The Non-Homologous End Joining Protein PAXX Acts to Restrict HSV-1 Infection
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Transfection
2.3. Viruses
2.4. Plaque Assay Titration of HSV-1
2.5. Virus Titre Assay
2.6. Cellular RNA Extraction
2.7. cDNA Synthesis
2.8. Quantitative Real Time-Polymerase Chain Reaction (qPCR)
2.9. Isolation of Cellular and Viral DNA for Quantification by qPCR
2.10. Quantification of Viral DNA by qPCR
2.11. Isolation of Viral DNA for Southern Blotting
2.12. Creation of Hybridisation Probe for Southern Blotting
2.13. Southern Blotting
2.14. Immunofluorescence
2.15. Immunoblotting
3. Results
3.1. HSV-1 Infection Induces Changes in PAXX Distribution
3.2. Paxx−/− MEFs Are Not Defective in Type I Interferon Production during HSV-1 Infection
3.3. PAXX Is Not Required to Create Endless Forms of the HSV-1 Genome
3.4. PAXX−/− Cells Produce Fewer Viral Genomes than WT Cells
3.5. Viral Gene Expression and Protein Production Are Unaffected by PAXX
3.6. PAXX−/− Cells Produce More Infectious Virions than WT Cells
4. Discussion
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Lieber, M.R.; Ma, Y.; Pannicke, U.; Schwarz, K. Mechanism and regulation of human non-homologous DNA end-joining. Nat. Rev. Mol. Cell Biol. 2003, 4, 712–720. [Google Scholar] [CrossRef] [PubMed]
- Gottlieb, T.M.; Jackson, S.P. The DNA-dependent protein kinase: Requirement for DNA ends and association with Ku antigen. Cell 1993, 72, 131–142. [Google Scholar] [CrossRef]
- Yaneva, M.; Kowalewski, T.; Lieber, M.R. Interaction of DNA-dependent protein kinase with DNA and with Ku: Biochemical and atomic-force microscopy studies. EMBO J. 1997, 16. [Google Scholar] [CrossRef] [PubMed]
- Mimori, T.; Hardin, J.A. Mechanism of interaction between Ku protein and DNA. J. Biol. Chem. 1986, 261, 10375–10379. [Google Scholar] [PubMed]
- Buck, D.; Malivert, L.; de Chasseval, R.; Barraud, A.; Fondanèche, M.C.; Sanal, O.; Plebani, A.; Stéphan, J.L.; Hufnagel, M.; le Deist, F.; et al. Cernunnos, a novel nonhomologous end-joining factor, is mutated in human immunodeficiency with microcephaly. Cell 2006, 124, 287–299. [Google Scholar] [CrossRef] [PubMed]
- Ochi, T.; Blackford, A.N.; Coates, J.; Jhujh, S.; Mehmood, S.; Tamura, N.; Travers, J.; Wu, Q.; Draviam, V.M.; Robinson, C.V.; et al. PAXX, a paralog of XRCC4 and XLF, interacts with Ku to promote DNA double-strand break repair. Science 2015, 347, 185–188. [Google Scholar] [CrossRef] [PubMed]
- Xing, M.; Yang, M.; Huo, W.; Feng, F.; Wei, L.; Jiang, W.; Ning, S.; Yan, Z.; Li, W.; Wang, Q.; et al. Interactome analysis identifies a new paralogue of XRCC4 in non-homologous end joining DNA repair pathway. Nat. Commun. 2015, 6, 6233. [Google Scholar] [CrossRef] [PubMed]
- Craxton, A.; Somers, J.; Munnur, D.; Jukes-Jones, R.; Cain, K.; Malewicz, M. XLS (C9ORF142) is a new component of mammalian DNA double-stranded break repair. Cell Death Differ. 2015, 22, 890–897. [Google Scholar] [CrossRef] [PubMed]
