Effects of Octylphenol and Bisphenol A on the Metal Cation Transporter Channels of Mouse Placentas
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Animals
2.3. Total RNA Extraction and Quantitative Real-Time PCR
2.4. Western Blotting
2.5. Immunohistochemical Analysis
2.6. Fetal Serum Collection and Measurement of Blood Calcium, Copper, and Iron Concentration
2.7. Statistical Analysis
3. Results
3.1. Expression of Calcium Transporter Channels in Response to Octylphenol and Bisphenol A
3.2. Expression of Copper Transporter Channels in Response to Octylphenol and Bisphenol A
3.3. Expression of Iron Transporter Channels in Response to Octylphenol and Bisphenol A
3.4. Expression Localization of Cation Transporter Channels in Mouse Placenta
3.5. Octylphenol and Bisphenol A Influence on Fetal Cations
4. Discussion
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Corcoran, J.J.; Nicholson, C.; Sweeney, M.; Charnock, J.C.; Robson, S.C.; Westwood, M.; Taggart, M.J. Human uterine and placental arteries exhibit tissue-specific acute responses to 17beta-estradiol and estrogen-receptor-specific agonists. Mol. Hum. Reprod. 2014, 20, 433–441. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Choi, K.C.; Jung, E.M.; An, B.S.; Hyun, S.H.; Jeung, E.B. Expression and regulation of sodium/calcium exchangers, NCX and NCKX, in reproductive tissues: Do they play a critical role in calcium transport for reproduction and development? Adv. Exp. Med. Biol. 2013, 961, 109–121. [Google Scholar] [PubMed]
- Olmos-Ortiz, A.; Avila, E.; Durand-Carbajal, M.; Diaz, L. Regulation of calcitriol biosynthesis and activity: Focus on gestational vitamin D deficiency and adverse pregnancy outcomes. Nutrients 2015, 7, 443–480. [Google Scholar] [CrossRef] [PubMed]
- Young, B.E.; Cooper, E.M.; McIntyre, A.W.; Kent, T.; Witter, F.; Harris, Z.L.; O’Brien, K.O. Placental vitamin D receptor (VDR) expression is related to neonatal vitamin D status, placental calcium transfer, and fetal bone length in pregnant adolescents. FASEB J. 2014, 28, 2029–2037. [Google Scholar] [CrossRef] [PubMed]
- Diamanti-Kandarakis, E.; Bourguignon, J.P.; Giudice, L.C.; Hauser, R.; Prins, G.S.; Soto, A.M.; Zoeller, R.T.; Gore, A.C. Endocrine-disrupting chemicals: An endocrine society scientific statement. Endocr. Rev. 2009, 30, 293–342. [Google Scholar] [CrossRef] [PubMed]
- Lathi, R.B.; Liebert, C.A.; Brookfield, K.F.; Taylor, J.A.; vom Saal, F.S.; Fujimoto, V.Y.; Baker, V.L. Conjugated bisphenol A in maternal serum in relation to miscarriage risk. Fertil. Steril. 2014, 102, 123–128. [Google Scholar] [CrossRef] [PubMed]
- Alonso-Magdalena, P.; Garcia-Arevalo, M.; Quesada, I.; Nadal, A. Bisphenol-A treatment during pregnancy in mice: A new window of susceptibility for the development of diabetes in mothers later in life. Endocrinology 2015, 156, 1659–1670. [Google Scholar] [CrossRef] [PubMed]
- Kunz, N.; Camm, E.J.; Somm, E.; Lodygensky, G.; Darbre, S.; Aubert, M.L.; Huppi, P.S.; Sizonenko, S.V.; Gruetter, R. Developmental and metabolic brain alterations in rats exposed to bisphenol A during gestation and lactation. Int. J. Dev. Neurosci. 2011, 29, 37–43. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.; An, B.S.; Yang, H.; Jeung, E.B. Effects of octylphenol and bisphenol A on the expression of calcium transport genes in the mouse duodenum and kidney during pregnancy. Toxicology 2013, 303, 99–106. [Google Scholar] [CrossRef] [PubMed]
