Visualization of Early RNA Replication Kinetics of SARS-CoV-2 by Using Single Molecule RNA-FISH Combined with Immunofluorescence
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Infection of Vero E6 Cells with SARS-CoV-2
2.3. Immunofluorescence
2.4. smRNA-FISH Probe Design and Specificity Analysis
2.5. smRNA-FISH Analysis
2.6. Whole-Slide Scanning, Microscope Setup, and Image Acquisition
3. Results
3.1. Design and Optimization of smRNA-FISH Probes to Study the Early Replication Events of SARS-CoV-2 at Single-Cell and Single-Molecule Resolution
3.2. Time-Course Analysis of SARS-CoV-2 RNA Replication
3.3. Replication of gRNA and sgRNA during Early Stages of SARS-CoV-2 Viral Replication
3.4. Nuclear Localization of SARS-CoV-2 RNA
3.5. Nature of RNA Spots Observed during Early Stages of Viral Replication
3.6. Heterogeneity in the Replication of SARS-CoV-2 RNA
3.7. Specificity of SARS-CoV-2 Probes against Variants of Concern (VOCs) of SARS-CoV-2
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kim, D.; Lee, J.Y.; Yang, J.S.; Kim, J.W.; Kim, V.N.; Chang, H. The Architecture of SARS-CoV-2 Transcriptome. Cell 2020, 181, 914–921. [Google Scholar] [CrossRef] [PubMed]
- World Health Organization. WHO Coronavirus (COVID-19) Dashboard. Available online: https://covid19.who.int/ (accessed on 16 November 2023).
- Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Kruger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280. [Google Scholar] [CrossRef] [PubMed]
- Shang, J.; Ye, G.; Shi, K.; Wan, Y.S.; Luo, C.M.; Aihara, H.; Geng, Q.B.; Auerbach, A.; Li, F. Structural basis of receptor recognition by SARS-CoV-2. Nature 2020, 581, 221–224. [Google Scholar] [CrossRef] [PubMed]
- Sridhar, S.; Nicholls, J. Pathophysiology of infection with SARS-CoV-2-What is known and what remains a mystery. Respirology 2021, 26, 652–665. [Google Scholar] [CrossRef]
- Mokhtari, T.; Hassani, F.; Ghaffari, N.; Ebrahimi, B.; Yarahmadi, A.; Hassanzadeh, G. COVID-19 and multiorgan failure: A narrative review on potential mechanisms. J. Mol. Histol. 2020, 51, 613–628. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.; Bowe, B.; Al-Aly, Z. Burdens of post-acute sequelae of COVID-19 by severity of acute infection, demographics and health status. Nat. Commun. 2021, 12, 6571. [Google Scholar] [CrossRef] [PubMed]
- Nolen, L.T.; Mukerji, S.S.; Mejia, N.I. Post-acute neurological consequences of COVID-19: An unequal burden. Nat. Med. 2022, 28, 20–23. [Google Scholar] [CrossRef] [PubMed]
- Lam, I.C.H.; Wong, C.K.H.; Zhang, R.; Chui, C.S.L.; Lai, F.T.T.; Li, X.; Chan, E.W.Y.; Luo, H.; Zhang, Q.; Man, K.K.C.; et al. Long-term post-acute sequelae of COVID-19 infection: A retrospective, multi-database cohort study in Hong Kong and the UK. eClinicalMedicine 2023, 60, 102000. [Google Scholar] [CrossRef]
- Davis, H.E.; McCorkell, L.; Vogel, J.M.; Topol, E.J. Long COVID: Major findings, mechanisms and recommendations. Nat. Rev. Microbiol. 2023, 21, 133–146. [Google Scholar] [CrossRef]
- Gupta, A.; Madhavan, M.V.; Sehgal, K.; Nair, N.; Mahajan, S.; Sehrawat, T.S.; Bikdeli, B.; Ahluwalia, N.; Ausiello, J.C.; Wan, E.Y.; et al. Extrapulmonary manifestations of COVID-19. Nat. Med. 2020, 26, 1017–1032. [Google Scholar] [CrossRef]
- Sarkesh, A.; Daei Sorkhabi, A.; Sheykhsaran, E.; Alinezhad, F.; Mohammadzadeh, N.; Hemmat, N.; Bannazadeh Baghi, H. Extrapulmonary Clinical Manifestations in COVID-19 Patients. Am. J. Trop. Med. Hyg. 2020, 103, 1783–1796. [Google Scholar] [CrossRef]