- Lescale, C.; Lenden Hasse, H.; Blackford, A.N.N.; Balmus, G.; Bianchi, J.J.; Yu, W.; Bacoccina, L.; Jarade, A.; Clouin, C.; Sivapalan, R.; et al. Specific roles of XRCC4 paralogs PAXX and XLF during V(D)J recombination. Cell Rep. 2016, 16, 2967–2979. [Google Scholar] [CrossRef] [PubMed]
- Ahnesorg, P.; Smith, P.; Jackson, S.P. XLF interacts with the XRCC4-DNA ligase IV complex to promote DNA nonhomologous end-joining. Cell 2006, 124, 301–313. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Shao, Z.; Jiang, W.; Lee, B.J.; Zha, S. PAXX promotes Ku accumulation at DNA breaks and is essential for end-joining in XLF-deficient mice. Nat. Commun. 2017, 8, 13816. [Google Scholar] [CrossRef] [PubMed]
- Balmus, G.; Barros, A.C.; Wijnhoven, P.W.G.; Lescale, C.; Hasse, H.L.; Boroviak, K.; le Sage, C.; Doe, B.; Speak, A.O.; Galli, A.; et al. Synthetic lethality between PAXX and XLF in mammalian development. Genes Dev. 2016, 30, 2152–2157. [Google Scholar] [CrossRef] [PubMed]
- Mansur, D.S.; Smith, G.L.; Ferguson, B.J. Intracellular sensing of viral DNA by the innate immune system. Microbes Infect. 2014, 16, 1002–1012. [Google Scholar] [CrossRef] [PubMed]
- Unterholzner, L.; Keating, S.E.; Baran, M.; Horan, K.A.; Jensen, S.B.; Sharma, S.; Sirois, C.M.; Jin, T.; Latz, E.; Xiao, T.S.; et al. IFI16 is an innate immune sensor for intracellular DNA. Nat. Immunol. 2010, 11, 997–1004. [Google Scholar] [CrossRef] [PubMed]
- Kerur, N.; Veettil, M.V.; Sharma-Walia, N.; Bottero, V.; Sadagopan, S.; Otageri, P.; Chandran, B. IFI16 acts as a nuclear pathogen sensor to induce the inflammasome in response to Kaposi Sarcoma-associated herpesvirus infection. Cell Host Microbe 2011, 9, 363–375. [Google Scholar] [CrossRef] [PubMed]
- Ferguson, B.J.; Mansur, D.S.; Peters, N.E.; Ren, H.; Smith, G.L. DNA-PK is a DNA sensor for IRF-3-dependent innate immunity. Elife 2012, 1, e00047. [Google Scholar] [CrossRef] [PubMed]
- Morchikh, M.; Cribier, A.; Raffel, R.; Amraoui, S.; Cau, J.; Severac, D.; Dubois, E.; Schwartz, O.; Bennasser, Y.; Benkirane, M. HEXIM1 and NEAT1 long non-coding RNA form a multi-subunit complex that regulates DNA-mediated innate immune response. Mol. Cell 2017, 67, 387–399. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Brann, T.W.; Zhou, M.; Yang, J.; Oguariri, R.M.; Lidie, K.B.; Imamichi, H.; Huang, D.W.; Lempicki, R.A.; Baseler, M.W.; et al. Cutting edge: Ku70 is a novel cytosolic DNA sensor that induces type III rather than type I IFN. J. Immunol. 2011, 186, 4541–4545. [Google Scholar] [CrossRef] [PubMed]
- Sui, H.; Zhou, M.; Imamichi, H.; Jiao, X.; Sherman, B.T.; Lane, H.C.; Imamichi, T. STING is an essential mediator of the Ku70-mediated production of IFN-λ1 in response to exogenous DNA. Sci. Signal. 2017, 10. [Google Scholar] [CrossRef] [PubMed]
- Kondo, T.; Kobayashi, J.; Saitoh, T.; Maruyama, K.; Ishii, K.J.; Barber, G.N.; Komatsu, K.; Akira, S.; Kawai, T. DNA damage sensor MRE11 recognizes cytosolic double-stranded DNA and induces type I interferon by regulating STING trafficking. Proc. Natl. Acad. Sci. USA 2013, 110, 2969–2974. [Google Scholar] [CrossRef] [PubMed]
