An ERF Transcription Factor Gene from Malus baccata (L.) Borkh, MbERF11, Affects Cold and Salt Stress Tolerance in Arabidopsis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Material and Growth Conditions
2.2. The qRT-PCR Expression Analysis of MbERF11
2.3. Subcellular Localization Analysis of MbERF11 Protein
2.4. A. Thaliana Transformation
2.5. Determination Survival Rates Under Cold and/or Salt Stress Treatment in Transgenic Arabidopsis
2.6. Detection of the Contents of Chlorophyll, MDA and Proline and the Activity of SOD, POD and CAT
2.7. Statistical Analysis
3. Results
3.1. Isolation of MbERF11 Gene from M. Baccata
3.2. Phylogenetic Relationship of MbERF11 with Other ERF Proteins
3.3. MbERF11 was Localized to the Nucleus
3.4. Expression Analysis of MbERF11 in M. Baccata
3.5. Overexpression of MbERF11 in A. Thaliana Contributed to Low Temperature Stress Tolerance
3.6. Overexpression of MbERF11 in A. Thaliana Contributed to Improved Salt Stress Tolerance
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Tuskan, G.A.; Difazio, S.; Jansson, S.; Bohlmann, J.; Grigoriev, I.; Hellsten, U.; Hellsten, U.; Putnam, N.; Ralph, S.; Rombauts, S.; et al. The genome of black cottonwood, Populus trichocarpa (Torr. & Gray). Science 2006, 313, 1596–1604. [Google Scholar]
- Han, D.; Du, M.; Zhou, Z.; Wang, S.; Li, T.; Han, J.; Xu, T.; Yang, G. Overexpression of a Malus baccata NAC transcription factor gene MbNAC25 increases cold and salinity tolerance in Arabidopsis. Int. J. Mol. Sci. 2020, 21, 1198. [Google Scholar] [CrossRef] [Green Version]
- Ryu, H.; Cho, Y.G. Plant hormones in salt stress tolerance. J. Plant Biol. 2015, 58, 147–155. [Google Scholar] [CrossRef]
- Yamaguchishinozaki, K.; Shinozaki, K. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Ann. Rev. Plant Biol. 2006, 57, 781–803. [Google Scholar] [CrossRef] [Green Version]
- Huang, Z.; Zhang, Z.; Zhang, X.; Zhang, H.; Huang, D.; Huang, R. Tomato TERF1 modulates ethylene response and enhances osmotic stress tolerance by activating expression of downstream genes. FEBS Lett. 2004, 573, 110–116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lucas, S.; Durmaz, E.; Akpınar, B.A.; Budak, H. The drought response displayed by a dre-binding protein from triticum dicoccoides. Plant Physiol. Biochem. 2011, 49, 346–351. [Google Scholar] [CrossRef]
- Mcconn, M.; Creelman, R.A.; Bell, E.; Mullet, J.E.; Browse, J. Jasmonate is essential for insect defense in Arabidopsis. Proc. Natl. Acad. Sci. USA 1997, 94, 5473–5477. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, L.; White, M.J.; Macrae, T.H. Transcription factors and their genes in higher plants functional domains, evolution and regulation. Eur. J. Biochem. 1999, 262, 247–257. [Google Scholar] [CrossRef]
- Singh, K.; Foley, R.C.; Oñatesánchez, L. Transcription factors in plant defense and stress responses. Curr. Opin. Plant Biol. 2002, 5, 430–436. [Google Scholar] [CrossRef]
- Nakano, T.; Suzuki, K.; Fujimura, T.; Shinshi, H. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol. 2006, 140, 411–432. [Google Scholar] [CrossRef] [Green Version]