- V’Kovski, P.; Kratzel, A.; Steiner, S.; Stalder, H.; Thiel, V. Coronavirus biology and replication: Implications for SARS-CoV-2. Nat. Rev. Microbiol. 2021, 19, 155–170. [Google Scholar] [CrossRef]
- Gorbalenya, A.E.; Enjuanes, L.; Ziebuhr, J.; Snijder, E.J. Nidovirales: Evolving the largest RNA virus genome. Virus Res. 2006, 117, 17–37. [Google Scholar] [CrossRef]
- Wolff, G.; Limpens, R.; Zevenhoven-Dobbe, J.C.; Laugks, U.; Zheng, S.; de Jong, A.W.M.; Koning, R.I.; Agard, D.A.; Grunewald, K.; Koster, A.J.; et al. A molecular pore spans the double membrane of the coronavirus replication organelle. Science 2020, 369, 1395–1398. [Google Scholar] [CrossRef] [PubMed]
- Wolff, G.; Melia, C.E.; Snijder, E.J.; Barcena, M. Double-Membrane Vesicles as Platforms for Viral Replication. Trends Microbiol. 2020, 28, 1022–1033. [Google Scholar] [CrossRef] [PubMed]
- Zimmermann, L.; Zhao, X.; Makroczyova, J.; Wachsmuth-Melm, M.; Prasad, V.; Hensel, Z.; Bartenschlager, R.; Chlanda, P. SARS-CoV-2 nsp3 and nsp4 are minimal constituents of a pore spanning replication organelle. Nat. Commun. 2023, 14, 7894. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.Y.; Wing, P.A.; Gala, D.S.; Noerenberg, M.; Jarvelin, A.I.; Titlow, J.; Zhuang, X.; Palmalux, N.; Iselin, L.; Thompson, M.K.; et al. Absolute quantitation of individual SARS-CoV-2 RNA molecules provides a new paradigm for infection dynamics and variant differences. eLife 2022, 11, e74153. [Google Scholar] [CrossRef] [PubMed]
- Acheampong, K.K.; Schaff, D.L.; Emert, B.L.; Lake, J.; Reffsin, S.; Shea, E.K.; Comar, C.E.; Litzky, L.A.; Khurram, N.A.; Linn, R.L.; et al. Subcellular Detection of SARS-CoV-2 RNA in Human Tissue Reveals Distinct Localization in Alveolar Type 2 Pneumocytes and Alveolar Macrophages. mBio 2022, 13, e0375121. [Google Scholar] [CrossRef] [PubMed]
- Rensen, E.; Pietropaoli, S.; Mueller, F.; Weber, C.; Souquere, S.; Sommer, S.; Isnard, P.; Rabant, M.; Gibier, J.B.; Terzi, F.; et al. Sensitive visualization of SARS-CoV-2 RNA with CoronaFISH. Life Sci. Alliance 2022, 5, e202101124. [Google Scholar] [CrossRef] [PubMed]
- LGC Biosearch Technologies’ Stellaris® RNA FISH Probe Designer Version 4.2. Available online: https://www.biosearchtech.com/stellaris-designer (accessed on 21 September 2020).
- Aleem, A.; Akbar Samad, A.B.; Vaqar, S. Emerging Variants of SARS-CoV-2 and Novel Therapeutics Against Coronavirus (COVID-19). In StatPearls; Statpearls Publishing: Treasure Island, FL, USA, 2023. [Google Scholar]
- Gu, Z.; Eils, R.; Schlesner, M. Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics 2016, 32, 2847–2849. [Google Scholar] [CrossRef] [PubMed]
- Eliscovich, C.; Shenoy, S.M.; Singer, R.H. Imaging mRNA and protein interactions within neurons. Proc. Natl. Acad. Sci. USA 2017, 114, E1875–E1884. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef]
- Dieterle, M.E.; Haslwanter, D.; Bortz, R.H., 3rd; Wirchnianski, A.S.; Lasso, G.; Vergnolle, O.; Abbasi, S.A.; Fels, J.M.; Laudermilch, E.; Florez, C.; et al. A Replication-Competent Vesicular Stomatitis Virus for Studies of SARS-CoV-2 Spike-Mediated Cell Entry and Its Inhibition. Cell Host Microbe 2020, 28, 486–496.e6. [Google Scholar] [CrossRef]
- Buchrieser, J.; Dufloo, J.; Hubert, M.; Monel, B.; Planas, D.; Rajah, M.M.; Planchais, C.; Porrot, F.; Guivel-Benhassine, F.; Van der Werf, S.; et al. Syncytia formation by SARS-CoV-2-infected cells. EMBO J. 2020, 39, e106267. [Google Scholar] [CrossRef] [PubMed]