- Li, X.-D.; Wu, J.; Gao, D.; Wang, H.; Sun, L.; Chen, Z.J. Pivotal roles of cGAS-cGAMP signaling in antiviral defense and immune adjuvant effects. Science 2013, 341. [Google Scholar] [CrossRef] [PubMed]
- Paludan, S.R.R.; Bowie, A.G.G. Immune sensing of DNA. Immunity 2013, 38, 870–880. [Google Scholar] [CrossRef] [PubMed]
- Stetson, D.B.; Medzhitov, R. Recognition of cytosolic DNA activates an IRF3-dependent innate immune response. Immunity 2006, 24, 93–103. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, Y.; Chen, Z.J. STING specifies IRF3 phosphorylation by TBK1 in the cytosolic DNA signaling pathway. Sci. Signal. 2012. [Google Scholar] [CrossRef] [PubMed]
- Unterholzner, L. The interferon response to intracellular DNA: Why so many receptors? Immunobiology 2013, 218, 1312–1321. [Google Scholar] [CrossRef] [PubMed]
- Luftig, M.A. Viruses and the DNA damage response: Activation and antagonism. Annu. Rev. Virol. 2014, 1, 605–625. [Google Scholar] [CrossRef] [PubMed]
- Trigg, B.J.; Ferguson, B.J. Functions of DNA damage machinery in the innate immune response to DNA virus infection. Curr. Opin. Virol. 2015, 15, 56–62. [Google Scholar] [CrossRef] [PubMed]
- Smith, S.; Reuven, N.; Mohni, K.N.; Schumacher, A.J.; Weller, S.K. Structure of the HSV-1 genome: Manipulation of nicks and gaps can abrogate infectivity and alter the cellular DNA damage response. J. Virol. 2014, 88, 10146–10156. [Google Scholar] [CrossRef] [PubMed]
- Weller, S.K.; Bai, P.; Buchek, G.; Korza, G.; Weller, S. Herpes simplex virus reorganizes the cellular DNA repair and protein quality control machinery. PLoS Pathog. 2010, 6, e1001105. [Google Scholar] [CrossRef] [PubMed]
- Smith, S.; Weller, S.K. HSV-I and the cellular DNA damage response. Future Virol. 2015, 10, 383–397. [Google Scholar] [CrossRef] [PubMed]
- Lees-Miller, S.P.; Long, M.C.; Kilvert, M.A.; Lam, V.; Rice, S.A.; Spencer, C.A. Attenuation of DNA-dependent protein kinase activity and its catalytic subunit by the herpes simplex virus type 1 transactivator ICP0. J. Virol. 1996, 70, 7471–7477. [Google Scholar] [PubMed]
- Weitzman, M.D.; Carson, C.T.; Schwartz, R.A.; Lilley, C.E. Interactions of viruses with the cellular DNA repair machinery. DNA Repair 2004, 3, 1165–1173. [Google Scholar] [CrossRef] [PubMed]
- De Chiara, G.; Racaniello, M.; Mollinari, C.; Marcocci, M.E.; Aversa, G.; Cardinale, A.; Giovanetti, A.; Garaci, E.; Palamara, A.T.; Merlo, D. Herpes simplex virus-type1 (HSV-1) impairs DNA repair in cortical neurons. Front. Aging Neurosci. 2016, 8, 242. [Google Scholar] [CrossRef] [PubMed]
- Weller, S.K.; Coen, D.M. Herpes simplex viruses: Mechanisms of DNA replication. Cold Spring Harb. Perspect. Biol. 2012, 4, a013011. [Google Scholar] [CrossRef] [PubMed]
- Karttunen, H.; Savas, J.N.N.; McKinney, C.; Chen, Y.H.; Yates, J.R.R.; Hukkanen, V.; Huang, T.T.; Mohr, I. Co-opting the fanconi anemia genomic stability pathway enables herpesvirus DNA synthesis and productive growth. Mol. Cell 2014, 55, 111–122. [Google Scholar] [CrossRef] [PubMed]
