Molecular Phylogenetic Evidence and Biogeographic History of Indian Endemic Portulaca L. (Portulacaceae) Species
Abstract
:1. Introduction
2. Materials and Methods
2.1. Taxon Sampling and DNA Extraction
2.2. PCR and DNA Sequencing
2.3. Sequence Alignment and Phylogenetic Analyses
2.4. Biogeographic Analysis
3. Results
3.1. Phylogenetic Analyses
3.2. Historical Biogeography Reconstructions
S-DIVA Analysis
4. Discussion
4.1. Systematic Positions and Morphological Relationships of Indian Endemic Species with Their Closely Related Species
4.2. Biogeographic History of Indian Endemic Species
4.3. Taxonomic Treatment for Indian Endemic PORTULACA Species
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ocampo, G.; Columbus, J.T. Molecular phylogentics, historical biogeography, and chromosome number evolution of Portulaca (Portulacaceae). Mol. Phylogenet. Evol. 2012, 63, 97–112. [Google Scholar] [CrossRef]
- Ocampo, G. Morphological characterization of seeds in Portulacaceae. Phytotaxa 2013, 141, 1–24. [Google Scholar] [CrossRef] [Green Version]
- Dalavi, J.; Deshmukh, P.; Jadhav, V.; Yadav, S. Two new species of Portulaca (Portulacaceae) from India. Phytotaxa 2018, 376, 68–76. [Google Scholar] [CrossRef]
- Dalavi, J.V.; Chougule, R.N.; Jadhav, V.D.; Yadav, S.R. Variation in seed micromorphology in Portulaca L. (Portulacaceae) in India. Phytomorphology 2019, 69, 15–24. [Google Scholar]
- Plants of the World. Kew Science. 2021. Available online: www.plantssoftheworldonline.org (accessed on 1 June 2021).
- Sivarajan, V.V. Taxonomic notes of the genus Portulaca Linn from India. J. Bombay Nat. Hist. Soc. 1981, 78, 256–260. [Google Scholar]
- Singh, B.D.; Sanjappa, M. Volume of India; Botanical Survey of India: Culcutta, India, 1993; Volume 3, 10p.
- Sivaramkrishna, P.; Yugandhar, P. A new species of the genus Portulaca L. (Portulacaceae) from the Eastern Ghats, India. J. Asia Pac. Biodivers. 2020, 13, 755–761. [Google Scholar] [CrossRef]
- Dalavi, J.D. Flora of Bagalkot District and Bioprospecting of Some Promising Wild Edible Plants. Ph.D. Thesis, Shivaji University, Kolhapur, India, 2021. [Google Scholar]
- Ocampo, G. A new species of Portulaca (Portulacaceae) from central Mexico. Phytotaxa 2018, 347, 89–95. [Google Scholar] [CrossRef]
- Ocampo, G. Portulaca almeviae (Portulacaceae), a new species from the pacific coast of Mexico. Phytotaxa 2019, 413, 289–295. [Google Scholar]
- Jain, S.K.; Rao, R.R. Handbook of Field and Herbarium Mrthods; Today & Tommorrow Printers and Publishers: New Delhi, India, 1977; pp. 50–80. [Google Scholar]
- Paterson, A.; Brubaker, C.; Wendel, J. A rapid method for extraction of cotton (Gossypium spp.) genomic DNA suitable for RFLP or PCR analysis. Plant. Mol. Biol. Rep. 1993, 11, 122–127. [Google Scholar] [CrossRef]
- Tamboli, A.S.; Dalavi, J.V.; Kadam, S.K.; Yadav, S.R.; Govindwar, S.P.; Simoes, A.R.G. New molecular phylogenetic evidence for Indian endemic species of the tribe Merremieae. Convolvulaceae. Plant. Biosyst. 2021. [Google Scholar] [CrossRef]
- Gene Codes Corporation. Sequencher 5.1 Gene Codes Corporation. Ann Arbor, Michigan. 2012. Available online: http://genecodes.com/ (accessed on 20 January 2022).