- Femino, A.M.; Fay, F.S.; Fogarty, K.; Singer, R.H. Visualization of single RNA transcripts in situ. Science 1998, 280, 585–590. [Google Scholar] [CrossRef]
- Singer, R.H.; Ward, D.C. Actin gene expression visualized in chicken muscle tissue culture by using in situ hybridization with a biotinated nucleotide analog. Proc. Natl. Acad. Sci. USA 1982, 79, 7331–7335. [Google Scholar] [CrossRef]
- Raj, A.; van den Bogaard, P.; Rifkin, S.A.; van Oudenaarden, A.; Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nat. Methods 2008, 5, 877–879. [Google Scholar] [CrossRef] [PubMed]
- Sattar, S.; Kabat, J.; Jerome, K.; Feldmann, F.; Bailey, K.; Mehedi, M. Nuclear translocation of spike mRNA and protein is a novel feature of SARS-CoV-2. Front. Microbiol. 2023, 14, 1073789. [Google Scholar] [CrossRef] [PubMed]
- Ricciardi, S.; Guarino, A.M.; Giaquinto, L.; Polishchuk, E.V.; Santoro, M.; Di Tullio, G.; Wilson, C.; Panariello, F.; Soares, V.C.; Dias, S.S.G.; et al. The role of NSP6 in the biogenesis of the SARS-CoV-2 replication organelle. Nature 2022, 606, 761–768. [Google Scholar] [CrossRef]
- Kehrer, T.; Cupic, A.; Ye, C.; Yildiz, S.; Bouhaddou, M.; Crossland, N.A.; Barrall, E.A.; Cohen, P.; Tseng, A.; Cagatay, T.; et al. Impact of SARS-CoV-2 ORF6 and its variant polymorphisms on host responses and viral pathogenesis. Cell Host Microbe 2023, 31, 1668–1684.e12. [Google Scholar] [CrossRef]
- Hoffmann, M.; Wong, L.R.; Arora, P.; Zhang, L.; Rocha, C.; Odle, A.; Nehlmeier, I.; Kempf, A.; Richter, A.; Halwe, N.J.; et al. Omicron subvariant BA.5 efficiently infects lung cells. Nat. Commun. 2023, 14, 3500. [Google Scholar] [CrossRef]
- Zhao, H.; Lu, L.; Peng, Z.; Chen, L.L.; Meng, X.; Zhang, C.; Ip, J.D.; Chan, W.M.; Chu, A.W.; Chan, K.H.; et al. SARS-CoV-2 Omicron variant shows less efficient replication and fusion activity when compared with Delta variant in TMPRSS2-expressed cells. Emerg. Microbes Infect. 2022, 11, 277–283. [Google Scholar] [CrossRef]
- Shi, F.S.; Yu, Y.; Li, Y.L.; Cui, L.; Zhao, Z.; Wang, M.; Wang, B.; Zhang, R.; Huang, Y.W. Expression Profile and Localization of SARS-CoV-2 Nonstructural Replicase Proteins in Infected Cells. Microbiol. Spectr. 2022, 10, e0074422. [Google Scholar] [CrossRef] [PubMed]
- Roe, T.; Reynolds, T.C.; Yu, G.; Brown, P.O. Integration of murine leukemia virus DNA depends on mitosis. EMBO J. 1993, 12, 2099–2108. [Google Scholar] [CrossRef] [PubMed]
- Feuer, R.; Mena, I.; Pagarigan, R.; Slifka, M.K.; Whitton, J.L. Cell cycle status affects coxsackievirus replication, persistence, and reactivation in vitro. J. Virol. 2002, 76, 4430–4440. [Google Scholar] [CrossRef] [PubMed]
- Lafon-Hughes, L. Towards Understanding Long COVID: SARS-CoV-2 Strikes the Host Cell Nucleus. Pathogens 2023, 12, 806. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Richards, A.; Barrasa, M.I.; Hughes, S.H.; Young, R.A.; Jaenisch, R. Reverse-transcribed SARS-CoV-2 RNA can integrate into the genome of cultured human cells and can be expressed in patient-derived tissues. Proc. Natl. Acad. Sci. USA 2021, 118, e2105968118. [Google Scholar] [CrossRef] [PubMed]
- Burke, J.M.; St Clair, L.A.; Perera, R.; Parker, R. SARS-CoV-2 infection triggers widespread host mRNA decay leading to an mRNA export block. RNA 2021, 27, 1318–1329. [Google Scholar] [CrossRef]
- Hu, D.; Wang, T.; Uddin, J.; Greene, W.K.; Hu, D.; Ma, B. Development of a high-sensitivity and short-duration fluorescence in situ hybridization method for viral mRNA detection in HEK 293T cells. Front. Cell. Infect. Microbiol. 2022, 12, 960938. [Google Scholar] [CrossRef] [PubMed]