- Muylaert, I.; Elias, P. Knockdown of DNA ligase IV/XRCC4 by RNA interference inhibits herpes simplex virus type I DNA replication. J. Biol. Chem. 2007, 282, 10865–10872. [Google Scholar] [CrossRef] [PubMed]
- Blackford, A.N.; Jackson, S.P. ATM, ATR, and DNA-PK: The trinity at the heart of the DNA damage response. Mol. Cell 2017, 66, 801–817. [Google Scholar] [CrossRef] [PubMed]
- Stiff, T.; Walker, S.A.; Cerosaletti, K.; Goodarzi, A.A.; Petermann, E.; Concannon, P.; O’Driscoll, M.; Jeggo, P.A. ATR-dependent phosphorylation and activation of ATM in response to UV treatment or replication fork stalling. EMBO J. 2006, 25, 5775–5782. [Google Scholar] [CrossRef] [PubMed]
- Mohni, K.N.; Livingston, C.M.; Cortez, D.; Weller, S.K. ATR and ATRIP are recruited to herpes simplex virus type 1 replication compartments even though ATR signaling is disabled. J. Virol. 2010, 84, 12152–12164. [Google Scholar] [CrossRef] [PubMed]
- Mohni, K.N.; Smith, S.; Dee, A.R.; Schumacher, A.J.; Weller, S.K. Herpes simplex virus type 1 single strand DNA binding protein and helicase/primase complex disable cellular ATR signaling. PLoS Pathog. 2013, 9, e1003652. [Google Scholar] [CrossRef] [PubMed]
- Wilkinson, D.E.; Weller, S.K. Herpes simplex virus type I disrupts the ATR-dependent DNA-damage response during lytic infection. J. Cell Sci. 2006, 119, 2695–26703. [Google Scholar] [CrossRef] [PubMed]
- Shirata, N.; Kudoh, A.; Daikoku, T.; Tatsumi, Y.; Fujita, M.; Kiyono, T.; Sugaya, Y.; Isomura, H.; Ishizaki, K.; Tsurumi, T. Activation of ataxia telangiectasia-mutated DNA damage checkpoint signal transduction elicited by herpes simplex virus infection. J. Biol. Chem. 2005, 280, 30336–30341. [Google Scholar] [CrossRef] [PubMed]
- Wilkinson, D.E.; Weller, S.K. Recruitment of cellular recombination and repair proteins to sites of herpes simplex virus type 1 DNA replication is dependent on the composition of viral proteins within prereplicative sites and correlates with the induction of the DNA damage response. J. Virol. 2004, 78, 4783–4796. [Google Scholar] [CrossRef] [PubMed]
- Stow, N.D.; Stow, E.C. Isolation and characterization of a herpes simplex virus type 1 mutant containing a deletion within the gene encoding the immediate early polypeptide VMW110. J. Gen. Virol. 1986, 67, 2571–2585. [Google Scholar] [CrossRef] [PubMed]
- McGeoch, D.J.; Dalrymple, M.A.; Davison, A.J.; Dolan, A.; Frame, M.C.; McNab, D.; Perry, L.J.; Scott, J.E.; Taylor, P. The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. J. Gen. Virol. 1988, 69, 1531–1574. [Google Scholar] [CrossRef] [PubMed]
- Parkinson, J.; Lees-Miller, S.P.; Everett, R.D. Herpes simplex virus type 1 immediate-early protein VMW110 induces the proteasome-dependent degradation of the catalytic subunit of DNA-dependent protein kinase. J. Virol. 1999, 73, 650–657. [Google Scholar] [PubMed]
- Bell, S.; Cranage, M.; Borysiewicz, L.; Minson, T. Induction of immunoglobulin G Fc receptors by recombinant vaccinia viruses expressing glycoproteins E and I of herpes simplex virus type 1. J. Virol. 1990, 64, 2181–2186. [Google Scholar] [PubMed]