- Feng, J.X.; Liu, D.; Pan, Y.; Gong, W.; Ma, L.G.; Luo, J.C.; Deng, X.W.; Zhu, Y.X. An annotation update via cdna sequence analysis and comprehensive profiling of developmental, hormonal or environmental responsiveness of the Arabidopsis, Ap2/EREBP transcription factor gene family. Plant Mol. Biol. 2005, 59, 853–868. [Google Scholar] [CrossRef] [PubMed]
- Sun, B.; Zhan, X.D.; Cao, L.Y.; Cheng, S.H. Research Progress of Rice AP2/ERF Transcription Factors. J. Agric. Biotech. 2017, 11, 1860–1869. [Google Scholar]
- Shigyo, M.; Hasebe, M.; Ito, M. Molecular evolution of the AP2 subfamily. Gene 2006, 366, 256–265. [Google Scholar] [CrossRef] [PubMed]
- Jofuku, K.D.; den Boer, B.G.; Van, M.M.; Okamuro, J.K. Control of Arabidopsis flower and seed development by the homeotic gene APETALA2. Plant Cell 1994, 6, 1211–1225. [Google Scholar] [PubMed] [Green Version]
- Elliott, R.C.; Betzner, A.S.; Huttner, E.; Oakes, M.P.; Tucker, W.Q.; Gerentes, D.; Perez, P.; Smyth, D.R. AINTEGUMENTA, an APETALA2-Like gene of Arabidopsis with pleiotropic roles in ovule development and floral organ growth. Plant Cell 1996, 8, 155–168. [Google Scholar] [PubMed]
- Stockinger, E.J.; Gilmour, S.J.; Thomashow, M.F. Arabidopsis thaliana cbf1 encodes an AP2 domain-containing transcriptional activator that binds to the c-repeat/dre, a cis-acting dna regulatory element that stimulates transcription in response to low temperature and water deficit. Proc. Natl. Acad. Sci. USA 1997, 94, 1035–1040. [Google Scholar] [CrossRef] [Green Version]
- Qin, L.; Wang, L.; Guo, Y.; Li, Y.; Ümüt, H.; Wang, Y. An ERF transcription factor from Tamarix hispida, ThCRF1, can adjust osmotic potential and reactive oxygen species scavenging capability to improve salt tolerance. Plant Sci. 2017, 265, 154–166. [Google Scholar] [CrossRef]
- Wang, C.; Xin, M.; Zhou, X.; Liu, C.; Li, S.; Liu, D.; Xu, Y.; Qin, Z.W. The novel ethylene-responsive factor CsERF025 affects the development of fruit bending in cucumber. Plant Mol. Biol. 2017, 95, 519–531. [Google Scholar] [CrossRef]
- Erpen, L.; Devi, H.S.; Grosser, J.W.; Dutt, M. Potential use of the DREB/ERF, MYB, NAC and WRKY transcription factors to improve abiotic and biotic stress in transgenic plants. Plant Cell Tissue Organ Cult. 2017, 132, 1–25. [Google Scholar] [CrossRef]
- Hao, D.; Ohmetakagi, M.; Sarai, A. Unique mode of gcc box recognition by the dna-binding domain of ethylene-responsive element-binding factor (ERF domain) in plant. J. Biol. Chem. 1998, 273, 26857–26861. [Google Scholar] [CrossRef] [Green Version]
- Liu, W.; Li, Q.; Wang, Y.; Wu, T.; Yang, Y.; Zhang, X.; Han, Z.; Xu, X. Ethylene response factor AtERF72 negatively regulates Arabidopsis thaliana response to iron deficiency. Biochem. Biophys. Res. Commun. 2017, 491, 862–868. [Google Scholar] [CrossRef] [PubMed]
- Son, G.H.; Wan, J.; Kim, H.J.; Nguyen, X.C.; Chung, W.S.; Hong, J.C.; Stacey, G. Ethylene-responsive element-binding factor 5, ERF5, is involved in chitin-induced innate immunity response. Mol. Plant 2012, 25, 48–60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, S.Y.; Hwang, E.Y.; Seok, H.Y.; Tarte, V.N.; Jeong, M.S.; Jang, S.B. Arabidopsis AtERF71/HRE2 functions as transcriptional activator via cis-acting gcc box or dre/crt element and is involved in root development through regulation of root cell expansion. Plant Cell Rep. 2015, 34, 223–231. [Google Scholar] [CrossRef] [PubMed]
