Changes in the Proteomic Profile After Audiogenic Kindling in the Inferior Colliculus of the GASH/Sal Model of Epilepsy
Abstract
:1. Introduction
2. Results
2.1. Severity Index
2.2. Auditory Brainstem Response
2.3. Cytokines
2.4. Proteomics
2.4.1. Batch Effect Correction
2.4.2. Proteomic Data Analyses for Uncovering Potential Status Epilepticus Regulation in GASH/Sal Model
Unsupervised Analysis
Univariate t-Test Analysis
2.5. Gene Validation of the Overexpressed DEPs
2.6. Gene Set Enrichment Analysis
2.7. Gene Validation of GSEA-Selected Proteins
2.8. Network Analysis
2.9. Gene Validation of WGCNA-Selected Candidates
3. Discussion
3.1. Cytokines
3.2. Proteomics
3.2.1. GSEA
3.2.2. Weighted Correlation Network Analysis
4. Materials and Methods
4.1. Experimental Groups
4.2. Experimental Design
4.3. Audiogenic Kindling Procedure
4.4. Study of the State of the Auditory System of Animals: ABRs
4.5. Blood Processing and Cytokine Arrays
4.6. Euthanasia and Tissue Recollection for Molecular Studies
4.7. Mass Spectrometry Sample Preparation
4.8. Proteomic Data Processing
4.9. Proteomic Data Analyses for Uncovering Potential Status Epilepticus Regulation in GASH/Sal Model
4.9.1. Unsupervised Analysis
4.9.2. Univariate t-Test Analysis
4.9.3. GSEA, Data Visualization, and Interpretation
4.9.4. Network Analysis
4.10. Real-Time Quantitative Reverse Transcription PCR
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kulkarni, S.K.; George, B. Kindling model of epilepsy. Methods Find. Exp. Clin. Pharmacol. 1994, 16, 735–745. [Google Scholar] [PubMed]
- Dutra Moraes, M.F.; Galvis-Alonso, O.Y.; Garcia-Cairasco, N. Audiogenic kindling in the Wistar rat: A potential model for recruitment of limbic structures. Epilepsy Res. 2000, 39, 251–259. [Google Scholar] [CrossRef] [PubMed]
- Vinogradova, L.V. Audiogenic kindling and secondary subcortico-cortical epileptogenesis: Behavioral correlates and electrographic features. Epilepsy Behav. 2017, 71 Pt B, 142–153. [Google Scholar] [CrossRef]
- Faingold, C.; Evans, M.S. Pathophysiology of Generalized Tonic-Clonic Seizures. In Atlas of Epilepsies; Panayiotopoulos, C.P., Ed.; Springer: London, UK, 2010. [Google Scholar] [CrossRef]
- Vinogradova, L.V.; van Rijn, C.M. Anticonvulsive and antiepileptogenic effects of levetiracetam in the audiogenic kindling model. Epilepsia 2008, 49, 1160–1168. [Google Scholar] [CrossRef] [PubMed]
- Feng, H.J.; Faingold, C.L. Synaptic plasticity in the pathway from the medial geniculate body to the lateral amygdala is induced by seizure repetition. Brain Res. 2002, 946, 198–205. [Google Scholar] [CrossRef] [PubMed]
- Tupal, S.; Faingold, C.L. Audiogenic kindling induces plastic changes in the neuronal firing patterns in periaqueductal gray. Brain Res. 2011, 1377, 60–66. [Google Scholar] [CrossRef]
- Aleksandrova, E.P.; Ivlev, A.P.; Kulikov, A.A.; Naumova, A.A.; Glazova, M.V.; Chernigovskaya, E.V. Audiogenic kindling activates glutamatergic system in the hippocampus of rats with genetic predisposition to audiogenic seizures. Brain Res. 2024, 1829, 148792. [Google Scholar] [CrossRef]
- Hochgerner, H.; Singh, S.; Tibi, M.; Lin, Z.; Skarbianskis, N.; Admati, I.; Ophir, O.; Reinhardt, N.; Netser, S.; Wagner, S.; et al. Neuronal types in the mouse amygdala and their transcriptional response to fear conditioning. Nat. Neurosci. 2023, 26, 2237–2249. [Google Scholar] [CrossRef]
- Catterall, W.A. Sodium, calcium, and potassium channels: Key targets for epilepsy therapy. Annu. Rev. Pharmacol. Toxicol. 2014, 54, 317–338. [Google Scholar] [CrossRef]
- Kinboshi, M.; Shimizu, S.; Tokudome, K.; Mashimo, T.; Serikawa, T.; Ito, H.; Takahashi, R.; Ikeda, A.; Ohnoa, Y. Imbalance of glutamatergic and GABAergic neurotransmission in audiogenic seizure-susceptible Leucine-rich glioma-inactivated 1 (Lgi1)-mutant rats. Heliyon 2023, 7, e17984. [Google Scholar] [CrossRef]
- Ribak, C.E. An abnormal GABAergic system in the inferior colliculus provides a basis for audiogenic seizures in genetically epilepsy-prone rats. Epilepsy Behav. 2017, 71 Pt B, 160–164. [Google Scholar] [CrossRef]
- Bertocchi, I.; Eltokhi, A.; Rozov, A.; Chi, V.N.; Jensen, V.; Bus, T.; Pawlak, V.; Serafino, M.; Sonntag, H.; Yang, B.; et al. Voltage-independent GluN2A-type NMDA receptor Ca(2+) signaling promotes audiogenic seizures, attentional and cognitive deficits in mice. Commun. Biol. 2021, 4, 59. [Google Scholar] [CrossRef]
- Galvis-Alonso, O.Y.; Cortes De Oliveira, J.A.; Garcia-Cairasco, N. Limbic epileptogenicity, cell loss and axonal reorganization induced by audiogenic and amygdala kindling in wistar audiogenic rats (WAR strain). Neuroscience 2004, 125, 787–802. [Google Scholar] [CrossRef] [PubMed]
- Savina, T.A.; Levina, S.G.; Poletaeva, I.I.; Fedotova, I.B.; Shchipakina, T.G. Audiogenic Kindling Changes the Subunit Composition of BK-Channels in Dentate Gyrus of Krushinskii–Molodkina Rats. Biochem. (Mosc.) Suppl. Ser. A Membr. Cell Biol. 2014, 8, 111–115. [Google Scholar] [CrossRef]
- Muñoz, L.J.; Carballosa-Gautam, M.M.; Yanowsky, K.; García-Atarés, N.; López, D.E. The Genetic Audiogenic Seizure Hamster from Salamanca: The GASH:Sal. Epilepsy Behav. 2017, 71, 181–192. [Google Scholar] [CrossRef] [PubMed]
- Rogawski, M.A.; Johnson, M.R. Intrinsic severity as a determinant of antiepileptic drug refractoriness. Epilepsy Curr. 2008, 8, 127–130. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Cairasco, N.; Wakamatsu, H.; Cortés de Oliveira, J.A.; Gomes, E.L.T.; Del Bel, E.A.; Mello, L.E.A.M. Neuroethological and Morphological (Neo-Timm Staining) Correlates of Limbic Recruitment during the Development of Audiogenic Kindling in Seizure Susceptible Wistar rats. Epilepsy Res. 1996, 26, 177–192. [Google Scholar] [CrossRef]
- Merico, D.; Isserlin, R.; Stueker, O.; Emili, A.; Bader, G.D. Enrichment map: A network-based method for gene-set enrichment visualization and interpretation. PLoS ONE 2010, 5, e13984. [Google Scholar] [CrossRef]
- Kutmon, M.; van Iersel, M.P.; Bohler, A.; Kelder, T.; Nunes, N.; Pico, A.R.; Evelo, C.T. PathVisio 3: An extendable pathway analysis toolbox. PLoS Comput. Biol. 2015, 11, e1004085. [Google Scholar] [CrossRef]
- Cerri, C.; Caleo, M.; Bozzi, Y. Chemokines as new inflammatory players in the pathogenesis of epilepsy. Epilepsy Res. 2017, 136, 77–83. [Google Scholar] [CrossRef]
- Krassowski, M. ComplexUpset. GitHub Repository. 2022. Available online: https://github.com/krassowski/complex-upset (accessed on 15 January 2025).