- Orzalli, M.H.; Broekema, N.M.; Knipe, D.M. Varying roles of herpes simplex virus 1 ICP0 and VHS in loss of cellular IFI16 in different cell types. J. Virol. 2016. [Google Scholar] [CrossRef] [PubMed]
- Orzalli, M.H.; DeLuca, N.A.; Knipe, D.M. Nuclear IFI16 induction of IRF-3 signaling during herpesviral infection and degradation of IFI16 by the viral ICP0 protein. Proc. Natl. Acad. Sci. USA 2012, 109, E3008–E3017. [Google Scholar] [CrossRef] [PubMed]
- Christensen, M.H.; Paludan, S.R. Viral evasion of DNA-stimulated innate immune responses. Cell. Mol. Immunol. 2016. [Google Scholar] [CrossRef] [PubMed]
- Honda, K.; Yanai, H.; Negishi, H.; Asagiri, M.; Sato, M.; Mizutani, T.; Shimada, N.; Ohba, Y.; Takaoka, A.; Yoshida, N.; et al. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 2005, 434, 772–777. [Google Scholar] [CrossRef] [PubMed]
- Lin, R.; Noyce, R.S.; Collins, S.E.; Everett, R.D.; Mossman, K.L. The herpes simplex virus ICP0 RING finger domain inhibits IRF3- and IRF7-mediated activation of interferon-stimulated genes. J. Virol. 2004, 78, 1675–1684. [Google Scholar] [CrossRef] [PubMed]
- Lilley, C.E.; Chaurushiya, M.S.; Boutell, C.; Everett, R.D.; Weitzman, M.D. The intrinsic antiviral defense to incoming HSV-1 genomes includes specific DNA repair proteins and is counteracted by the viral protein ICP0. PLoS Pathog. 2011, 7, e1002084. [Google Scholar] [CrossRef] [PubMed]
- Sowd, G.A.; Mody, D.; Eggold, J.; Cortez, D.; Friedman, K.L.; Fanning, E. SV40 utilizes ATM kinase activity to prevent non-homologous end joining of broken viral DNA replication products. PLoS Pathog. 2014, 10, e1004536. [Google Scholar] [CrossRef] [PubMed]
- Homa, F.L.; Brown, J.C. Capsid assembly and DNA packaging in herpes simplex virus. Rev. Med. Virol. 1997, 7, 107–122. [Google Scholar] [CrossRef]
- Sheaffer, A.K.; Newcomb, W.W.; Gao, M.; Yu, D.; Weller, S.K.; Brown, J.C.; Tenney, D.J. Herpes simplex virus DNA cleavage and packaging proteins associate with the procapsid prior to its maturation. J. Virol. 2001, 75, 687–698. [Google Scholar] [CrossRef] [PubMed]
- Lilley, C.E.; Carson, C.T.; Muotri, A.R.; Gage, F.H.; Weitzman, M.D. DNA repair proteins affect the lifecycle of herpes simplex virus 1. Proc. Natl. Acad. Sci. USA 2005, 102, 5844–5849. [Google Scholar] [CrossRef] [PubMed]
- Taylor, T.J.; Knipe, D.M. Proteomics of herpes simplex virus replication compartments: Association of cellular DNA replication, repair, recombination, and chromatin remodeling proteins with ICP8. J. Virol. 2004, 78, 5856–5866. [Google Scholar] [CrossRef] [PubMed]
- Mohni, K.N.; Mastrocola, A.S.; Bai, P.; Weller, S.K.; Heinen, C.D. DNA mismatch repair proteins are required for efficient herpes simplex virus 1 replication. J. Virol. 2011, 85, 12241–12253. [Google Scholar] [CrossRef] [PubMed]
- Mavromara-Nazos, P.; Roizman, B. Activation of herpes simplex virus 1 gamma 2 genes by viral DNA replication. Virology 1987, 161, 593–598. [Google Scholar] [CrossRef]
