; Willard, S. Surgical implantation of coelomic radiotransmitters and postoperative survival of Chinese giant salamanders (Andrias davidianus) following reintroduction. Zoo Wildl. Med. 2016, 47, 187–195. [Google Scholar] [CrossRef] [PubMed]
- Luo, Q.H.; Tong, F.; Song, Y.J.; Wang, H.; Du, M.L.; Ji, H.B. Observation of the breeding behavior of the Chinese giant salamander (Andrias davidianus) using a digital monitoring system. Animals 2018, 8, 161. [Google Scholar] [CrossRef]
- Wang, J.; Zhang, H.X.; Xie, F.; Wei, G.; Jian, J.P. Genetic bottlenecks of the wild Chinese giant salamander in karst caves. Asian Herpetol. Res. 2017, 8, 174–183. [Google Scholar] [CrossRef]
- Ying, M.G.; Cao, Y.; Li, C. Current Status and Protection Countermeasures for Chinese Giant Salamander Andrias davidianus. Guizhou Agric. Sci. 2014, 42, 197–202. [Google Scholar] [CrossRef]
- Wang, C.; Tao, M.; Li, A.M.; Shi, P.; Yang, J.H.; Wang, Z.H.; Zhang, X.W. Research on the biodiversity of Qinhuai River based on environmental DNA metabacroding. Acta. Ecol. Sin. 2022, 42, 611–624. [Google Scholar] [CrossRef]
- Girdoniya, V. DNA Barcoding and its Application in Fish Biodiversity Identification: A Review. IJPBA 2014, 6, 1–2. [Google Scholar]
- Lobato, I.M.; O’Sullivan, C.K. Recombinase polymerase amplification: Basics, applications and recent advances. Trends. Anal. Chem. 2018, 98, 19–35. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.C.; Liu, L.B.; Li, R.W.; Wang, J.F.; Fu, Q.; Yuan, W.Z. Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification. Arch. Virol. 2016, 161, 1015–1018. [Google Scholar] [CrossRef] [PubMed]
- Babu, B.; Washburn, B.K.; Miller, S.H.; Poduch, K.; Sarigul, T.; Knox, G.W.; Ochoa-Corona, F.M.; Paret, M.L. A rapid assay for detection of Rose rosette virus using reverse transcription-recombinase polymerase amplification using multiple gene targets. J. Virol. Methods. 2017, 240, 78–84. [Google Scholar] [CrossRef] [PubMed]
- Crannell, Z.A.; Rohrman, B.; Richards-Kortum, R. Quantification of HIV-1 DNA using real-time recombinase polymerase amplification. Anal. Chem. 2014, 86, 5615–5619. [Google Scholar] [CrossRef] [PubMed]
- Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA detection using recombination proteins. PLoS Biol. 2006, 4, 1115–1121. [Google Scholar] [CrossRef]
- Daher, R.K.; Stewart, G.; Boissinot, M.; Bergeron, M.G. Recombinase Polymerase Amplification for Diagnostic Applications. Clin. Chem. 2016, 62, 947–958. [Google Scholar] [CrossRef]
- Wang, H.B.; Dong, J.J.; Zhang, T.; Wang, F.; Yang, R.; Zhang, Y.; Zhao, X.X. A novel rapid detection of Senecavirus A using recombinase polymerase amplification (RPA) coupled with lateral flow (LF) dipstrip. Anal. Biochem. 2022, 646, 114627. [Google Scholar] [CrossRef]
- Hu, S.D.; Yan, C.Y.; Yu, H.; Zhang, Y.; Zhang, C.Q. Establishment of the recombinase polymerase amplification-lateral flow dipstick (RPA-LFD) detection technique for Fusarium oxysporum. Plant Dis. 2023, 107, 2665–2672. [Google Scholar] [CrossRef] [PubMed]