- Sakuma, Y.; Liu, Q.; Dubouzet, J.G.; Abe, H.; Shinozaki, K.; Yamaguchishinozaki, K. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis drebs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem. Biophys. Res. Commun. 2002, 290, 998–1009. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Huang, R. Enhanced tolerance to freezing in tobacco and tomato overexpressing transcription factor TERF2/LeERF2 is modulated by ethylene biosynthesis. Plant Mol. Biol. 2010, 73, 241–249. [Google Scholar] [CrossRef]
- El-Sharkawy, I.; Sherif, S.; Mila, I. Molecular cliaracterization of seven genes encoding ethylene-responsive transcriptional factors during plum fruit development and ripening. J. Exp. Bot. 2009, 60, 907–922. [Google Scholar] [CrossRef] [Green Version]
- Nakano, T.; Fujisawa, M.; Shima, Y.; Ito, Y. The AP2/ERF transcription factor SlERF52 functions in flower pedicel abscission in tomato. J. Exp. Bot. 2014, 65, 1–4. [Google Scholar] [CrossRef] [Green Version]
- Pirrello, J.; Jaimesmiranda, F.; Sanchezballesta, M.T.; Tournier, B.; Khalilahmad, Q.; Regad, F.; Latché, A.; Pech, J.C.; Bouzayen, M. Sl-ERF2, a tomato ethylene response factor involved in ethylene response and seed germination. Plant Cell Physiol. 2006, 47, 1195–1205. [Google Scholar] [CrossRef] [Green Version]
- Fukao, T.; Xu, K.; Ronald, P.C.; Baileyserres, J. A variable cluster of ethylene response factor-like genes regulates metabolic and developmental acclimation responses to submergence in rice. Plant Cell 2006, 18, 2021–2034. [Google Scholar] [CrossRef] [Green Version]
- Wang, A.; Tan, D.; Takahashi, A.; Li, T.Z.; Harada, T. MdERFs, two ethylene-response factors involved in apple fruit ripening. J. Exp. Bot. 2007, 58, 3743–3748. [Google Scholar] [CrossRef]
- Xiao, H.; Yin, L.; Xu, X.; Li, T.; Han, Z. The iron-regulated transporter, mbnramp1, isolated from Malus baccata is involved in fe, mn and cd trafficking. Ann. Bot. 2008, 102, 881–889. [Google Scholar] [CrossRef] [PubMed]
- Song, C.P.; Agarwal, M.; Ohta, M.; Guo, Y.; Halfter, U.; Wang, P.; Zhu, J.K. Role of an Arabidopsis AP2/EREBP-type transcriptional repressor in abscisic acid and drought stress responses. Plant Cell 2005, 17, 2384–2396. [Google Scholar] [CrossRef] [PubMed]
- Han, D.; Yufang Wang, Y.; Zhang, Z.; Pu, Q.; Ding, H.; Han, J.; Fan, T.; Bai, X.; Yang, G. Isolation and functional analysis of MxCS3: A gene encoding a citrate synthase in Malus xiaojinensis, with functions in tolerance to iron stress and abnormal flower in transgenic Arabidopsis thaliana. Plant Growth Regul. 2017, 82, 479–489. [Google Scholar] [CrossRef]
- An, J.P.; Qu, F.J.; Yao, J.F.; Wang, X.N.; You, C.X.; Wang, X.F.; Hao, Y.J. The bZIP transcription factor MdHY5 regulates anthocyanin accumulation and nitrate assimilation in apple. Hortic. Res. 2017, 4, 17023. [Google Scholar] [CrossRef] [Green Version]
