Evaluation of African Swine Fever Virus E111R Gene on Viral Replication and Porcine Virulence
Abstract
:1. Introduction
2. Materials and Methods
2.1. Viruses and Cells
2.2. Amino Acid Sequence Analysis
2.3. E111R Gene Expression Characteristics
2.4. Construction of Recombinant ASFV SY18∆E111R
2.5. SY18ΔE111R Growth Curve
2.6. Animal Experiments
2.7. Virus Detection in Blood and Tissue
2.8. Detection of Anti-p54 Antibodies
2.9. Statistical Analysis
3. Results
3.1. Conserved Nature of the E111R Gene in Different Isolates
3.2. The E111R Gene Is an Early Expressed Gene in ASFV Infection
3.3. Purification and In Vitro Growth Characteristics of the SY18ΔE111R Strain
3.4. Virulence of SY18ΔE111R in Pigs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Iacolina, L.; Penrith, M.-L.; Bellini, S.; Chenais, E.; Jori, F.; Montoya, M.; Ståhl, K.; Gavier-Widén, D. (Eds.) Understanding and Combatting African Swine Fever: A European Perspective; Wageningen Academic Publishers: Wageningen, The Netherlands, 2021; ISBN 978-90-8686-357-0. [Google Scholar]
- Alonso, C.; Borca, M.; Dixon, L.; Revilla, Y.; Rodriguez, F.; Escribano, J.M. ICTV Report Consortium ICTV Virus Taxonomy Profile: Asfarviridae. J. Gen. Virol. 2018, 99, 613–614. [Google Scholar] [CrossRef]
- Gaudreault, N.N.; Madden, D.W.; Wilson, W.C.; Trujillo, J.D.; Richt, J.A. African Swine Fever Virus: An Emerging DNA Arbovirus. Front. Vet. Sci. 2020, 7, 215. [Google Scholar] [CrossRef]
- Dixon, L.K.; Chapman, D.A.G.; Netherton, C.L.; Upton, C. African Swine Fever Virus Replication and Genomics. Virus Res. 2013, 173, 3–14. [Google Scholar] [CrossRef] [PubMed]
- Eustace Montgomery, R. On A Form of Swine Fever Occurring in British East Africa (Kenya Colony). J. Comp. Pathol. Ther. 1921, 34, 159–191. [Google Scholar] [CrossRef] [Green Version]
- Mur, L.; Atzeni, M.; Martínez-López, B.; Feliziani, F.; Rolesu, S.; Sanchez-Vizcaino, J.M. Thirty-Five-Year Presence of African Swine Fever in Sardinia: History, Evolution and Risk Factors for Disease Maintenance. Transbound. Emerg. Dis. 2016, 63, e165–e177. [Google Scholar] [CrossRef] [PubMed]
- Cisek, A.A.; Dąbrowska, I.; Gregorczyk, K.P.; Wyżewski, Z. African Swine Fever Virus: A new old enemy of Europe. Ann. Parasitol. 2016, 62, 161–167. [Google Scholar] [CrossRef] [PubMed]
- Rowlands, R.J.; Michaud, V.; Heath, L.; Hutchings, G.; Oura, C.; Vosloo, W.; Dwarka, R.; Onashvili, T.; Albina, E.; Dixon, L.K. African Swine Fever Virus Isolate, Georgia, 2007. Emerg. Infect. Dis. 2008, 14, 1870–1874. [Google Scholar] [CrossRef]
- Gallardo, C.; Fernández-Pinero, J.; Pelayo, V.; Gazaev, I.; Markowska-Daniel, I.; Pridotkas, G.; Nieto, R.; Fernández-Pacheco, P.; Bokhan, S.; Nevolko, O.; et al. Genetic Variation among African Swine Fever Genotype II Viruses, Eastern and Central Europe. Emerg. Infect. Dis. 2014, 20, 1544–1547. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, X.; Li, N.; Luo, Y.; Liu, Y.; Miao, F.; Chen, T.; Zhang, S.; Cao, P.; Li, X.; Tian, K.; et al. Emergence of African Swine Fever in China, 2018. Transbound. Emerg. Dis. 2018, 65, 1482–1484. [Google Scholar] [CrossRef] [Green Version]