- Cline, J. Calcium and vitamin D metabolism, deficiency, and excess. Top. Companion Anim. Med. 2012, 27, 159–164. [Google Scholar] [CrossRef] [PubMed]
- Gambling, L.; Dunford, S.; McArdle, H.J. Iron deficiency in the pregnant rat has differential effects on maternal and fetal copper levels. J. Nutr. Biochem. 2004, 15, 366–372. [Google Scholar] [CrossRef] [PubMed]
- Abass, R.M.; Hamdan, H.Z.; Elhassan, E.M.; Hamdan, S.Z.; Ali, N.I.; Adam, I. Zinc and copper levels in low birth weight deliveries in Medani Hospital, Sudan. BMC Res. Notes 2014, 7, 386. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Ahn, C.; Jeung, E.B. Differential expression of calcium transport genes caused by COMT inhibition in the duodenum, kidney and placenta of pregnant mice. Mol. Cell. Endocrinol. 2015, 401, 45–55. [Google Scholar] [CrossRef] [PubMed]
- McArdle, H.J.; Andersen, H.S.; Jones, H.; Gambling, L. Copper and iron transport across the placenta: Regulation and interactions. J. Neuroendocrinol. 2008, 20, 427–431. [Google Scholar] [CrossRef] [PubMed]
- Ahmed, R.G. Maternal bisphenol A alters fetal endocrine system: Thyroid adipokine dysfunction. Food Chem. Toxicol. 2016, 95, 168–174. [Google Scholar] [CrossRef] [PubMed]
- Medwid, S.; Guan, H.; Yang, K. Prenatal exposure to bisphenol A disrupts adrenal steroidogenesis in adult mouse offspring. Environ. Toxicol. Pharmacol. 2016, 43, 203–208. [Google Scholar] [CrossRef] [PubMed]
- Sainath, S.B.; Meena, R.; Kumar, C.H.; Kalapana, P.; Swetha, K.N.; Devi, N.S.; Reddy, P.S. Embryonic exposure to octylphenol induces changes in testosterone levels and disrupts reproductive efficiency in rats at their adulthood. Food Chem. Toxicol. 2011, 49, 983–990. [Google Scholar] [CrossRef] [PubMed]
- An, B.S.; Ahn, H.J.; Kang, H.S.; Jung, E.M.; Yang, H.; Hong, E.J.; Jeung, E.B. Effects of estrogen and estrogenic compounds, 4-tert-octylphenol, and bisphenol A on the uterine contraction and contraction-associated proteins in rats. Mol. Cell. Endocrinol. 2013, 375, 27–34. [Google Scholar] [CrossRef] [PubMed]
- Ahn, C.; Yang, H.; Lee, D.; An, B.S.; Jeung, E.B. Placental claudin expression and its regulation by endogenous sex steroid hormones. Steroids 2015, 100, 44–51. [Google Scholar] [CrossRef] [PubMed]
- Sarkar, A.A.; Nuwayhid, S.J.; Maynard, T.; Ghandchi, F.; Hill, J.T.; Lamantia, A.S.; Zohn, I.E. Hectd1 is required for development of the junctional zone of the placenta. Dev. Biol. 2014, 392, 368–380. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Ying, G.G.; Zhao, J.L.; Liu, S.; Zhou, L.J.; Chen, F. Removal of selected endocrine disrupting chemicals (EDCs) and pharmaceuticals and personal care products (PPCPs) during ferrate (VI) treatment of secondary wastewater effluents. Water Res. 2012, 46, 2194–2204. [Google Scholar] [CrossRef] [PubMed]
- Choi, K.C.; Leung, P.C.; Jeung, E.B. Biology and physiology of Calbindin-D9k in female reproductive tissues: Involvement of steroids and endocrine disruptors. Reprod. Biol. Endocrinol. 2005, 3, 66. [Google Scholar] [CrossRef] [PubMed]