- Honess, R.W.; Roizman, B. Regulation of herpesvirus macromolecular synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins. J. Virol. 1974, 14, 8–19. [Google Scholar] [PubMed]
- Balasubramanian, N.; Bai, P.; Buchek, G.; Korza, G.; Weller, S.K. Physical interaction between the herpes simplex virus type 1 exonuclease, UL12, and the DNA double-strand break-sensing MRN complex. J. Virol. 2010, 84, 12504–12514. [Google Scholar] [CrossRef] [PubMed]
- Schumacher, A.J.; Mohni, K.N.; Kan, Y.; Hendrickson, E.A.; Stark, J.M.; Weller, S.K. The HSV-1 exonuclease, UL12, stimulates recombination by a single strand annealing mechanism. PLoS Pathog. 2012, 8, e1002862. [Google Scholar] [CrossRef] [PubMed]
- Mohni, K.N.; Dee, A.R.; Smith, S.; Schumacher, A.J.; Weller, S.K. Efficient herpes simplex virus 1 replication requires cellular ATR pathway proteins. J. Virol. 2013, 87, 531–542. [Google Scholar] [CrossRef] [PubMed]
- Neal, J.A.; Dang, V.; Douglas, P.; Wold, M.S.; Lees-Miller, S.P.; Meek, K. Inhibition of homologous recombination by DNA-dependent protein kinase requires kinase activity, is titratable, and is modulated by autophosphorylation. Mol. Cell. Biol. 2011, 31, 1719–1733. [Google Scholar] [CrossRef] [PubMed]
- Heming, J.D.; Huffman, J.B.; Jones, L.M.; Homa, F.L. Isolation and characterization of the herpes simplex virus 1 terminase complex. J. Virol. 2014, 88, 225–236. [Google Scholar] [CrossRef] [PubMed]
- Jackson, S.A.; DeLuca, N.A. Relationship of herpes simplex virus genome configuration to productive and persistent infections. Proc. Natl. Acad. Sci. USA 2003, 100, 7871–7876. [Google Scholar] [CrossRef] [PubMed]
- Efstathiou, S.; Minson, A.C.; Field, H.J.; Anderson, J.R.; Wildy, P. Detection of herpes simplex virus-specific DNA sequences in latently infected mice and in humans. J. Virol. 1986, 57, 446–455. [Google Scholar] [PubMed]
- Orzalli, M.H.; Conwell, S.E.; Berrios, C.; DeCaprio, J.A.; Knipe, D.M. Nuclear interferon-inducible protein 16 promotes silencing of herpesviral and transfected DNA. Proc. Natl. Acad. Sci. USA 2013, 110, E4492–E4501. [Google Scholar] [CrossRef] [PubMed]
- Lilley, C.E.; Chaurushiya, M.S.; Boutell, C.; Landry, S.; Suh, J.; Panier, S.; Everett, R.D.; Stewart, G.S.; Durocher, D.; Weitzman, M.D. A viral E3 ligase targets RNF8 and RNF168 to control histone ubiquitination and DNA damage responses. EMBO J. 2010, 29, 943–955. [Google Scholar] [CrossRef] [PubMed]
- Kibler, P.K.; Duncan, J.; Keith, B.D.; Hupel, T.; Smiley, J.R. Regulation of herpes simplex virus true late gene expression: Sequences downstream from the US11 TATA box inhibit expression from an unreplicated template. J. Virol. 1991, 65, 6749–6760. [Google Scholar] [PubMed]
- Wu, Z.H.; Shi, Y.; Tibbetts, R.S.; Miyamoto, S. Molecular linkage between the kinase ATM and NF-κB signaling in response to genotoxic stimuli. Science 2006, 311, 1141–1146. [Google Scholar] [CrossRef] [PubMed]