- Pfaffl, M.W. A new mathematical model for relative quantification in real time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Yang, G.H.; Li, J.; Liu, W.; Yu, Z.Y.; Shi, Y.; Lv, B.Y.; Wang, B.; Han, D.G. Molecular cloning and characterization of MxNAS2, a gene encoding nicotianamine synthase in Malus xiaojinensis, with functions in tolerance to iron stress and misshapen flower in transgenic tobacco. Sci. Hortic. 2015, 183, 77–86. [Google Scholar] [CrossRef]
- An, G.; Watson, B.D.; Chiang, C.C. Transformation of tobacco, tomato, potato, and Arabidopsis thaliana using a binary ti vector system. Plant Physiol. 1986, 81, 301–305. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, S.Y.; Liu, Y.F.; Xu, J.; Liu, T.; Dong, S.Z. Effectiveness of lysozyme coatings and 1-MCP treatments on storage and preservation of kiwifruit. Food Chem. 2019, 288, 201–217. [Google Scholar]
- Jiménez-Bremont, J.F.; Becerra-Flora, A.; Hernandéz-Lucero, E.; Rodriguéz-Kessler, M.; Acosta-Gallegos, J.A.; Ramiréz-Pimentel, J.G. Proline accumulation in two bean cultivars under salt stress and the effect of polyamines and ornithine. Biol. Plant 2006, 50, 763–766. [Google Scholar] [CrossRef]
- Shin, L.J.; Lo, J.C.; Yeh, K.C. Copper chaperone antioxidant protein1 is essential for copper homeostasis. Plant Physiol. 2012, 59, 1099–1110. [Google Scholar] [CrossRef] [Green Version]
- Ohta, M.; Matsui, K.; Hiratsu, K.; Shinshi, H.; Ohme-Takagi, M. Repression domains of class II ERF transcriptional repressors share an essential motif for active repression. Plant Cell 2001, 13, 1959–1968. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Achard, P.; Baghour, M.; Chapple, A.; Hedden, P.; Van Der Straeten, D.; Genschik, P.; Harberd, N.P. The plant stress hormone ethylene controls floral transition via DELLA-dependent regulation of floral meristem-identity genes. Proc. Natl. Acad. Sci. USA 2007, 104, 6484–6489. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, H.; Xue, L.; Chintamanani, S.; Germain, H.; Lin, H.; Cui, H. Ethylene insensitive3 and ethylene insensitive3-like1 repress salicylic acid induction deficient2 expression to negatively regulate plant innate immunity in Arabidopsis. Plant Cell 2009, 21, 2527–2540. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yin, C.C.; Ma, B.; Collinge, D.P.; Pogson, B.J.; He, S.J.; Xiong, Q. Ethylene responses in rice roots and coleoptiles are differentially regulated by a carotenoid isomerase-mediated abscisic acid pathway. Plant Cell 2015, 27, 1061–1081. [Google Scholar] [CrossRef] [Green Version]
- Kendrick, M.D.; Chang, C. Ethylene signaling: New levels of complexity and regulation. Curr. Opin. Plant Biol. 2008, 11, 479–485. [Google Scholar] [CrossRef] [Green Version]
- Sun, X.; Zhao, T.; Gan, S.; Ren, X.; Fang, L.; Karungo, S.K. Ethylene positively regulates cold tolerance in grapevine by modulating the expression of ethylene response factor 057. Sci. Rep. 2016, 6, 24066. [Google Scholar] [CrossRef]
- Catalá, R.; Lópezcobollo, R.; Mar, M.C.; Angosto, T.; Alonso, J.M.; Ecker, J.R. The Arabidopsis 14-3-3 protein rare cold inducible 1a links low-temperature response and ethylene biosynthesis to regulate freezing tolerance and cold acclimation. Plant Cell 2014, 26, 3326–3342. [Google Scholar] [CrossRef] [Green Version]