- Amtage, F.; Birnbaum, D.; Reinhard, T.; Niesen, W.D.; Weiller, C.; Mader, I.; Meyer, P.T.; Rijntjes, M. Estrogen intake and copper depositions: Implications for Alzheimer’s disease? Case Rep. Neurol. 2014, 6, 181–187. [Google Scholar] [CrossRef] [PubMed]
- Hardman, B.; Manuelpillai, U.; Wallace, E.M.; Monty, J.F.; Kramer, D.R.; Kuo, Y.M.; Mercer, J.F.; Ackland, M.L. Expression, localisation and hormone regulation of the human copper transporter hCTR1 in placenta and choriocarcinoma Jeg-3 cells. Placenta 2006, 27, 968–977. [Google Scholar] [CrossRef] [PubMed]
- Hardman, B.; Michalczyk, A.; Greenough, M.; Camakaris, J.; Mercer, J.F.; Ackland, M.L. Hormonal regulation of the Menkes and Wilson copper-transporting ATpases in human placental Jeg-3 cells. Biochem. J. 2007, 402, 241–250. [Google Scholar] [CrossRef] [PubMed]
- Gambling, L.; Danzeisen, R.; Fosset, C.; Andersen, H.S.; Dunford, S.; Srai, S.K.; McArdle, H.J. Iron and copper interactions in development and the effect on pregnancy outcome. J. Nutr. 2003, 133 (Suppl. 1), 1554S–1556S. [Google Scholar] [PubMed]
- Millard, K.N.; Frazer, D.M.; Wilkins, S.J.; Anderson, G.J. Changes in the expression of intestinal iron transport and hepatic regulatory molecules explain the enhanced iron absorption associated with pregnancy in the rat. Gut 2004, 53, 655–660. [Google Scholar] [CrossRef] [PubMed]
- Gao, G.; Liu, S.Y.; Wang, H.J.; Zhang, T.W.; Yu, P.; Duan, X.L.; Zhao, S.E.; Chang, Y.Z. Effects of pregnancy and lactation on iron metabolism in rats. Biomed. Res. Int. 2015, 2015, 105325. [Google Scholar] [CrossRef] [PubMed]
- De Lauzon, S.; Uhrich, F.; Vandel, S.; Cittanova, N.; Jayle, M.F. Determination of progesterone and of free and conjugated estrogens in pregnant and peudo-pregnant rats. Steroids 1974, 24, 31–40. [Google Scholar] [CrossRef]
- Stuckey, R.; Aldridge, T.; Lim, F.L.; Moore, D.J.; Tinwell, H.; Doherty, N.; Davies, R.; Smith, A.G.; Kimber, I.; Ashby, J.; et al. Induction of iron homeostasis genes during estrogen-induced uterine growth and differentiation. Mol. Cell. Endocrinol. 2006, 253, 22–29. [Google Scholar] [CrossRef] [PubMed]
- Finn, C.A.; Martin, L. Hormone secretion during early pregnancy in the mouse. J. Endocrinol. 1969, 45, 57–65. [Google Scholar] [CrossRef] [PubMed]
- Barkley, M.S.; Geschwind, I.I.; Bradford, G.E. The gestational pattern of estradiol, testosterone and progesterone secretion in selected strains of mice. Biol. Reprod. 1979, 20, 733–738. [Google Scholar] [CrossRef] [PubMed]
- Virgo, B.B.; Bellward, G.D. Serum progesterone levels in the pregnant and postpartum laboratory mouse. Endocrinology 1974, 95, 1486–1490. [Google Scholar] [CrossRef] [PubMed]
- Soares, M.J. The prolactin and growth hormone families: Pregnancy-specific hormones/cytokines at the maternal-fetal interface. Reprod. Biol. Endocrinol. 2004, 2, 51. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Red-Horse, K.; Zhou, Y.; Genbacev, O.; Prakobphol, A.; Foulk, R.; McMaster, M.; Fisher, S.J. Trophoblast differentiation during embryo implantation and formation of the maternal-fetal interface. J. Clin. Investig. 2004, 114, 744–754. [Google Scholar] [CrossRef] [PubMed]