- Lex, A.; Gehlenborg, N.; Strobelt, H.; Vuillemot, R.; Pfister, H. UpSet: Visualization of Intersecting Sets. IEEE Trans. Vis. Comput. Graph. 2014, 20, 1983–1992. [Google Scholar] [CrossRef] [PubMed]
- Yu, G. enrichplot: Visualization of Functional Enrichment Result. R Package Version 1.26.6. 2025. Available online: https://yulab-smu.top/biomedical-knowledge-mining-book/ (accessed on 15 January 2025).
- Langfelder, P.; Horvath, S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinform. 2008, 9, 559. [Google Scholar] [CrossRef] [PubMed]
- Langfelder, P.; Horvath, S. Fast R functions for robust correlations and hierarchical clustering. J. Stat. Softw. 2012, 46, 1–17. [Google Scholar] [CrossRef]
- Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Mering, C.V.; et al. STRING v11: Protein–Protein Association Networks with Increased Coverage, Supporting Functional Discovery in Genome-Wide Experimental Datasets. Nucleic Acids Res. 2023, 51, D607–D616. [Google Scholar] [CrossRef]
- Grissa, D.; Junge, A.; Oprea, T.I.; Jensen, L.J. Diseases 2.0: A Weekly Updated Database of Disease-Gene Associations from Text Mining and Data Integration. Database 2022, 2022, baac019. [Google Scholar] [CrossRef]
- Piñero, J.; Ramírez-Anguita, J.M.; Saüch-Pitarch, J.; Ronzano, F.; Centeno, E.; Sanz, F.; Furlong, L.I. The DisGeNET Knowledge Platform for Disease Genomics: 2019 Update. Nucleic Acids Res. 2020, 48, D845–D855. [Google Scholar] [CrossRef]
- Vergnes, M.; Kiesmann, L.; Marescaux, C.; Depaulis, A.; Micheletti, G.; Warter, J. Kindling of audiogenic seizures in the rat. Int. J. Neurosci. 1987, 36, 167–176. [Google Scholar] [CrossRef]
- Goddard, G.V.; McIntyre, D.C.; Leech, C.K. A Permanent Change in Brain Function Resulting from Daily Electrical Stimulation. Exp. Neurol. 1969, 25, 295–330. [Google Scholar] [CrossRef]
- McNamara, J.O.; Constant Byrne, M.; Dasheiff, R.M.; Gregory Fitz, J. The Kindling Model of Epilepsy: A Review. Prog. Neurobiol. 1980, 15, 139–159. [Google Scholar] [CrossRef]
- Pitkänen, A.; Lukasiuk, K.; Dudek, F.E.; Staley, K.J. Epileptogenesis. Cold Spring Harb. Perspect. Med. 2015, 5, a022822. [Google Scholar] [CrossRef]
- Lennox, B.R.; Coles, A.J.; Vincent, A. Antibody-Mediated Encephalitis: A Treatable Cause of Schizophrenia. Br. J. Psychiatry 2012, 200, 92–94. [Google Scholar] [CrossRef] [PubMed]
- Abadi, S.; Khanbabaee, G.; Sheibani, K. Auditory Brainstem Response Wave Amplitude Characteristics as a Diagnostic Tool in Children with Speech Delay with Unknown Causes. Iran. J. Med. Sci. 2016, 41, 415–421. [Google Scholar] [PubMed]
- Bramhall, N.F.; Konrad-Martin, D.; McMillan, G.P.; Griest, S.E. Auditory Brainstem Response Altered in Humans with Noise Exposure Despite Normal Outer Hair Cell Function. Ear Hear. 2017, 38, e1–e12. [Google Scholar] [CrossRef] [PubMed]
- Milloy, V.; Fournier, P.; Benoit, D.; Noreña, A.; Koravand, A. Auditory Brainstem Responses in Tinnitus: A Review of Who, How, and What? Front. Aging Neurosci. 2017, 9, 237. [Google Scholar] [CrossRef]
- Sánchez-Benito, D.; Gómez-Nieto, R.; Hernández-Noriega, S.; Murashima, A.A.B.; de Oliveira, J.A.C.; Garcia-Cairasco, N.; López, D.E.; Hyppolito, M.A. Morphofunctional Alterations in the Olivocochlear Efferent System of the Genetic Audiogenic Seizure-Prone Hamster GASH:Sal. Epilepsy Behav. 2017, 71, 193–206. [Google Scholar] [CrossRef]
- Schaette, R.; McAlpine, D. Tinnitus with a Normal Audiogram: Physiological Evidence for Hidden Hearing Loss and Computational Model. J. Neurosci. 2011, 31, 13452–13457. [Google Scholar] [CrossRef]
- Merelli, A.; Repetto, M.; Lazarowski, A.; Auzmendi, J. Hypoxia, Oxidative Stress, and Inflammation: Three Faces of Neurodegenerative Diseases. J. Alzheimers Dis. 2021, 82, S109–S126. [Google Scholar] [CrossRef]
- Aguilar-Castillo, M.J.; Cabezudo-García, P.; García-Martín, G.; Lopez-Moreno, Y.; Estivill-Torrús, G.; Ciano-Petersen, N.L.; Oliver-Martos, B.; Narváez-Pelaez, M.; Serrano-Castro, P.J. A Systematic Review of the Predictive and Diagnostic Uses of Neuroinflammation Biomarkers for Epileptogenesis. Int. J. Mol. Sci. 2024, 25, 6488. [Google Scholar] [CrossRef]