- Brzostek-Racine, S.; Gordon, C.; Van Scoy, S.; Reich, N.C. The DNA damage response induces IFN. J. Immunol. 2011, 187, 5336–5345. [Google Scholar] [CrossRef] [PubMed]
- Kim, T.Y.K.; Kim, T.Y.K.; Song, Y.H.; Min, I.M.; Yim, J.; Kim, T.Y.K. Activation of interferon regulatory factor 3 in response to DNA-damaging agents. J. Biol. Chem. 1999, 274, 30686–30689. [Google Scholar] [CrossRef] [PubMed]
- Roth, S.; Rottach, A.; Lotz-Havla, A.S.; Laux, V.; Muschaweckh, A.; Gersting, S.W.; Muntau, A.C.; Hopfner, K.P.; Jin, L.; Vanness, K.; et al. Rad50-CARD9 interactions link cytosolic DNA sensing to IL-1β production. Nat. Immunol. 2014, 15, 538–545. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primer Sequence |
---|---|
ICP27 (fwd) | GTGCAAGATGTGCATCCACCACAACCTGCC |
ICP27 (rev) | GCCAGAATGACAAACACGAAGGATGCAATG |
ICP4 (fwd) | GACGTGCGCGTGGTGGTGCTGTACTCG |
ICP4 (rev) | GCGCACGGTGTTGACCACGATGAGCC |
US11 (fwd) | CTTCAGATGGCTTCGAGATCGTAG |
US11 (rev) | TGTTTACTTAAAAGGCGTGCCGT |
gB (fwd) | TGTGTACATGTCCCCGTTTTACG |
gB (rev) | GCGTAGAAGCCGTCAACCT |
Cxcl10 (fwd) | GTGGCATTCAAGGAGTACCTC |
Cxcl10 (rev) | GCCTTCGATTCTGGATTCAGACA |
Ifnb (fwd) | ACATCCCTGAGGAGATTAAGCA |
Ifnb (rev) | GCCAGGAGGTTCTCAACAATAG |
Name | Sequence | Concentration |
---|---|---|
ICP0 (forward) | GGAAAGGCGTGGGGTATAA | 24 nM |
ICP0 (reverse) | AACGTAGGCGGGGCTTC | 72 nM |
ICP0 probe | 6FAM-TCGCATTTGCACCTCGGCAC-BBQ | 50 nM |
GAPDH (fwd) | CGGCTACTAGCGGTTTTACG | 72 nM |
GAPDH (rev) | AAGAAGATGCGGCTGACTGT | 24 nM |
GAPDH probe | Cy5-CACGTAGCTCAGGCCTCAAGACCT-BBQ | 50 nM |
Name | Source | Dilution |
---|---|---|
PAXX | Sigma, Dorset, UK (HPA045268) | 1:1000 |
PARP-1 | Abcam, Cambridge, UK (ab6079) | 1:1000 |
Ku80 | Santa Cruz, Dallas, TX, USA (sc1483) | 1:500 |
Tubulin | Millipore, Burlington, MA, USA (05-829) | 1:15,000 |
HSV-1 VP22 | Gift from Geoffrey Smith (AGV031) | 1:20,000 |
HSV-1 ICP4 | Gift from Colin Crump | 1:50 |
HSV-1 VP5 | Gift from Colin Crump | 1:500 |
HSV-1 ICP0 | Abcam (ab6513) | 1:2000 |
IRDye 800CW anti-mouse | Licor, Lincoln, NE, USA (926-32210) | 1:10,000 |
IRDye 680RD anti-rabbit | Licor (926-68071) | 1:10,000 |
Anti-mouse (HRP-conjugated) | Sigma (A4416) | 1:10,000 |
Anti-rabbit (HRP-conjugated) | Sigma (A6154) | 1:20,000 |
Anti-goat (HRP-conjugated) | Sigma (A5420) | 1:20,000 |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Trigg, B.J.; Lauer, K.B.; Fernandes dos Santos, P.; Coleman, H.; Balmus, G.; Mansur, D.S.; Ferguson, B.J. The Non-Homologous End Joining Protein PAXX Acts to Restrict HSV-1 Infection. Viruses 2017, 9, 342. https://doi.org/10.3390/v9110342
Trigg BJ, Lauer KB, Fernandes dos Santos P, Coleman H, Balmus G, Mansur DS, Ferguson BJ. The Non-Homologous End Joining Protein PAXX Acts to Restrict HSV-1 Infection. Viruses. 2017; 9(11):342. https://doi.org/10.3390/v9110342
Chicago/Turabian StyleTrigg, Ben J., Katharina B. Lauer, Paula Fernandes dos Santos, Heather Coleman, Gabriel Balmus, Daniel S. Mansur, and Brian J. Ferguson. 2017. "The Non-Homologous End Joining Protein PAXX Acts to Restrict HSV-1 Infection" Viruses 9, no. 11: 342. https://doi.org/10.3390/v9110342