- Qiao, M.H.; Zhang, L.Q.; Chang, J.; Li, H.X.; Li, J.K.; Wang, W.C.; Yuan, G.L.; Su, J.G. Rapid and sensitive detection of pathogenic Elizabethkingia miricola in black spotted frog by RPA-LFD and fluorescent probe-based RPA. Fish Shellfish Immunol. Rep. 2022, 3, 100059. [Google Scholar] [CrossRef] [PubMed]
- Onchan, W.; Ritbamrung, O.; Changtor, P.; Pradit, W.; Chomdej, S.; Nganvongpanit, K.; Siengdee, P.; Suyasunanont, U.; Buddhachat, K. Sensitive and rapid detection of Babesia species in dogs by recombinase polymerase amplification with lateral flow dipstick (RPA-LFD). Sci. Rep. 2022, 12, 20560. [Google Scholar] [CrossRef] [PubMed]
- Shang, Y.T.; Xing, G.W.; Lin, H.F.; Sun, Y.C.; Chen, S.L.; Lin, J.M. Development of nucleic acid extraction and real-time recombinase polymerase amplification (RPA) assay integrated microfluidic biosensor for multiplex detection of foodborne bacteria. Food Control 2024, 155, 110047. [Google Scholar] [CrossRef]
- Liu, L.B.; Wang, J.F.; Zhang, R.X.; Lin, M.; Shi, R.H.; Han, Q.G.; Wang, J.C.; Yuan, W.Z. Visual and equipment-free reverse transcription recombinase polymerase amplification method for rapid detection of foot-and-mouth disease virus. BMC Vet. Res. 2018, 14, 263. [Google Scholar] [CrossRef] [PubMed]
- Jiang, W.; Ren, Y.L.; Han, X.G.; Xue, J.X.; Shan, T.L.; Chen, Z.G.; Liu, Y.J.; Wang, Q. Recombinase polymerase amplification-lateral flow (RPA-LF) assay combined with immunomagnetic separation for rapid visual detection of Vibrio parahaemolyticus in raw oysters. Anal. Bioanal. Chem. 2020, 412, 2903–2914. [Google Scholar] [CrossRef] [PubMed]
- Archer, J.; Patwary, F.K.; Sturt, A.S.; Webb, E.L.; Phiri, C.R.; Mweene, T.; Hayes, R.J.; Ayles, H.; Brienen, E.A.; van Lieshout, L.; et al. Validation of the isothermal Schistosoma haematobium Recombinase Polymerase Amplification (RPA) assay, coupled with simplified sample preparation, for diagnosing female genital schistosomiasis using cervicovaginal lavage and vaginal self-swab samples. PLoS Negl. Trop. Dis. 2022, 16, e0010276. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Zhang, F.; Wang, L.; Qian, W.; Qian, C.; Wu, J.; Ying, Y. Instant, Visual, and Instrument-Free Method for On-Site Screening of GTS 40-3-2 Soybean Based on Body-Heat Triggered Recombinase Polymerase Amplification. Anal. Chem. 2017, 89, 4413–4418. [Google Scholar] [CrossRef] [PubMed]
- Fuller, S.L.; Savory, E.A.; Weisberg, A.J.; Buser, J.Z.; Gordon, M.I.; Putnam, M.L.; Chang, J.H. Isothermal Amplification and Lateral-Flow Assay for Detecting Crown-Gall-Causing Agrobacterium spp. Phytopathology 2017, 107, 1062–1068. [Google Scholar] [CrossRef]
- Qi, Y.; Yin, Q.; Shao, Y.; Cao, M.; Li, S.; Chen, H.; Shen, W.; Rao, J.; Li, J.; Li, X.; et al. Development of a rapid and visual nucleotide detection method for a Chinese epidemic strain of Orientia tsutsugamushi based on recombinase polymerase amplification assay and lateral flow test. Int. J. Infect. Dis. 2018, 70, 42–50. [Google Scholar] [CrossRef]
- Qi, Y.; Yin, Q.; Shao, Y.; Li, S.; Chen, H.; Shen, W.; Rao, J.; Li, J.; Li, X.; Sun, Y.; et al. Rapid and Visual Detection of Coxiella burnetii Using Recombinase Polymerase Amplification Combined with Lateral Flow Strips. Biomed. Res. Int. 2018, 2018, 6417354. [Google Scholar] [CrossRef] [PubMed]