- Cheng, J.; Ward, M.P. Risk Factors for the Spread of African Swine Fever in China: A Systematic Review of Chinese-language Literature. Transbound. Emerg. Dis. 2022, 69, e1289–e1298. [Google Scholar] [CrossRef]
- Ito, S.; Bosch, J.; Martínez-Avilés, M.; Sánchez-Vizcaíno, J.M. The Evolution of African Swine Fever in China: A Global Threat? Front. Vet. Sci. 2022, 9, 828498. [Google Scholar] [CrossRef] [PubMed]
- Rahimi, P.; Sohrabi, A.; Ashrafihelan, J.; Edalat, R.; Alamdari, M.; Masoudi, M.; Mostofi, S.; Azadmanesh, K. Emergence of African Swine Fever Virus, Northwestern Iran. Emerg. Infect. Dis. 2010, 16, 1946–1948. [Google Scholar] [CrossRef] [PubMed]
- Ramirez-Medina, E.; O’Donnell, V.; Silva, E.; Espinoza, N.; Velazquez-Salinas, L.; Moran, K.; Daite, D.A.; Barrette, R.; Faburay, B.; Holland, R.; et al. Experimental Infection of Domestic Pigs with an African Swine Fever Virus Field Strain Isolated in 2021 from the Dominican Republic. Viruses 2022, 14, 1090. [Google Scholar] [CrossRef] [PubMed]
- Blome, S.; Gabriel, C.; Beer, M. Modern Adjuvants Do Not Enhance the Efficacy of an Inactivated African Swine Fever Virus Vaccine Preparation. Vaccine 2014, 32, 3879–3882. [Google Scholar] [CrossRef]
- Leitão, A.; Cartaxeiro, C.; Coelho, R.; Cruz, B.; Parkhouse, R.M.E.; Portugal, F.C.; Vigário, J.D.; Martins, C.L.V. The Non-Haemadsorbing African Swine Fever Virus Isolate ASFV/NH/P68 Provides a Model for Defining the Protective Anti-Virus Immune Response. J. Gen. Virol. 2001, 82, 513–523. [Google Scholar] [CrossRef]
- Sang, H.; Miller, G.; Lokhandwala, S.; Sangewar, N.; Waghela, S.D.; Bishop, R.P.; Mwangi, W. Progress Toward Development of Effective and Safe African Swine Fever Virus Vaccines. Front. Vet. Sci. 2020, 7, 84. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Ke, J.; Zhang, J.; Yang, J.; Yue, H.; Zhou, X.; Qi, Y.; Zhu, R.; Miao, F.; Li, Q.; et al. African Swine Fever Virus Bearing an I226R Gene Deletion Elicits Robust Immunity in Pigs to African Swine Fever. J. Virol. 2021, 95, e0119921. [Google Scholar] [CrossRef]
- Borca, M.V.; Ramirez-Medina, E.; Silva, E.; Vuono, E.; Rai, A.; Pruitt, S.; Holinka, L.G.; Velazquez-Salinas, L.; Zhu, J.; Gladue, D.P. Development of a Highly Effective African Swine Fever Virus Vaccine by Deletion of the I177L Gene Results in Sterile Immunity against the Current Epidemic Eurasia Strain. J. Virol. 2020, 94, e02017-19. [Google Scholar] [CrossRef]
- Li, Z.; Chen, W.; Qiu, Z.; Li, Y.; Fan, J.; Wu, K.; Li, X.; Zhao, M.; Ding, H.; Fan, S.; et al. African Swine Fever Virus: A Review. Life 2022, 12, 1255. [Google Scholar] [CrossRef]
- Alejo, A.; Matamoros, T.; Guerra, M.; Andrés, G. A Proteomic Atlas of the African Swine Fever Virus Particle. J. Virol. 2018, 92, e01293-18. [Google Scholar] [CrossRef] [Green Version]
- O’Donnell, V.; Holinka, L.G.; Krug, P.W.; Gladue, D.P.; Carlson, J.; Sanford, B.; Alfano, M.; Kramer, E.; Lu, Z.; Arzt, J.; et al. African Swine Fever Virus Georgia 2007 with a Deletion of Virulence-Associated Gene 9GL (B119L), When Administered at Low Doses, Leads to Virus Attenuation in Swine and Induces an Effective Protection against Homologous Challenge. J. Virol. 2015, 89, 8556–8566. [Google Scholar] [CrossRef] [Green Version]