- Rosciszewski, G.; Cadena, V.; Auzmendi, J.; Cieri, M.B.; Lukin, J.; Rossi, A.R.; Murta, V.; Villarreal, A.; Reinés, A.; Gomes, F.C.A.; et al. Detrimental Effects of HMGB-1 Require Microglial-Astroglial Interaction: Implications for the Status Epilepticus -Induced Neuroinflammation. Front. Cell Neurosci. 2019, 13, 380. [Google Scholar] [CrossRef]
- Sano, F.; Shigetomi, E.; Shinozaki, Y.; Tsuzukiyama, H.; Saito, K.; Mikoshiba, K.; Horiuchi, H.; Cheung, D.L.; Nabekura, J.; Sugita, K.; et al. Reactive astrocyte-driven epileptogenesis is induced by microglia initially activated following status epilepticus. JCI Insight. 2021, 6, e135391. [Google Scholar] [CrossRef]
- Soltani Khaboushan, A.; Yazdanpanah, N.; Rezaei, N. Neuroinflammation and Proinflammatory Cytokines in Epileptogenesis. Mol. Neurobiol. 2022, 59, 1724–1743. [Google Scholar] [CrossRef] [PubMed]
- Dyomina, A.V.; Zubareva, O.E.; Smolensky, I.V.; Vasilev, D.S.; Zakharova, M.V.; Kovalenko, A.A.; Schwarz, A.P.; Ischenko, A.M.; Zaitsev, A.V. Anakinra Reduces Epileptogenesis, Provides Neuroprotection, and Attenuates Behavioral Impairments in Rats in the Lithium-Pilocarpine Model of Epilepsy. Pharmaceuticals 2020, 13, 340. [Google Scholar] [CrossRef] [PubMed]
- Olğun, Y.; Poyraz, C.A.; Bozluolçay, M.; Konukoğlu, D.; Poyraz, B.Ç. Plasma Biomarkers in Neurodegenerative Dementias: Unrevealing the Potential of Serum Oxytocin, BDNF, NPTX1, TREM2, TNF-alpha, IL-1 and Prolactin. Curr. Alzheimer Res. 2024, 21, 109–119. [Google Scholar] [CrossRef] [PubMed]
- Koçak, M.N.; Arslan, R.; Albayrak, A.; Tekin, E.; Bayraktar, M.; Çelik, M.; Kaya, Z.; Bekmez, H.; Tavaci, T. An antihypertensive agent benidipine is an effective neuroprotective and antiepileptic agent: An experimental rat study. Neurol. Res. 2021, 43, 1069–1080. [Google Scholar] [CrossRef]
- Kocatürk, M.; Kirmit, A. Evaluation of IL-10, IFN-γ, and Thiol–Disulfide Homeostasis in Patients with Drug-Resistant Epilepsy. Neurol. Sci. 2022, 43, 485–492. [Google Scholar] [CrossRef]
- Quirico-Santos, T.; Meira, I.D.A.; Gomes, A.C.; Pereira, V.C.; Pinto, M.; Monteiro, M.; Souza, J.M.; Alves-Leon, S.V. Resection of the Epileptogenic Lesion Abolishes Seizures and Reduces Inflammatory Cytokines of Patients with Temporal Lobe Epilepsy. J. Neuroimmunol. 2013, 254, 125–130. [Google Scholar] [CrossRef]
- Hegde, M.; Lowenstein, D.H. The Search for Circulating Epilepsy Biomarkers. Biomark. Med. 2014, 8, 413–427. [Google Scholar] [CrossRef]
- de Vries, E.E.; van den Munckhof, B.; Braun, K.P.J.; van Royen-Kerkhof, A.; de Jager, W.; Jansen, F.E. Inflammatory Mediators in Human Epilepsy: A Systematic Review and Meta-Analysis. Neurosci. Biobehav. Rev. 2016, 63, 177–190. [Google Scholar] [CrossRef]
- Yang, W.; Li, G.; Cao, K.; Ma, P.; Guo, Y.; Tong, W.; Wan, J. Exogenous Insulin-like Growth Factor 1 Attenuates Acute Ischemic Stroke-Induced Spatial Memory Impairment via Modulating Inflammatory Response and Tau Phosphorylation. Neuropeptides 2020, 83, 102082. [Google Scholar] [CrossRef]
- Chen, S.F.; Jou, S.B.; Chen, N.C.; Chuang, H.Y.; Huang, C.R.; Tsai, M.H.; Tan, T.Y.; Tsai, W.C.; Chang, C.C.; Chuang, Y.C. Serum Levels of Brain-Derived Neurotrophic Factor and Insulin like Growth Factor 1 Are Associated with Autonomic Dysfunction and Impaired Cerebral Autoregulation in Impaired Cerebral Autoregulation in Patients with Epilepsy. Front. Neurol. 2018, 9, 969. [Google Scholar] [CrossRef]
- Wu, L.; Qin, Y.; Yuan, H.; Zhu, Y.; Hu, A. Anti-Inflammatory and Neuroprotective Effects of Insulin-like Growth Factor-1 Overexpression in Pentylenetetrazole (PTZ)-Induced Mouse Model of Chronic Epilepsy. Brain Res. 2022, 1785, 147881. [Google Scholar] [CrossRef] [PubMed]
- Schneider, A.; Krüger, C.; Steigleder, T.; Weber, D.; Pitzer, C.; Laage, R.; Aronowski, J.; Maurer, M.H.; Gassler, N.; Mier, W.; et al. The hematopoietic factor G-CSF is a neuronal ligand that counteracts programmed cell death and drives neurogenesis. J. Clin. Investig. 2005, 115, 2083–2098. [Google Scholar] [CrossRef] [PubMed]
- Pitzer, C.; Krüger, C.; Plaas, C.; Kirsch, F.; Dittgen, T.; Müller, R.; Laage, R.; Kastner, S.; Suess, S.; Spoelgen, R.; et al. Granulocyte-colony stimulating factor improves outcome in a mouse model of amyotrophic lateral sclerosis. Brain 2008, 131 Pt 12, 3335–3347. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Zhang, N.; Su, M.; Wang, L.; Liu, S.; Fu, Q.; Su, Q. Concentration of IL-1β, IL-7, IL-12, IL-17, CX3CL1, ITAC and relation with the seizure severity and sudden unexpected death in epilepsy patient. Seizure 2024, 121, 70–77. [Google Scholar] [CrossRef]