- Carter, A.M. Evolution of placental function in mammals: The molecular basis of gas and nutrient transfer, hormone secretion, and immune responses. Physiol. Rev. 2012, 92, 1543–1576. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vo, T.T.; Nguyen, P.V.; Duong, H.T.; Nguyen, T.D.; Huynh, H.T.; Nong, H.V. Potential effect of combined xenoestrogens during gestation stages on mouse offspring. J. Environ. Biol. 2015, 36, 337–344. [Google Scholar] [PubMed]
- Hubbard, A.C.; Bandyopadhyay, S.; Wojczyk, B.S.; Spitalnik, S.L.; Hod, E.A.; Prestia, K.A. Effect of dietary iron on fetal growth in pregnant mice. Comp. Med. 2013, 63, 127–135. [Google Scholar] [PubMed]
- Tait, S.; Tassinari, R.; Maranghi, F.; Mantovani, A. Bisphenol A affects placental layers morphology and angiogenesis during early pregnancy phase in mice. J. Appl. Toxicol. 2015, 35, 1278–1291. [Google Scholar] [CrossRef] [PubMed]
- Gambling, L.; Kennedy, C.; McArdle, H.J. Iron and copper in fetal development. Semin. Cell Dev. Biol. 2011, 22, 637–644. [Google Scholar] [CrossRef] [PubMed]
- Nagao, T.; Kagawa, N.; Saito, Y.; Komada, M. Developmental effects of oral exposure to diethylstilbestrol on mouse placenta. J. Appl. Toxicol. 2013, 33, 1213–1221. [Google Scholar] [CrossRef] [PubMed]
- Hirashima, M.; Lu, Y.; Byers, L.; Rossant, J. Trophoblast expression of fms-like tyrosine kinase 1 is not required for the establishment of the maternal-fetal interface in the mouse placenta. Proc. Natl. Acad. Sci. USA 2003, 100, 15637–15642. [Google Scholar] [CrossRef] [PubMed]
- Ueno, M.; Lee, L.K.; Chhabra, A.; Kim, Y.J.; Sasidharan, R.; van Handel, B.; Wang, Y.; Kamata, M.; Kamran, P.; Sereti, K.I.; et al. c-Met-dependent multipotent labyrinth trophoblast progenitors establish placental exchange interface. Dev. Cell 2013, 27, 373–386. [Google Scholar] [CrossRef] [PubMed]
Species | Gene | Primer Sequences (5′→3′) | Accession Number |
---|---|---|---|
Mouse | Trpv6 | F: GCTGGTTCTTGAGGGTGGAA | NM_022413.4 |
R: ATAGGCACCAAAGGGACGTG | |||
Pmca1 | F: GCACCAAGTTGAAAACATCTCCC | NM_026482.2 | |
R: TCTCCACAAAGTGCATTATCCCC | |||
Ctr1 | F: TATGAACCACACGGACGACAA | NM_175090.4 | |
R: GCCATTTCTCCAGGTGTATTGA | |||
Atp7a | F: TGGGAAAGTGAATGGTGTCCA | NM_001109757.2 | |
R: ACGGTATTGGTTAAGACAGGGA | |||
Ireg1 | F: GGGTGGATAAGAATGCCAGAC | NM_016917.2 | |
R: CCTTTGGATTGTGATCGCAGT | |||
Heph | F: GCAGTGGAACTATGCTCCCAA | NM_001159627.1 | |
R: CAGCCTGTAACAGTGGTCCTA | |||
Rn18S | F: CTCAACACGGGAAACCTCAC | NC_000072 | |
R: CGCTCCACCAACTAAGAACG |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.-H.; Ahn, C.; Kang, H.Y.; Hong, E.-J.; Hyun, S.-H.; Choi, K.-C.; Jeung, E.-B. Effects of Octylphenol and Bisphenol A on the Metal Cation Transporter Channels of Mouse Placentas. Int. J. Environ. Res. Public Health 2016, 13, 965. https://doi.org/10.3390/ijerph13100965
Lee J-H, Ahn C, Kang HY, Hong E-J, Hyun S-H, Choi K-C, Jeung E-B. Effects of Octylphenol and Bisphenol A on the Metal Cation Transporter Channels of Mouse Placentas. International Journal of Environmental Research and Public Health. 2016; 13(10):965. https://doi.org/10.3390/ijerph13100965
Chicago/Turabian StyleLee, Jae-Hwan, Changhwan Ahn, Hee Young Kang, Eui-Ju Hong, Sang-Hwan Hyun, Kyung-Chul Choi, and Eui-Bae Jeung. 2016. "Effects of Octylphenol and Bisphenol A on the Metal Cation Transporter Channels of Mouse Placentas" International Journal of Environmental Research and Public Health 13, no. 10: 965. https://doi.org/10.3390/ijerph13100965