- Chen, W.; Zhao, D.; He, X.; Liu, R.; Wang, Z.; Zhang, X.; Li, F.; Shan, D.; Chen, H.; Zhang, J.; et al. A Seven-Gene-Deleted African Swine Fever Virus Is Safe and Effective as a Live Attenuated Vaccine in Pigs. Sci. China Life Sci. 2020, 63, 623–634. [Google Scholar] [CrossRef] [PubMed]
- Reis, A.L.; Goatley, L.C.; Jabbar, T.; Sanchez-Cordon, P.J.; Netherton, C.L.; Chapman, D.A.G.; Dixon, L.K. Deletion of the African Swine Fever Virus Gene DP148R Does Not Reduce Virus Replication in Culture but Reduces Virus Virulence in Pigs and Induces High Levels of Protection against Challenge. J. Virol. 2017, 91, e01428-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dixon, L.K.; Stahl, K.; Jori, F.; Vial, L.; Pfeiffer, D.U. African Swine Fever Epidemiology and Control. Annu. Rev. Anim. Biosci. 2020, 8, 221–246. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Blasco, R.; Agüero, M.; Almendral, J.M.; Viñuela, E. Variable and Constant Regions in African Swine Fever Virus DNA. Virology 1989, 168, 330–338. [Google Scholar] [CrossRef]
- Chapman, D.A.G.; Tcherepanov, V.; Upton, C.; Dixon, L.K. Comparison of the Genome Sequences of Non-Pathogenic and Pathogenic African Swine Fever Virus Isolates. J. Gen. Virol. 2008, 89, 397–408. [Google Scholar] [CrossRef]
- Reis, A.L.; Goatley, L.C.; Jabbar, T.; Lopez, E.; Rathakrishnan, A.; Dixon, L.K. Deletion of the Gene for the Type I Interferon Inhibitor I329L from the Attenuated African Swine Fever Virus OURT88/3 Strain Reduces Protection Induced in Pigs. Vaccines 2020, 8, 262. [Google Scholar] [CrossRef]
- Liu, H.; Zhu, Z.; Feng, T.; Ma, Z.; Xue, Q.; Wu, P.; Li, P.; Li, S.; Yang, F.; Cao, W.; et al. African Swine Fever Virus E120R Protein Inhibits Interferon Beta Production by Interacting with IRF3 To Block Its Activation. J. Virol. 2021, 95, e0082421. [Google Scholar] [CrossRef]
- Wang, S.; Zhang, J.; Zhang, Y.; Yang, J.; Wang, L.; Qi, Y.; Han, X.; Zhou, X.; Miao, F.; Chen, T.; et al. Cytokine Storm in Domestic Pigs Induced by Infection of Virulent African Swine Fever Virus. Front. Vet. Sci. 2021, 7, 601641. [Google Scholar] [CrossRef]
- Zhang, Y.; Ke, J.; Zhang, J.; Yue, H.; Chen, T.; Li, Q.; Zhou, X.; Qi, Y.; Zhu, R.; Wang, S.; et al. I267L Is Neither the Virulence- Nor the Replication-Related Gene of African Swine Fever Virus and Its Deletant Is an Ideal Fluorescent-Tagged Virulence Strain. Viruses 2021, 14, 53. [Google Scholar] [CrossRef]
- Zhang, J.; Zhang, Y.; Chen, T.; Yang, J.; Yue, H.; Wang, L.; Zhou, X.; Qi, Y.; Han, X.; Ke, J.; et al. Deletion of the L7L-L11L Genes Attenuates ASFV and Induces Protection against Homologous Challenge. Viruses 2021, 13, 255. [Google Scholar] [CrossRef]
- Hübner, A.; Keßler, C.; Pannhorst, K.; Forth, J.H.; Kabuuka, T.; Karger, A.; Mettenleiter, T.C.; Fuchs, W. Identification and Characterization of the 285L and K145R Proteins of African Swine Fever Virus. J. Gen. Virol. 2019, 100, 1303–1314. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- REED, L.J.; Muench, H. A Simple Method of Estimating Fifty Per Cent Endpoints12. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- King, K.; Chapman, D.; Argilaguet, J.M.; Fishbourne, E.; Hutet, E.; Cariolet, R.; Hutchings, G.; Oura, C.A.L.; Netherton, C.L.; Moffat, K.; et al. Protection of European Domestic Pigs from Virulent African Isolates of African Swine Fever Virus by Experimental Immunisation. Vaccine 2011, 29, 4593–4600. [Google Scholar] [CrossRef] [Green Version]