- Courtois, G.; Gilmore, T.D. Mutations in the NF-κB signaling pathway: Implication for human disease. Oncogene 2006, 25, 6831–6843. [Google Scholar] [CrossRef]
- Rong, Y.; Baudry, M. Seizure activity results in a rapid induction of nuclear factor-kappa B in adult but not juvenile rat limbic structures. J. Neurochem. 1996, 67, 662–668. [Google Scholar] [CrossRef]
- Cai, M.; Lin, W. The Function of NF-Kappa B During Epilepsy, a Potential Therapeutic Target. Front. Neurosci. 2022, 16, 851394. [Google Scholar] [CrossRef]
- Hu, H.; Kahrizi, K.; Musante, L.; Fattahi, Z.; Herwig, R.; Hosseini, M.; Oppitz, C.; Abedini, S.S.; Suckow, V.; Larti, F.; et al. Genetics of intellectual disability in consanguineous families. Mol. Psychiatry 2019, 24, 1027–1039. [Google Scholar] [CrossRef]
- Yamaguchi, K.; Tanaka, M.; Mizoguchi, A.; Hirata, Y.; Ishizaki, H.; Kaneko, K.; Miyoshi, J.; Takai, Y. A GDP/GTP exchange protein for the Rab3 small G protein family up-regulates a postdocking step of synaptic exocytosis in central synapses. Proc. Natl. Acad. Sci. USA 2002, 99, 14536–14541. [Google Scholar] [CrossRef]
- Panel of Early Onset or Syndromic Epilepsy v4.164. Available online: https://panelapp.genomicsengland.co.uk/panels/activity/?panel=402 (accessed on 13 December 2024).
- Quinn, J.P.; Kandigian, S.E.; Trombetta, B.A.; Arnold, S.E.; Carlyle, B.C. VGF as a biomarker and therapeutic target in neurodegenerative and psychiatric diseases. Brain Commun. 2021, 3, fcab261. [Google Scholar] [CrossRef]
- Zhao, Z.; Lange, D.J.; Ho, L.; Bonini, S.; Shao, B.; Salton, S.R.; Thomas, S.; Pasinetti, G.M. Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis. Int. J. Med. Sci. 2008, 5, 92–99. [Google Scholar] [CrossRef] [PubMed]
- Toshinai, K.; Saito, T.; Yamaguchi, H.; Sasaki, K.; Tsuchimochi, W.; Minamino, N.; Ueta, Y.; Nakazato, M. Neuroendocrine regulatory peptide-1 and -2 (NERPs) inhibit the excitability of magnocellular neurosecretory cells in the hypothalamus. Brain Res. 2014, 1563, 52–60. [Google Scholar] [CrossRef] [PubMed]
- Roy, P.R.; Link, N. Loss of neuronal Imp induces seizure behavior through Syndecan function. bioRxiv 2024. [Google Scholar] [CrossRef]
- Chauhan, P.; Philip, S.E.; Chauhan, G.; Mehra, S. The Anatomical Basis of Seizures. In Epilepsy; Chapter 2; Czuczwar, S.J., Ed.; Exon Publications: Brisbane, Australia, 2022. Available online: http://www.ncbi.nlm.nih.gov/books/NBK580614/ (accessed on 5 September 2024).
- Beletskiy, A.; Chesnokova, E.; Bal, N. Insulin-Like Growth Factor 2 As a Possible Neuroprotective Agent and Memory Enhancer-Its Comparative Expression, Processing and Signaling in Mammalian CNS. Int. J. Mol. Sci. 2021, 22, 1849. [Google Scholar] [CrossRef]
- Pan, J.; Ho, M. Role of glypican-1 in regulating multiple cellular signaling pathways. Am. J. Physiol. Cell Physiol. 2021, 321, C846–C858. [Google Scholar] [CrossRef]
- Jen, Y.H.; Musacchio, M.; Lander, A.D. Glypican-1 controls brain size through regulation of fibroblast growth factor signaling in early neurogenesis. Neural Dev. 2009, 4, 33. [Google Scholar] [CrossRef]
- Ohmi, K.; Zhao, H.Z.; Neufeld, E.F. Defects in the medial entorhinal cortex and dentate gyrus in the mouse model of Sanfilippo syndrome type B. PLoS ONE 2011, 6, e27461. [Google Scholar] [CrossRef]
- Lau, E.; Margolis, R.U. Inhibitors of slit protein interactions with the heparan sulphate proteoglycan glypican-1: Potential agents for the treatment of spinal cord injury. Clin. Exp. Pharmacol. Physiol. 2010, 37, 417–421. [Google Scholar] [CrossRef]
- Ma, K.G.; Hu, H.B.; Zhou, J.S.; Ji, C.; Yan, Q.S.; Peng, S.M.; Ren, L.-D.; Yang, B.-N.; Xiao, X.-L.; Ma, Y.-B.; et al. Neuronal Glypican4 promotes mossy fiber sprouting through the mTOR pathway after pilocarpine-induced status epilepticus in mice. Exp. Neurol. 2022, 347, 113918. [Google Scholar] [CrossRef]
- Xiong, Y.; Zhang, Y.; Zheng, F.; Yang, Y.; Xu, X.; Wang, W.; Zhu, B.; Wang, X. Expression of Glypican-4 in the brains of epileptic patients and epileptic animals and its effects on epileptic seizures. Biochem. Biophys. Res. Commun. 2016, 478, 241–246. [Google Scholar] [CrossRef]