- Zhai, Y.; Wang, Y.; Li, Y.; Lei, T.; Yan, F.; Su, L. Isolation and molecular characterization of GmERF7, a soybean ethylene-response factor that increases salt stress tolerance in tobacco. Gene 2013, 513, 174–183. [Google Scholar] [CrossRef]
- Park, H.Y.; Seok, H.Y.; Woo, D.H.; Lee, S.Y.; Tarte, V.N.; Lee, E.H. AtERF71/HRE2 transcription factor mediates osmotic stress response as well as hypoxia response in Arabidopsis. Biochem. Biophys. Res. Commun. 2011, 414, 135–141. [Google Scholar] [CrossRef]
- Papdi, C.; Perez-Salamo, I.; Joseph, M.P.; Giuntoli, B.; Bögre, L.; Koncz, C.; Szabados, L. The low oxygen, oxidative and osmotic stress responses synergistically act through the ethylene response factor vii genes rap2.12, rap2.2 and rap2.3. Plant J. 2015, 82, 772–784. [Google Scholar] [CrossRef] [Green Version]
- Yang, C.Y.; Hsu, F.C.; Li, J.P.; Wang, N.N.; Shih, M.C. The AP2/ERF transcription factor AtERF73/HRE1 modulates ethylene responses during hypoxia in Arabidopsis. Plant Physiol. 2011, 156, 202–212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, G.Y.; Chen, M.; Li, L.C.; Xu, Z.S.; Chen, X.P.; Guo, J.M. Overexpression of the soybean GmERF3 gene, an AP2/ERF type transcription factor for increased tolerances to salt, drought, and diseases in transgenic tobacco. J. Exp. Bot. 2009, 60, 3781–3796. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, D.; Ding, H.; Chai, L.; Liu, W.; Zhang, Z.; Hou, Y.; Yang, G. Isolation and characterization of MbWRKY1, a WRKY transcription factor gene from Malus baccata (L.) Borkh involved in drought tolerance. Can. J. Plant Sci. 2018, 98, 1023–1034. [Google Scholar] [CrossRef]
- Han, D.; Zhang, Z.; Ding, H.; Chai, L.; Liu, W.; Li, H.; Yang, G. Isolation and characterization of MbWRKY2 gene involved in enhanced drought tolerance in transgenic tobacco. J. Plant Interact. 2018, 13, 163–172. [Google Scholar] [CrossRef] [Green Version]
Name of Primer | Sequence of Primer (5′→3′) | Purpose |
---|---|---|
MbERF11-F | ATGGAAGGAGATTACTGCTGCT | Cloning |
MbERF11-R | TTAACTTTCATCGGAGTTTTCTGGG | Cloning |
ACTIN-F | ACACGGGGAGGTAGTGACAA | qPCR |
ACTIN-R | CCTCCAATGGATCCTCGTTA | qPCR |
GAP-F | GTCGTACTACTGGTATCGTT | qPCR |
GAP-R | TCATAGTCAAGAGCAATGTA | qPCR |
MF | TGGAGAAGCGTAAGCATCCC | qPCR |
MR | CGTCGTCTTGGAATACAAGCT | qPCR |
Site-F | GAGCTCATGGAAGGAGATTACTGCT | Add SacI site |
Site-R | CCTAGGACTTTCATCGGAGTTTTCTG | Add BamHI site |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, D.; Han, J.; Yang, G.; Wang, S.; Xu, T.; Li, W. An ERF Transcription Factor Gene from Malus baccata (L.) Borkh, MbERF11, Affects Cold and Salt Stress Tolerance in Arabidopsis. Forests 2020, 11, 514. https://doi.org/10.3390/f11050514
Han D, Han J, Yang G, Wang S, Xu T, Li W. An ERF Transcription Factor Gene from Malus baccata (L.) Borkh, MbERF11, Affects Cold and Salt Stress Tolerance in Arabidopsis. Forests. 2020; 11(5):514. https://doi.org/10.3390/f11050514
Chicago/Turabian StyleHan, Deguo, Jiaxin Han, Guohui Yang, Shuang Wang, Tianlong Xu, and Wenhui Li. 2020. "An ERF Transcription Factor Gene from Malus baccata (L.) Borkh, MbERF11, Affects Cold and Salt Stress Tolerance in Arabidopsis" Forests 11, no. 5: 514. https://doi.org/10.3390/f11050514