- Holm, S. A Simple Sequentially Rejective Multiple Test Procedure. Scand. J. Stat. 1979, 6, 65–70. [Google Scholar]
- Cackett, G.; Matelska, D.; Sýkora, M.; Portugal, R.; Malecki, M.; Bähler, J.; Dixon, L.; Werner, F. The African Swine Fever Virus Transcriptome. J. Virol. 2020, 94, e00119-20. [Google Scholar] [CrossRef] [Green Version]
- Tran, X.H.; Le, T.T.P.; Nguyen, Q.H.; Do, T.T.; Nguyen, V.D.; Gay, C.G.; Borca, M.V.; Gladue, D.P. African Swine Fever Virus Vaccine Candidate ASFV-G- Δ I177L Efficiently Protects European and Native Pig Breeds against Circulating Vietnamese Field Strain. Transbound. Emerg. Dis. 2022, 69, e497–e504. [Google Scholar] [CrossRef]
- Yoo, D.S.; Kim, Y.; Lee, E.S.; Lim, J.S.; Hong, S.K.; Lee, I.S.; Jung, C.S.; Yoon, H.C.; Wee, S.H.; Pfeiffer, D.U.; et al. Transmission Dynamics of African Swine Fever Virus, South Korea, 2019. Emerg. Infect. Dis. 2021, 27, 1909–1918. [Google Scholar] [CrossRef]
- Ankhanbaatar, U.; Sainnokhoi, T.; Khanui, B.; Ulziibat, G.; Jargalsaikhan, T.; Purevtseren, D.; Settypalli, T.B.K.; Flannery, J.; Dundon, W.G.; Basan, G.; et al. African Swine Fever Virus Genotype II in Mongolia, 2019. Transbound. Emerg. Dis. 2021, 68, 2787–2794. [Google Scholar] [CrossRef]
- Mighell, E.; Ward, M.P. African Swine Fever Spread across Asia, 2018–2019. Transbound. Emerg. Dis. 2021, 68, 2722–2732. [Google Scholar] [CrossRef] [PubMed]
- Karger, A.; Pérez-Núñez, D.; Urquiza, J.; Hinojar, P.; Alonso, C.; Freitas, F.B.; Revilla, Y.; Le Potier, M.-F.; Montoya, M. An Update on African Swine Fever Virology. Viruses 2019, 11, 864. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bishop, R.P.; Fleischauer, C.; de Villiers, E.P.; Okoth, E.A.; Arias, M.; Gallardo, C.; Upton, C.; Blome, S.; Gabriel, C.; Beer, M. Comparative Analysis of the Complete Genome Sequences of Kenyan African Swine Fever Virus Isolates within P72 Genotypes IX and X. Virus Res. 2013, 50, 122–130. [Google Scholar] [CrossRef]
- Rodríguez, J.M.; Moreno, L.T.; Alejo, A.; Lacasta, A.; Rodríguez, F.; Salas, M.L. Genome Sequence of African Swine Fever Virus BA71, the Virulent Parental Strain of the Nonpathogenic and Tissue-Culture Adapted BA71V. PLoS ONE 2015, 10, e0142889. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- O’Donnell, V.; Risatti, G.R.; Holinka, L.G.; Krug, P.W.; Carlson, J.; Velazquez-Salinas, L.; Azzinaro, P.A.; Gladue, D.P.; Borca, M.V. Simultaneous Deletion of the 9GL and UK Genes from the African Swine Fever Virus Georgia 2007 Isolate Offers Increased Safety and Protection against Homologous Challenge. J. Virol. 2017, 91, e01760-16. [Google Scholar] [CrossRef] [Green Version]
- Borca, M.V.; Ramirez-Medina, E.; Silva, E.; Vuono, E.; Rai, A.; Pruitt, S.; Espinoza, N.; Velazquez-Salinas, L.; Gay, C.G.; Gladue, D.P. ASFV-G-∆I177L as an Effective Oral Nasal Vaccine against the Eurasia Strain of Africa Swine Fever. Viruses 2021, 13, 765. [Google Scholar] [CrossRef] [PubMed]