- Zhu, B.; Zha, J.; Long, Y.; Hu, X.; Chen, G.; Wang, X. Increased expression of copine VI in patientswith refractory epilepsy and a rat model. J. Neurol. Sci. 2016, 360, 30–36. [Google Scholar] [CrossRef] [PubMed]
- Umeda, S.; Kanda, M.; Koike, M.; Tanaka, H.; Miwa, T.; Tanaka, C.; Kobayashi, D.; Suenaga, M.; Hayashi, M.; Yamada, S.; et al. Copine 5 expression predicts prognosis following curative resection of esophageal squamous cell carcinoma. Oncol. Rep. 2018, 40, 3772–3780. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Wang, R.; Wei, B.; Peng, C.; Wang, L.; Hu, G.; Kong, D.; Du, C. Candidate biomarkers and molecular mechanism investigation for glioblastoma multiforme utilizing WGCNA. Biomed. Res. Int. 2018, 2018, 4246703. [Google Scholar] [CrossRef] [PubMed]
- Vitali, T.; Girald-Berlingeri, S.; Randazzo, P.A.; Chen, P.W. Arf GAPs: A family of proteins with disparate functions that converge on a common structure, the integrin adhesion complex. Small GTPases 2017, 10, 280–288. [Google Scholar] [CrossRef]
- Ahn, J.Y.; Hu, Y.; Kroll, T.G.; Allard, P.; Ye, K. PIKE-A is amplified in human cancers and prevents apoptosis by up-regulating Akt. Proc. Natl. Acad. Sci. USA 2004, 101, 6993–6998. [Google Scholar] [CrossRef]
- Navarro-Corcuera, A.; López-Zabalza, M.J.; Martínez-Irujo, J.J.; Álvarez-Sola, G.; Ávila, M.A.; Iraburu, M.J.; Ansorena, E.; Montiel-Duarte, C. Role of AGAP2 in the profibrogenic effects induced by TGFβ in LX-2 hepatic stellate cells. BBA-Mol. Cell Res. 2019, 1866, 673–685. [Google Scholar] [CrossRef]
- Fricker, L.D.; Snyder, S.H. Enkephalin convertase: Purification and characterization of a specific enkephalin synthesizing carboxypeptidase localized to adrenal chromaffin granules. Proc. Natl. Acad. Sci. USA 1982, 79, 3886–3890. [Google Scholar] [CrossRef]
- Xiao, L.; Yang, X.; Loh, Y.P. Neurotrophic, gene regulation, and cognitive functions of carboxypeptidase E-neurotrophic factor-alpha1 and its variants. Front. Neurosci. 2019, 13, 243. [Google Scholar] [CrossRef]
- Chougule, A.; Kolli, V.; Baroi, S.; Ebraheim, N.; Czernik, P.J.; Loh, Y.P.; Lecka-Czernik, B. Nonenzymatic and trophic activities of carboxypeptidase E regulate bone mass and bioenergetics of skeletal stem cells in mice. JBMR Plus 2020, 4, e10392. [Google Scholar] [CrossRef]
- Xiao, L.; Sharma, V.K.; Toulabi, L.; Yang, X.; Lee, C.; Abebe, D.; Peltekian, A.; Arnaoutova, I.; Lou, H.; Loh, Y.P. Neurotrophic factor-alpha1, a novel tropin is critical for the prevention of stress-induced hippocampal CA3 cell death and cognitive dysfunction in mice: Comparison to BDNF. Transl. Psychiatry 2021, 11, 24. [Google Scholar] [CrossRef]
- Xiao, L.; Yang, X.; Sharma, V.K.; Abebe, D.; Loh, Y.P. Hippocampal Delivery of Neurotrophic Factor-α1/Carboxypeptidase E Gene Prevents Neurodegeneration, Amyloidosis, and Memory Loss in Alzheimer’s Disease Male Mice. Mol. Psychiatry 2023, 28, 3332–3342. [Google Scholar] [CrossRef] [PubMed]
- Woronowicz, A.; Cawley, N.X.; Peng Loh, Y. Carbamazepine Prevents Hippocampal Neurodegeneration in Mice Lacking the Neuroprotective Protein, Carboxypetidase E. Clin. Pharmacol. Biopharm. 2012, (Suppl. S1), 2. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Chen, Y.; Keane, F.M.; Gorrell, M.D. Advances in understanding the expression and function of dipeptidyl peptidase 8 and 9. Mol. Cancer Res. 2013, 11, 1487–1496. [Google Scholar] [CrossRef] [PubMed]
- Sato, T.; Tatekoshi, A.; Takada, K.; Iyama, S.; Kamihara, Y.; Jawaid, P.; Rehman, M.U.; Noguchi, K.; Kondo, T.; Kajikawa, S.; et al. DPP8 is a novel therapeutic target for multiple myeloma. Sci. Rep. 2019, 9, 18094. [Google Scholar] [CrossRef]
- Zhong, F.L.; Robinson, K.; Teo, D.E.T.; Tan, K.Y.; Lim, C.; Harapas, C.R.; Yu, C.-H.; Xie, W.H.; Sobota, R.M.; Au, V.B.; et al. Human DPP9 represses NLRP1 inflammasome and protects against autoinflammatory diseases via both peptidase activity and FIIND domain binding. J. Biol. Chem. 2018, 293, 18864–18878. [Google Scholar] [CrossRef]
- Okondo, M.C.; Rao, S.D.; Taabazuing, C.Y.; Chui, A.J.; Poplawski, S.E.; Johnson, D.C.; Bachovchin, D.A. Inhibition of Dpp8/9 activates the Nlrp1b inflammasome. Cell Chem. Biol. 2018, 25, 262–267. [Google Scholar] [CrossRef]