- Zhao, D.Q.; Xie, G.Q.; Wu, H.H.; Li, X.M.; Chen, J.P. Protection and Development of the Chinese giant salamander(Andrias davidianus) Germplasm Resources. Pract. Rural Technol. 2021, 87, 78–79. (In Chinese) [Google Scholar]
- Jiang, W.S.; Lan, X.Y.; Wang, J.X.; Xiang, H.M.; Tian, H.; Luo, Q.H. Recent progress in the germplasm resources conservation and utilization of the Chinese giant salamander (Andrias davidianus). J. Fish China 2022, 46, 683–705. [Google Scholar] [CrossRef]
- Yan, F.; Lü, J.C.; Zhang, B.L.; Yuan, Z.Y.; Zhao, H.P.; Huang, S.; Wei, G.; Mi, X.; Zou, D.H.; Xu, W.; et al. The Chinese giant salamander exemplifies the hidden extinction of cryptic species. Curr. Biol. 2018, 28, R590–R592. [Google Scholar] [CrossRef] [PubMed]
- Chai, J.; Lu, C.Q.; Yi, M.R.; Dai, N.H.; Weng, X.D.; Di, M.X.; Peng, Y.; Tang, Y.; Shan, Q.H.; Wang, K.; et al. Discovery of a wild, genetically pure Chinese giant salamander creates new conservation opportunities. Zool. Res. 2022, 43, 469–480. [Google Scholar] [CrossRef] [PubMed]
- Gao, W.F.; Zhu, P.; Huang, H.L. Recombinase polymerase amplification: A new DNA/RNA amplification strategy. Chin. J. Biochem. Mol. Biol. 2016, 32, 8. [Google Scholar] [CrossRef]
- Liu, H.; Zhang, J.; Zhang, Y.; Zhao, D.X.; Wu, S.Z. Establishment of a recombinase polymerase amplification technology to detect Pseudomonas aeruginosa in bottled (or barreled) water. J. Food Saf. Qual. 2020, 11, 6915–6920. [Google Scholar] [CrossRef]
- Cai, Y.K.; Liu, X.S.; Zhang, L.P.; Zhou, P.; Wang, Y.L. Development and application of a recombinase polymerase amplification combined with a lateral flow dipstick(RPA-LFD) assay for rapid diagnosis of porcine kobuvirus. Chin. Vet. Sci. 2020, 50, 5. (In Chinese) [Google Scholar] [CrossRef]
- Zou, X.H.; Dong, C.; Ni, Y.D.; Gao, Q.H. Rapid Detection of Strawberry Mild Yellow Edge Virus with a Lateral Flow Strip Reverse Transcription Recombinase Polymerase Amplification Assay. Curr. Microbiol. 2022, 79, 365. [Google Scholar] [CrossRef]
- Mayran, C.; Foulongne, V.; van de Perre, P.; Fournier-Wirth, C.; Molès, J.P.; Cantaloube, J.F. Rapid diagnostic test for hepatitis B virus viral load based on recombinase polymerase amplification combined with a lateral flow read-out. Diagnostics 2022, 12, 621. [Google Scholar] [CrossRef]
- Wang, J.C.; Wang, J.F.; Geng, Y.Y.; Yuan, W.Z. A recombinase polymerase amplification-based assay for rapid detection of African swine fever virus. Can. J. Vet. Res. 2017, 81, 308–312. [Google Scholar] [PubMed] [PubMed Central]
- Poritz, M.A.; Ririe, K.M. Getting things backwards to prevent primer dimers. J. Mol. Diagn. 2014, 16, 159–162. [Google Scholar] [CrossRef] [PubMed]
- Daher, R.K.; Stewart, G.; Boissinot, M.; Boudreau, D.K.; Bergeron, M.G. Influence of sequence mismatches on the specificity of recombinase polymerase amplification technology. Mol. Cell Probes. 2015, 29, 116–121. [Google Scholar] [CrossRef] [PubMed]