- Vuono, E.A.; Ramirez-Medina, E.; Pruitt, S.; Rai, A.; Espinoza, N.; Spinard, E.; Valladares, A.; Silva, E.; Velazquez-Salinas, L.; Borca, M.V.; et al. Deletion of the EP296R Gene from the Genome of Highly Virulent African Swine Fever Virus Georgia 2010 Does Not Affect Virus Replication or Virulence in Domestic Pigs. Viruses 2022, 14, 1682. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
GAPDH | CCTTCATTGACCTCCACTACA | GATGGCCTTTCCATTGATGAC |
B646L | CGAACTTGTGCCAATCTC | ACAATAACCACCACGATGA |
CP204L | TTCTTCTTGAGCCTGATGTT | TAGCGGTAGAATTGTTACGA |
E111R | ACCAGCACGTTGAATGAT | CGTACAGTCCTTCCAGTTAT |
Virus | No. of Survivors/Total | Fever (Rectal Temperature ≥ 40.5 °C) | Mean Days to Death (±SD) | ||
---|---|---|---|---|---|
Days of Onset (±SD) | Days of Duration (±SD) | Maximum Daily Temp °C (±SD) | |||
ASFY SY18 (102.0 TCID50) | 0/5 | 6.6 (±1.0) | 3.0 (±0.9) | 41.18 (±0.4) | 9.2 (±1.0) |
SY18ΔE111R (102.0 TCID50) | 2/5 | 10.6 (±1.7) | 4.2 (±2.2) | 40.88 (±0.2) | 14.67 (±2.1) 1 |
SY18ΔE111R (105.0 TCID50) | 0/5 | 5.8 (±1.6) | 2.8 (±0.8) | 41.34 (±0.4) | 9.6 (±0.8) |
Virus | No. | ASFV Genome Copies/mL (log10) | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Days Post Inoculation | |||||||||||||
0 | 7 | 14 | 21 | ||||||||||
Blood | Oral Swabs | Anal Swabs | Blood | Oral Swabs | Anal Swabs | Blood | Oral Swabs | Anal Swabs | Blood | Oral Swabs | Anal Swabs | ||
ASFY SY18 (102.0 TCID50) | SY18-1 | - a | - | - | 6.86 | 4.92 | 4.92 | / b | / | / | / | / | / |
SY18-2 | - | - | - | 7.86 | 4.45 | 4.80 | / | / | / | / | / | / | |
SY18-3 | - | - | - | 6.74 | 4.80 | - | / | / | / | / | / | / | |
SY18-4 | - | - | - | 8.34 | 4.63 | - | / | / | / | / | / | / | |
SY18-5 | - | - | - | 7.43 | 4.21 | 4.58 | / | / | / | / | / | / | |
SY18ΔE111R (102.0 TCID50) | EL-1 | - | - | - | - | 4.16 | 3.48 | 6.70 | 4.07 | 3.60 | / | / | / |
EL-2 | - | - | - | 7.45 | 4.96 | 4.50 | / | / | / | / | / | / | |
EL-3 | - | - | - | - | 3.91 | - | - | - | 4.40 | 3.93 | - | 3.75 | |
EL-4 | - | - | - | - | 4.81 | 3.87 | 6.56 | - | 4.01 | / | / | / | |
EL-5 | - | - | - | - | 4.01 | - | - | - | - | 4.14 | - | 3.86 | |
SY18ΔE111R (105.0 TCID50) | EH-1 | - | - | - | 7.47 | 5.73 | 4.73 | / | / | / | / | / | / |
EH-2 | - | - | - | 6.12 | 4.60 | 4.95 | / | / | / | / | / | / | |
EH-3 | - | - | - | 4.36 | - | 3.98 | / | / | / | / | / | / | |
EH-4 | - | - | - | 6.84 | 5.74 | 4.20 | / | / | / | / | / | / | |
EH-5 | - | - | - | 7.45 | 4.58 | 4.35 | / | / | / | / | / | / |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, X.; Fan, J.; Zhang, Y.; Yang, J.; Zhu, R.; Yue, H.; Qi, Y.; Li, Q.; Wang, Y.; Chen, T.; et al. Evaluation of African Swine Fever Virus E111R Gene on Viral Replication and Porcine Virulence. Viruses 2023, 15, 890. https://doi.org/10.3390/v15040890
Zhou X, Fan J, Zhang Y, Yang J, Zhu R, Yue H, Qi Y, Li Q, Wang Y, Chen T, et al. Evaluation of African Swine Fever Virus E111R Gene on Viral Replication and Porcine Virulence. Viruses. 2023; 15(4):890. https://doi.org/10.3390/v15040890
Chicago/Turabian StyleZhou, Xintao, Jiaqi Fan, Yanyan Zhang, Jinjin Yang, Rongnian Zhu, Huixian Yue, Yu Qi, Qixuan Li, Yu Wang, Teng Chen, and et al. 2023. "Evaluation of African Swine Fever Virus E111R Gene on Viral Replication and Porcine Virulence" Viruses 15, no. 4: 890. https://doi.org/10.3390/v15040890