- Jin, G.; Zhang, Z.; Wan, J.; Wu, X.; Liu, X.; Zhang, W. G3BP2: Structure and function. Pharmacol. Res. 2022, 186, 106548. [Google Scholar] [CrossRef]
- Ivanov, P.; Kedersha, N.; Anderson, P. Stress granules and processing bodies in translational control. Cold Spring Harb. Perspect. Biol. 2019, 11, a032813. [Google Scholar] [CrossRef]
- Moscovicz, F.; Taborda, C.; Fernández, F.; Borda, N.; Auzmendi, J.; Lazarowski, A. Ironing out the Links: Ferroptosis in epilepsy and SUDEP. Epilepsy Behav. 2024, 157, 109890. [Google Scholar] [CrossRef]
- Lazarowski, A.; Vitale, A.A.; Auzmendi, J.A.; Pomilio, A.B. Iron: From normal homeostasis to death by ferroptosis. Acta Bioquím Clín. Latinoam. 2022, 56, 491–513. [Google Scholar]
- Li, H.; Lin, P.H.; Gupta, P.; Li, X.; Zhao, S.L.; Zhou, X.; Li, Z.; Wei, S.; Xu, L.; Han, R.; et al. MG53 suppresses tumor progression and stress granule formation by modulating G3BP2 activity in non-small cell lung cancer. Mol. Cancer. 2021, 20, 118. [Google Scholar] [CrossRef] [PubMed]
- Quinonez, S.C.; Thoene, J.G.; Adam, M.P.; Feldman, J.; Mirzaa, G.M. Dihydrolipoamide Dehydrogenase Deficiency. In GeneReviews® [Internet]; Adam, M.P., Feldman, J., Mirzaa, G.M., Pagon, R.A., Wallace, S.E., Amemiya, A., Eds.; University of Washington: Seattle, WA, USA, 2014; pp. 1993–2025. [Google Scholar]
- Cameron, J.M.; Levandovskiy, V.; MacKay, N.; Raiman, J.; Renaud, D.L.; Clarke, J.T.R.; Feigenbaum, A.; Elpeleg, O.; Robinson, B.H. Novel Mutations in Dihydrolipoamide Dehydrogenase Deficiency in Two Cousins with Borderline-Normal PDH Complex Activity. Am. J. Med. Genet. Part A 2006, 140, 1542–1552. [Google Scholar] [CrossRef] [PubMed]
- Majd, H.; King, M.S.; Smith, A.C.; Kunji, E.R.S. Pathogenic Mutations of the Human Mitochondrial Citrate Carrier SLC25A1 Lead to Impaired Citrate Export Required for Lipid, Dolichol, Ubiquinone and Sterol Synthesis. Biochim. Biophys. Acta-Bioenerg. 2018, 1859, 1–7. [Google Scholar] [CrossRef] [PubMed]
- García-Cazorla, À.; Verdura, E.; Juliá-Palacios, N.; Anderson, E.N.; Goicoechea, L.; Planas-Serra, L.; Tsogtbaatar, E.; Dsouza, N.R.; Schlüter, A.; Urreizti, R.; et al. Impairment of the Mitochondrial One-Carbon Metabolism Enzyme SHMT2 Causes a Novel Brain and Heart Developmental Syndrome. Acta Neuropathol. 2020, 140, 971–975. [Google Scholar] [CrossRef]
- Aki, D.; Zhang, W.; Liu, Y.C. The E3 Ligase Itch in Immune Regulation and Beyond. Immunol. Rev. 2015, 266, 6–26. [Google Scholar] [CrossRef]
- Lin, X.; Zhang, H.; Boyce, B.F.; Xing, L. Ubiquitination of Interleukin-1α Is Associated with Increased pro-Inflammatory Polarization of Murine Macrophages Deficient in the E3 Ligase ITCH. J. Biol. Chem. 2020, 295, 11764–11775. [Google Scholar] [CrossRef]
- Fang, Y.; He, Y.; Zhai, B.; Hou, C.; Xu, R.; Xing, C.; Wang, X.; Ma, N.; Han, G.; Wang, R. The E3 Ubiquitin Ligase Itch Deficiency Promotes Antigen-Driven B-Cell Responses in Mice. Eur. J. Immunol. 2021, 51, 103–114. [Google Scholar] [CrossRef]
- Peng, S.F.; Fu, Y. FYN: Emerging Biological Roles and Potential Therapeutic Targets in Cancer. J. Transl. Med. 2023, 21, 84. [Google Scholar] [CrossRef]
- Cain, D.P.; Grant, S.G.N.; Saucier, D.; Hargreaves, E.L.; Kandel, E.R. Fyn tyrosine kinase is required for normal amygdala kindling. Epilepsy Res. 1995, 22, 107–114. [Google Scholar] [CrossRef]
- Luo, X.M.; Zhao, J.; Wu, W.Y.; Fu, J.; Li, Z.Y.; Zhang, M.; Lu, J. Post-Status Epilepticus Treatment with the Fyn Inhibitor, Saracatinib, Improves Cognitive Function in Mice. BMC Neurosci. 2021, 22, 2. [Google Scholar] [CrossRef]
- Putra, M.; Puttachary, S.; Liu, G.; Lee, G.; Thippeswamy, T. Fyn-tau Ablation Modifies PTZ-Induced Seizures and Post-seizure Hallmarks of Early Epileptogenesis. Front. Cell Neurosci. 2020, 14, 592374. [Google Scholar] [CrossRef] [PubMed]
- Bae, Y.S.; Chung, W.; Han, K.; Park, K.Y.; Kim, H.; Kim, E.; Kim, M.H. Down-regulation of RalBP1 expression reduces seizure threshold and synaptic inhibition in mice. Biochem Biophys. Res. Commun. 2013, 433, 175–180. [Google Scholar] [CrossRef] [PubMed]
- Bonham, L.W.; Karch, C.M.; Fan, C.C.; Tan, C.; Geier, E.G.; Wang, Y.; Wen, N.; Broce, I.J.; Li, Y.; Barkovich, M.J.; et al. CXCR4 Involvement in Neurodegenerative Diseases. Transl. Psychiatry 2018, 8, 73. [Google Scholar] [CrossRef] [PubMed]