- Edgar, R.C. MUSCLE: A multiple sequence alignment method with reduced time and space complexity. BMC Bioinform. 2004, 5, 113–131. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Talavera, G.; Castresana, J. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 2007, 56, 564–577. [Google Scholar] [CrossRef] [Green Version]
- Farris, J.D.; Kallersjo, M.; Kluge, A.G.; Bult, C. Testing significance of incongruence. Cladistics 1994, 10, 315–319. [Google Scholar] [CrossRef]
- Swofford, D.L. PAUP* Phylogenetic Analysis Using Parsimony (* and Other Methods), Version 4; Sinauer Associates: Sunderland, MA, USA, 2002. [Google Scholar]
- Vaidya, G.; Lohman, D.J.; Meier, R. SequenceMatrix: Concatenation software for the fast assembly of multigene datasets with character set and codon information. Cladistics 2011, 27, 171–180. [Google Scholar] [CrossRef]
- Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. jModelTest 2: More models, new heuristics and parallel computing. Nat. Methods. 2012, 9, 772–775. [Google Scholar] [CrossRef] [Green Version]
- Miller, M.A.; Pfeiffer, W.; Schwartz, T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the Gateway Computing Environments Workshop (GCE), New Orleans, LA, USA, 14 November 2010; pp. 1–8. [Google Scholar]
- Ronquist, F.; Huelsenbeck, J.P. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Green Version]
- Drummond, A.J.; Suchard, M.A.; Xie, D.; Rambaut, A. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Mol. Biol. Evol. 2012, 29, 1969–1973. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.D.; Bhatt, D.; Zuckerman, D.M. Automated sampling assessment for molecular simulations using the effective sample size. J. Chem. Theory Comput. 2010, 6, 3048–3057. [Google Scholar] [CrossRef]
- Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [Google Scholar] [CrossRef]
- Yu, Y.; Harris, A.J.; Blair, C.; He, X. RASP (Reconstruct Ancestral State in Phylogenies): A tool for historical biogeography. Mol. Phylogenet. Evol. 2015, 87, 46–49. [Google Scholar] [CrossRef]
- Ali, S.S.; Yu, Y.; Pfosser, M.; Wetschnig, W. Inferences of biogeographical histories within subfamily Hyacinthoideae using S-DIVA and Bayesian binary MCMC analysis implemented in RASP (Reconstruct Ancestral State in Phylogenies). Ann. Bot. 2012, 109, 95–107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Legrand, D. Desmembración del género Portulaca II. Com. Bot. Mus. Hist. Nat. 1958, 3, 1–17. [Google Scholar]
- Geesink, R. An account of the genus Portulaca in Indo-Australia and the Pacific. Blumea 1969, 17, 275–301. [Google Scholar]
- Sage, R.F. Atmospheric CO2, environmental stress, and the evolution of C4 photosynthesis. In A History of Atmospheric CO2 and Its Effects on Plants, Animals, and Ecosystems; Ehleringer, J.R., Cerling, T.E., Dearing, M.D., Eds.; Springer: New York, NY, USA, 2005; pp. 185–213. [Google Scholar]
- Applequist, W.L.; Wallace, R.S. Phylogeny of the Portulacaceous cohort based on ndhF sequence data. Syst. Bot. 2001, 26, 406–419. [Google Scholar]
- Ocampo, G.; Columbus, J.T. Molecular phylogenetics of suborder Cactineae (Caryophyllales), including insights into photosynthetic diversification and historical biogeography. Am. J. Bot. 2010, 97, 1827–1847. [Google Scholar] [CrossRef]
- Ridley, H.N. The Dispersal of Plants Throughout the World; L. Reeve and Co.: Ashford, UK, 1930. [Google Scholar]
- Danin, A.; Baker, I.; Baker, H.G. Cytogeography and taxonomy of the Portulaca oleracea L. polyploid complex. Israel J. Bot. 1978, 27, 177–211. [Google Scholar]
- Matthews, J.F.; Faircloth, W.R.; Allison, J.R. Portulaca biloba Urban (Portulacaceae), a species new to the United States. Syst. Bot. 1991, 16, 736–740. [Google Scholar] [CrossRef]
- Vadigi, S.; Vallepu, N.; Pujar, R.; Dalavi, J.V. New distributional record of Portulaca lakshminarasimhaniana S.R. Yadav & Dalavi (Family Portulacaceae) in the Eastern Ghats, India. J. Bombay Nat. Hist. Soc. 2021, 118. in press. [Google Scholar]
Taxa Name | Geographical Distribution | Taxa Included in Previous Molecular Phylogenies [1,10,11] | Indian Accessions Included in This Study |