Probe Number | smRNA-FISH Spike RNA Probe (P1) (5′ → 3′) | smRNA-FISH nsp12 RNA Probe (P2) (5′ → 3′) |
---|---|---|
1 | tgactagagactagtggcaata | gctactttatcattgtagatgt |
2 | tttgtcagggtaataaacacca | agttagagaaagtgtgtctctt |
3 | atgtatagcatggaaccaagta | aattaccttcatcaaaatgcct |
4 | accatcattaaatggtaggaca | ttctacaaaatcataccagtcc |
5 | tatgttagacttctcagtggaa | ttttaacaaagcttggcgtaca |
6 | tttttgtggtaataaacaccca | agttaccattgagatcttgatt |
7 | gtgcaattattcgcactagaat | agaatctacaacaggaactcca |
8 | aataggcgtgtgcttagaatat | acatgtgactctgcagttaaag |
9 | gcaaatctaccaatggttctaa | ctgtcatccaaacagttaacac |
10 | taggttgaagataacccacata | cagcagcatacacaagtaattc |
11 | ctacagtgaaggatttcaacgt | gtaatagattaccagaagcagc |
12 | agaattccaagctataacgcag | taagtgcagctactgaaaagca |
13 | tataattaccaccaaccttaga | aaaattaccgggtttgacagtt |
14 | ggcagaaactttttgttagact | caacagaacttccttccttaaa |
15 | tgacaccaccaaaagaacatgg | atcctgagcaaagaagaagtgt |
16 | tatttgttcctggtgttataac | acgatagtagtcataatcgctg |
17 | gttgatctgcatgaatagcaac | ttgtctgatatcacacattgtt |
18 | aataaacacgccaagtaggagt | acgatgacttggttagcattaa |
19 | cactcatatgagttgttgacat | gaaaaccagctgatttgtctag |
20 | atagtgtaggcaatgatggatt | atgcgaaaagtgcatcttgatc |
21 | gtaagcaactgaattttctgca | tagtagggatgacattacgttt |
22 | agtaaaatttgtgggtatggca | tattctttgcactaatggcata |
23 | ggtagaatttctgtggtaacac | ctattggtcatagtactacaga |
24 | acttgtgcaaaaacttcttggg | cttgttccaattactacagtag |
25 | tggtggtgttttgtaaatttgt | tcacatttaggataatcccaac |
26 | aacagtaaggccgttaaacttt | acaagtgaggccataattctaa |
27 | agaacattctgtgtaactccaa | gaaacggtgtgacaagctacaa |
28 | acttgctgtggaagaaagtgag | atgaccatttcactcaatactt |
29 | ggagctaagttgtttaacaagc | acatacttatcggcaattttgt |
30 | ttgagtcacatatgtctgcaaa | cactcataaagtctgtgttgta |
31 | gacattttagtagcagcaagat | tcacaaagtctgtgtcaacatc |
32 | cctttccacaaaaatcaactct | gtcagagagtatcatcattgag |
33 | ctgactgagggaaggacataag | actagaccttgagatgcataag |
34 | agtcacatgcaagaagactaca | gaaggtacacataatcatcacc |
35 | gttgttgacaattcctattaca | atatcatctacaaaacagccgg |
36 | tgaagcattaatgccagagatg | gacacgaaccgttcaatcataa |
37 | gcggtcaatttctttttgaatg | tagtaagtgggtaagcatctat |
38 | taaattcttggcaacctcattg | atgtagctttcttatgtattgt |
39 | ttggagatcgatgagagattca | aatacatgtctaacatgtgtcc |
40 | gctataaaacctagccaaatgt | gtgtacatagcctcataaaact |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pathak, R.; Eliscovich, C.; Mena, I.; Cupic, A.; Rutkowska, M.; Chandran, K.; Jangra, R.K.; García-Sastre, A.; Singer, R.H.; Kalpana, G.V. Visualization of Early RNA Replication Kinetics of SARS-CoV-2 by Using Single Molecule RNA-FISH Combined with Immunofluorescence. Viruses 2024, 16, 262. https://doi.org/10.3390/v16020262
Pathak R, Eliscovich C, Mena I, Cupic A, Rutkowska M, Chandran K, Jangra RK, García-Sastre A, Singer RH, Kalpana GV. Visualization of Early RNA Replication Kinetics of SARS-CoV-2 by Using Single Molecule RNA-FISH Combined with Immunofluorescence. Viruses. 2024; 16(2):262. https://doi.org/10.3390/v16020262
Chicago/Turabian StylePathak, Rajiv, Carolina Eliscovich, Ignacio Mena, Anastasija Cupic, Magdalena Rutkowska, Kartik Chandran, Rohit K. Jangra, Adolfo García-Sastre, Robert H. Singer, and Ganjam V. Kalpana. 2024. "Visualization of Early RNA Replication Kinetics of SARS-CoV-2 by Using Single Molecule RNA-FISH Combined with Immunofluorescence" Viruses 16, no. 2: 262. https://doi.org/10.3390/v16020262