- Hazelett, C.C.; Sheff, D.; Yeaman, C. RalA and RalB Differentially Regulate Development of Epithelial Tight Junctions. Mol. Biol. Cell 2011, 22, 4787–4800. [Google Scholar] [CrossRef] [PubMed]
- Polzin, A.; Shipitsin, M.; Goi, T.; Feig, L.A.; Turner, T.J. Ral-GTPase Influences the Regulation of the Readily Releasable Pool of Synaptic Vesicles. Mol. Cell. Biol. 2002, 22, 1714–1722. [Google Scholar] [CrossRef]
- Hu, H.; Nan, J.; Sun, Y.; Zhu, D.; Xiao, C.; Wang, Y.; Zhu, L.; Wu, Y.; Zhao, J.; Wu, R.; et al. Electron Leak from NDUFA13 within Mitochondrial Complex I Attenuates Ischemia-Reperfusion Injury via Dimerized STAT3. Proc. Natl. Acad. Sci. USA 2017, 114, 11908–11913. [Google Scholar] [CrossRef]
- Jakkamsetti, V.; Marin-Valencia, I.; Ma, Q.; Good, L.B.; Terrill, T.; Rajasekaran, K.; Pichumani, K.; Khemtong, C.; Hooshyar, M.A.; Sundarrajan, C.; et al. Brain Metabolism Modulates Neuronal Excitability in a Mouse Model of Pyruvate Dehydrogenase Deficiency. Sci. Transl. Med. 2019, 11, eaan0457. [Google Scholar] [CrossRef]
- Lee, J.; Choi, J.; Selen Alpergin, E.S.; Zhao, L.; Hartung, T.; Scafidi, S.; Riddle, R.C.; Wolfgang, M.J. Loss of Hepatic Mitochondrial Long-Chain Fatty Acid Oxidation Confers Resistance to Diet-Induced Obesity and Glucose Intolerance. Cell Rep. 2017, 20, 655–667. [Google Scholar] [CrossRef]
- Ohanele, C.; Peoples, J.N.; Karlstaedt, A.; Geiger, J.T.; Gayle, A.D.; Ghazal, N.; Sohani, F.; Brown, M.E.; Davis, M.E.; Porter, G.A., Jr.; et al. The Mitochondrial Citrate Carrier SLC25A1 Regulates Metabolic Reprogramming and Morphogenesis in the Developing Heart. Commun. Biol. 2024, 7, 1422. [Google Scholar] [CrossRef]
- Abboud, T.; Rohde, V.; Mielke, D. Mini Review: Current Status and Perspective of S100B Protein as a Biomarker in Daily Clinical Practice for Diagnosis and Prognosticating of Clinical Outcome in Patients with Neurological Diseases with Focus on Acute Brain Injury. BMC Neurosci. 2023, 244, 38. [Google Scholar] [CrossRef]
- Donato, R.; Sorci, G.; Bianchi, R.; Riuzzi, F.; Tubaro, C.; Arcuri, C.; Giambanco, I. S100B Protein, a Damage-Associated Molecular Pattern Protein in the Brain and Heart, and Beyond. Cardiovasc. Psychiatry Neurol. 2010, 2010, 656481. [Google Scholar] [CrossRef]
- Khamis, M.; El Din, N.S.; Nada, M.A.; Afifi, H.E.D.M. Serum Protein S-100B as a Novel Biomarker of Diagnosis and Prognosis of Childhood Epilepsy. Egypt. J. Neurol. Psychiatry Neurosurg. 2023, 59, 19. [Google Scholar] [CrossRef]
- Somera-Molina, K.C.; Nair, S.; Van Eldik, L.J.; Watterson, D.M.; Wainwright, M.S. Enhanced Microglial Activation and Proinflammatory Cytokine Upregulation Are Linked to Increased Susceptibility to Seizures and Neurologic Injury in a “two-Hit” Seizure Model. Brain Res. 2009, 1282, 162–172. [Google Scholar] [CrossRef] [PubMed]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef]
- García-Peral, C.; Ledesma, M.M.; Herrero-Turrión, M.J.; Gómez-Nieto, R.; Castellano, O.; López, D.E. Proteomic and Bioinformatic Tools to Identify Potential Hub Proteins in the Audiogenic Seizure-Prone Hamster GASH/Sal. Diagnostics 2023, 13, 1048. [Google Scholar] [CrossRef]
- Choi, M.; Chang, C.Y.; Clough, T.; Broudy, D.; Killeen, T.; MacLean, B.; Vitek, O. MSstats: An R package for statistical analysis of quantitative mass spectrometry-based proteomic experiments. Bioinformatics 2014, 30, 2524–2526. [Google Scholar] [CrossRef]
- Leek, J.T.; Johnson, W.E.; Parker, H.S.; Fertig, E.J.; Jaffe, A.E.; Zhang, Y.; Storey, J.D.; Torres, L.C. sva: Surrogate Variable Analysis. bioRxiv 2024. [Google Scholar] [CrossRef]
- Hao, Y.; Stuart, T.; Kowalski, M.H.; Choudhary, S.; Hoffman, P.; Hartman, A.; Srivastava, A.; Molla, G.; Madad, S.; Fernandez-Granda, C.; et al. Dictionary Learning for Integrative, Multimodal and Scalable Single-Cell Analysis. Nat. Biotechnol. 2023, 42, 293–304. [Google Scholar] [CrossRef]
- Wickham, H.; Henry, L. purrr: Functional Programming Tools. R Package Version 1.0.2. Available online: https://github.com/tidyverse/purrr (accessed on 10 October 2024).
- Cohen, J. Statistical Power Analysis for the Behavioral Sciences, 2nd ed.; Lawrence Erlbaum: Hillsdale, NJ, USA, 1988. [Google Scholar]
- Uniprot. Available online: https://www.uniprot.org/ (accessed on 24 June 2024).