- Shang, M.Y.; Deng, S.L.; Lu, W.P.; Huang, Q. Principles of recombinant enzyme polymerase amplification technology and its application in medical testing. Chin. J. Lab. Med. 2022, 45, 423427. (In Chinese) [Google Scholar] [CrossRef]
- Higgins, M.; Ravenhall, M.; Ward, D.; Phelan, J.; Ibrahim, A.; Forrest, M.S.; Clark, T.G.; Campino, S. PrimedRPA: Primer design for recombinase polymerase amplification assays. Bioinformatics 2019, 35, 682–684. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
Species | NCBI Accession Numbers |
---|---|
Andrias davidianus | NC_004926.1 |
Andrias japonicus | NC_007446.1 |
Randon sibiricus | NC_004021.1 |
Hynobius unisacculus | NC_045210.1 |
Hynobius maoershanensis | NC_023789.1 |
Hynobius yangi | NC_013825.1 |
Hynobius guabangshanensis | NC_013762.1 |
Hynobius quelpaertensis | NC_010224.1 |
Hynobius amjiensis | NC_008076.1 |
Hynobius chinensis | NC_008088.1 |
Hynobius arisanensis | NC_009335.1 |
Hynobius leechii | NC_008079.1 |
Hynobius formosanus | NC_008084.1 |
Pseudohynobius puxiongensis | NC_020634.1 |
Onychodactylus zhaoermii | NC_026854.1 |
Onychodactylus zhangyapingi | NC_026853.1 |
Onychodactylus fischeri | NC_008089.1 |
Batrachuperus yenyuanensis | NC_012430.1 |
Batrachuperus gorganensis | NC_008091.1 |
Batrachuperus mustersi | NC_008090.1 |
Batrachuperus tibetanus | NC_008085.1 |
Batrachuperus pinchonii | NC_008083.1 |
Batrachuperus londongenensis | NC_008077.1 |
Salamandrella keyserlingii | NC_008082.1 |
Liua shihi | NC_008078.1 |
Liua tsinpaensis | NC_008081.1 |
Pachyhynobius shangchengensis | NC_008080.1 |
Name | Sequences (5′-3′) |
---|---|
W1-F | CTAACCACATCCCATAATATATCAAACTCTAA |
W1-R | Biotin-CTCTTGGTCTCTTATCCTAAGTCTTTATATTA |
W1 | FAM-AACCTTTATATTAATATCATTATTAATCATCCTC/dSpacer/TCTCTCATATTACTCCCT-C3spacer |
W2-F | TCTAAGTGTAAGTATAAATCAAAACGAACCC |
W2-R | Biotin-GAGTTCCTTCTTTGACTTTTAATCTTTCTT |
W2 | FAM-GAACCATATTGAAGGTAACATCTATTTTAAGCAAG/dSpacer/AAATTTTGATTC -C3spacer |
W3-F | CACCCATTACACGTCTTATCATTATCAGCCC |
W3-R | Biotin-CCTAGCATGAAGGTTGTGTAAAATGTAAAATA |
W3 | FAM-AGGTCTTGAGTGAGCCCAATAAGTATTTAGTCC/dSpacer/AATAAAGACCGCTGA-C3spacer |
W4-F | CAGTAATAACATTAAAAGTCGGTAAATCCC |
W4-R | Biotin-CCTAGCATGAAGGTTGTGTAAAATGTAAAATA |
W4 | FAM-TCAATGACGAAAGTAATTCTAGATAATGACC/dSpacer/CCACGAAAATTAGGTT-C3spacer |
W5-F | TTCAAATCCTCTTCTTAG |
W5-R | Biotin-GGACGGATTGGTTCTTTAATAAATAGTTTT |
W5 | FAM-TTACGAAAAGGGCCAAACATTGTAGGCCCTGCC/dSpacer/GGCATTCTTCAACCAT-C3spacer |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ling, L.; Liang, L.; Wang, H.; Lin, X.; Li, C. Real-Time Monitoring on the Chinese Giant Salamander Using RPA-LFD. Int. J. Mol. Sci. 2024, 25, 4946. https://doi.org/10.3390/ijms25094946
Ling L, Liang L, Wang H, Lin X, Li C. Real-Time Monitoring on the Chinese Giant Salamander Using RPA-LFD. International Journal of Molecular Sciences. 2024; 25(9):4946. https://doi.org/10.3390/ijms25094946
Chicago/Turabian StyleLing, Lanxin, Linyan Liang, Huifang Wang, Xiaolong Lin, and Chenhong Li. 2024. "Real-Time Monitoring on the Chinese Giant Salamander Using RPA-LFD" International Journal of Molecular Sciences 25, no. 9: 4946. https://doi.org/10.3390/ijms25094946