---|---|---|---|
Portulaca badamica S.R.Yadav and Dalavi | Endemic to India (Badami hills of Bagalkot District, Karnataka) | - | X |
Portulaca grandiflora Hook. | South America, North America, Africa, and Asia | X | X |
Portulaca lakshminarasimhaniana S.R.Yadav and Dalavi | Endemic to India (Badami, Karnataka and Mahbubnagar, Andhra Pradesh) | - | X |
Portulaca laljii Sivaramakrishna and Yungandhar | Endemic to India (few localities of Prakasam District, Andhra Pradesh) | - | - |
Portulaca oleracea L. var. oleracea | Africa and Asia | X | X |
Portulaca oleracea var. linearifolia Sivarajan and Manilal | Endemic to India (Punjab, Uttar Pradesh, Bihar, West Bengal, Assam, Orissa, Gujarat, Maharashtra, Tamil Nadu, and Badami) | - | X |
Portulaca pilosa L. | South America, North America, Africa, Asia, and Australia | X | X |
Portulaca quadrifida L. | Africa and Asia | X | - |
Portulaca tuberosa Roxb. | Asia and Australia | X | X |
Portulaca umbraticola Kunth | South America, North America, and Asia | X | X |
Portulaca wightiana Wall. ex Wight and Arn. | Africa and Asia | X | X |
Taxa Name | Area of Collection | Voucher ID | GenBank Accession Numbers | |||
---|---|---|---|---|---|---|
ITS | ndhF | trnT-psbD | ndhA Intron | |||
P. badamica S.R.Yadav and Dalavi | Badami, Karnataka, India | JVD-1261 | OM111215 | OM160989 | MZ394024 | MZ394019 |
P. grandiflora Hook. | Kolhapur, Maharashtra, India | JVD-1264 | MZ382894 | ON058265 | - | ON058268 |
P. lakshminarasimhaniana S.R.Yadav and Dalavi | Badami, Karnataka, India | JVD-1260 | MZ382893 | OM160990 | MZ394026 | MZ394020 |
P. oleracea L. var. oleracea | Badami, Karnataka, India | JVD-1457 | - | OM160991 | MZ394028 | MZ394022 |
P. oleracea var. linearifolia Sivarajan and Manilal | Badami, Karnataka, India | JVD-1263 | - | OM160992 | - | MZ394023 |
P. pilosa L. | Badami, Karnataka, India | JVD-1259 | MZ382892 | OM160993 | MZ394025 | - |
P. tuberosa Roxb. | Badami, Karnataka, India | JVD-1681 | MZ382895 | ON058266 | - | - |
P. umbraticola Kunth | Badami, Karnataka, India | JVD-988 | - | OM160994 | OM160997 | OM160996 |
P. wightiana Wall. ex Wight and Arn. | Badami, Karnataka, India | JVD-1257 | - | ON058267 | - | MZ394021 |
Marker | Primers | Sequence (5′ to 3′) | PCR Conditions |
---|---|---|---|
ITS | ITS1 | TCCGTAGGTGAACCTGCGG | 94 °C for 4 min, 35 cycles (94 °C for 30 s, 55 °C for 1 min, and 72 °C for 1 min), and final extension at 72 °C for 10 min |
ITS5 | GGAAGTAAAAGTCGTAACAAGG | ||
ITSLeu1 | GTCCACTGAACCTTATCATTTAG | ||
ITS4 | TCCTCCGCTTATTGATATGC | ||
ndhA | ndhA×1 | GCYCAATCWATTAGTTATGAAATACC | 94 °C for 4 min, 35 cycles (94 °C for 30 s, 55 °C for 1 min, and 72 °C for 1 min), and final extension at 72 °C for 10 min |
ndhA×2 | GGTTGACGCCAMARATTCCA | ||
ndhF | ndhF_mF | ACTTTAGCTCTTGCTCAA | 94 °C for 4 min, 35 cycles (94 °C for 30 s, 50 °C for 1 min, and 72 °C for 2.5 min), and final extension at 72 °C for 7 min |
ndhF_R | CCTTCAAAAGTAAGTAAATA | ||
trnT-psbD | trnT | CCCTTTTAACTCAGTGGTAG | 94 °C for 4 min, 35 cycles (94 °C for 30 s, 55 °C for 1 min, and 72 °C for 1 min), and final extension at 72 °C for 10 min |
psbD | CTCCGTARCCAGTCATCCATA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tamboli, A.S.; Dalavi, J.V.; Kadam, S.K.; Yadav, S.R.; Govindwar, S.P.; Choo, Y.-S.; Pak, J.H. Molecular Phylogenetic Evidence and Biogeographic History of Indian Endemic Portulaca L. (Portulacaceae) Species. Diversity 2022, 14, 443. https://doi.org/10.3390/d14060443
Tamboli AS, Dalavi JV, Kadam SK, Yadav SR, Govindwar SP, Choo Y-S, Pak JH. Molecular Phylogenetic Evidence and Biogeographic History of Indian Endemic Portulaca L. (Portulacaceae) Species. Diversity. 2022; 14(6):443. https://doi.org/10.3390/d14060443
Chicago/Turabian StyleTamboli, Asif S., Jagdish V. Dalavi, Suhas K. Kadam, Shrirang R. Yadav, Sanjay P. Govindwar, Yeon-Sik Choo, and Jae Hong Pak. 2022. "Molecular Phylogenetic Evidence and Biogeographic History of Indian Endemic Portulaca L. (Portulacaceae) Species" Diversity 14, no. 6: 443. https://doi.org/10.3390/d14060443