- Kolberg, L.; Raudvere, U.; Kuzmin, I.; Vilo, J.; Peterson, H. gprofiler2-an R package for gene list functional enrichment analysis and namespace conversion toolset g:Profiler. F1000Research 2020, 9, 709. [Google Scholar] [CrossRef]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef]
- Mootha, V.K.; Lindgren, C.M.; Eriksson, K.F.; Subramanian, A.; Sihag, S.; Lehar, J.; Puigserver, P.; Carlsson, E.; Ridderstråle, M.; Laurila, E.; et al. PGC-1α-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat. Genet. 2003, 34, 267–273. [Google Scholar] [CrossRef] [PubMed]
- Liberzon, A.; Birger, C.; Thorvaldsdóttir, H.; Ghandi, M.; Mesirov, J.P.; Tamayo, P. The Molecular Signatures Database (MSigDB) Hallmark Gene Set Collection. Cell Syst. 2015, 1, 417–425. [Google Scholar] [CrossRef] [PubMed]
- Reimand, J.; Isserlin, R.; Voisin, V.; Kucera, M.; Tannus-Lopes, C.; Rostamianfar, A.; Wadi, L.; Meyer, M.; Wong, J.; Xu, C.; et al. Pathway enrichment analysis and visualization of omics data using g:Profiler, GSEA, Cytoscape and EnrichmentMap. Nat. Protoc. 2019, 14, 482–517. [Google Scholar] [CrossRef] [PubMed]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef]
- Agrawal, A.; Balcı, H.; Hanspers, K.; Coort, S.L.; Martens, M.; Slenter, D.N.; Ehrhart, F.; Digles, D.; Waagmeester, A.; Wassink, I.; et al. WikiPathways 2024: Next generation pathway database. Nucleic Acids Res. 2024, 52, D679–D689. [Google Scholar] [CrossRef]
- Schmittgen, T.D.; Livak, K.J. Analyzing Real-Time PCR Data by the Comparative CT Method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
Protein Symbol | Protein Name | Epilepsy Score |
---|---|---|
SLC1A2 | Excitatory Amino Acid Transporter 2 | 0.800 |
CYFIP2 | Cytoplasmic FMR1-interacting Protein 2 | 0.700 |
SLC1A3 | Excitatory Amino Acid Transporter 1 | 0.693 |
AKT1 | RAC-alpha serine/threonine-protein kinase | 0.677 |
S100B | S100 calcium-binding protein B | 0.527 |
Seizure Index | ||
---|---|---|
SI | Seizure Behaviors | Score |
0.00 | No seizures | 0 |
0.11 | One wild running | 1 |
0.23 | One wild running (running plus jumping plus atonic fall) | 2 |
0.38 | Two wild runnings | 3 |
0.61 | Tonic convulsion (opisthotonus) | 4 |
0.85 | Tonic seizures plus generalized clonic convulsions | 5 |
0.90 | Head ventral flexion plus cSI5 | 6 |
0.95 | Forelimb extension plus cSI6 | 7 |
1.00 | Hindlimb extension plus cSI7 | 8 |
Categories, which are generally followed by hindlimb clonic convulsions (CCV2) |
Amplicon Size and Primers Used for the RT-qPCR Experiments | ||
---|---|---|
Gene Amplified | Sequence (5′-3′) | Amplicon (pb) |
Gpc1 | GCTGCCGACTGATGACTACT | 214 |
CAACTTCATGATGGCCCGAG | ||
Sdc3 | CCTCCACGACAACACCATTG | 147 |
ATGAGCAGTGTGACCAGGAA | ||
Vgf | GACCATCGCTCGTACTCCAG | 167 |
AACAGAAGAGGACGGATGCC | ||
Cpe | CCAACGCAACCATCTCCG | 101 |
TGTAAGTTTGTAGTTTCCAGGCG | ||
G3bp2 | GTTCAATCCCAGCCACCAAG | 160 |
TGCCAACGAAAAGCTGATGA | ||
Cpne5 | GTGGAGTCAGAGAGCACCTT | 125 |
CTCATGTAGTGCAGGGACGT | ||
Agap2 | CAGGAATGGACTTTGAGCCG | 188 |
CGGATCAGGACCAGATGAGT | ||
Madd | ACTCTCAAACGTCTGGTGGA | 136 |
GGGCACTTGACTTCTCTTCC | ||
Ikbkg | AATCTGAGAGGTCGGGTTCC | 121 |
TGCACCATTTCACTCAACTGG | ||
Dpp8 | CCATCAACAGAGCAGCAGTC | 135 |
TTCCCACAGTTCCAATTCGC | ||
Slc25a1 | CACGTTGGACTGTGCCTTG | 133 |
GCAGCTTCACCACTTCATCG | ||
Shmt2 | CCTGGGGTCCTGTCTGAAC | 141 |
AGGGTCCAGATCAAAGGCTT | ||
Dld | AAAACATCCTTATAGCCACGGG | 152 |
TTCTACACCAATTACTCCTGCG | ||
Ralb | TCCGTGACAACTACTTCCGA | 100 |
GACTTGTTGCCCACGACC | ||
Itch | CTGCATCGAGAAAGTTGGGA | 84 |
CTCTTGTAGGGTGGGAGGTC | ||
Fyn | ACTCTTCCTCTCACACTGGC | 104 |
ACTCAGGTCATCTTCCGTCC | ||
Slc1a2 | CACCGTTGCCAGATCGTG | 117 |
CTGAGGTGGCTGTCGTGC | ||
Slc1a3 | GGCAAGCCCTGAGAGATTTC | 107 |
CCCTGCGATCAAGAAGAGGA | ||
Akt1 | CAAGGAGATCATGCAGCACC | 112 |
CCTGGTATCCGTCTCAGAGG | ||
Cyfip2 | CATCTGTGTGGATTACTACGAGA | 81 |
CCAAAGCCCATCACCTTGAG | ||
S100b | GAGGACACCAGCAGCAAAC | 125 |
ACCCTCTCGTCCTGAATACTG | ||
β-act | AGCCATGTACGTAGCCATCC | 115 |
ACCCTCATAGATGGGCACAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zeballos, L.; García-Peral, C.; Ledesma, M.M.; Auzmendi, J.; Lazarowski, A.; López, D.E. Changes in the Proteomic Profile After Audiogenic Kindling in the Inferior Colliculus of the GASH/Sal Model of Epilepsy. Int. J. Mol. Sci. 2025, 26, 2331. https://doi.org/10.3390/ijms26052331
Zeballos L, García-Peral C, Ledesma MM, Auzmendi J, Lazarowski A, López DE. Changes in the Proteomic Profile After Audiogenic Kindling in the Inferior Colliculus of the GASH/Sal Model of Epilepsy. International Journal of Molecular Sciences. 2025; 26(5):2331. https://doi.org/10.3390/ijms26052331
Chicago/Turabian StyleZeballos, Laura, Carlos García-Peral, Martín M. Ledesma, Jerónimo Auzmendi, Alberto Lazarowski, and Dolores E. López. 2025. "Changes in the Proteomic Profile After Audiogenic Kindling in the Inferior Colliculus of the GASH/Sal Model of Epilepsy" International Journal of Molecular Sciences 26, no. 5: 2331. https://doi.org/10.3390/ijms26052331
APA StyleZeballos, L., García-Peral, C., Ledesma, M. M., Auzmendi, J., Lazarowski, A., & López, D. E. (2025). Changes in the Proteomic Profile After Audiogenic Kindling in the Inferior Colliculus of the GASH/Sal Model of Epilepsy. International Journal of Molecular Sciences, 26(5), 2331. https://doi.org/10.3390/ijms26052331