Human Salivary Histatin-1 Attenuates Osteoarthritis through Promoting M1/M2 Macrophage Transition
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Study
2.2. OA Animal Model
2.3. Micro-CT Analysis
2.4. Histological Observation
2.5. Air Pouch Acute Inflammation Model
2.6. Cell Culture
2.7. Effects of Hst1 on Cell Metabolic Activity
2.8. LPS and Hst1 Treatment
2.9. Cytokine Expression Analysis with ELISA
2.10. RT-qPCR
2.11. Immunofluorescence (IF)
2.12. Flow Cytometry (FCM)
2.13. Metabolic Assays
2.14. Western Blot Assay
2.15. High-Throughput Generation Sequencing
2.16. Chondrogenic Differentiation Assay
2.16.1. Conditioned Medium (CM) Collection
2.16.2. Effects of CM on Cell Metabolic Activity
2.16.3. Cell Migration Assay
2.16.4. Alcian Blue Staining and Safranin O Staining
2.17. Statistical Analysis
3. Results
3.1. Hst1 Attenuated the Bone and Cartilage Damage in MIA-Induced Knee OA
3.2. Hst1 Did Not Affect the Differentiation of Chondrogenic Lineage Cells
3.3. Hst1 Suppressed Inflammation in Acute Air Pouch Model in Mice
3.4. Hst1 Mediated M1-to-M2 Macrophage Phenotype Transition
3.5. Hst1 Treatment Downregulated NF-κB and MAPK Signaling in LPS-Treated Macrophages
3.6. Hst1 Restored Metabolic Activity, Migration, Chondrogenic Differentiation, and Matrix Destruction in LPS/Macrophage-CM-Treated ADTC5 Cells
3.7. Hst1 Attenuated LPS/Macrophage-CM-Induced Apoptosis in ATDC5 Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Felson, D.; Lawrence, R.C.; Dieppe, P.A.; Hirsch, R.; Helmick, C.G.; Jordan, J.M.; Kington, R.S.; Lane, N.E.; Nevitt, M.C.; Zhang, Y.; et al. Osteoarthritis: New insights. Part 1: The disease and its risk factors. Ann. Intern. Med. 2000, 133, 635–646. [Google Scholar] [CrossRef] [PubMed]
- Hunter, D.J.; March, L.; Chew, M. Osteoarthritis in 2020 and beyond: A Lancet Commission. Lancet 2020, 396, 1711–1712. [Google Scholar] [CrossRef] [PubMed]
- Zhou, F.; Mei, J.; Han, X.; Li, H.; Yang, S.; Wang, M.; Chu, L.; Qiao, H.; Tang, T. Kinsenoside attenuates osteoarthritis by repolarizing macrophages through inactivating NF-κB/MAPK signaling and protecting chondrocytes. Acta Pharm. Sin. B 2019, 9, 973–985. [Google Scholar] [CrossRef] [PubMed]
- Glyn-Jones, S.; Palmer, A.J.; Agricola, R.; Price, A.J.; Vincent, T.L.; Weinans, H.; Carr, A.J. Osteoarthritis. Lancet 2015, 386, 376–387. [Google Scholar] [CrossRef]
- Robinson, W.H.; Lepus, C.M.; Wang, Q.; Raghu, H.; Mao, R.; Lindstrom, T.M.; Sokolove, J. Low-grade inflammation as a key mediator of the pathogenesis of osteoarthritis. Nat. Rev. Rheumatol. 2016, 12, 580–592. [Google Scholar] [CrossRef]
- Sellam, J.; Berenbaum, F. The role of synovitis in pathophysiology and clinical symptoms of osteoarthritis. Nat. Rev. Rheumatol. 2010, 6, 625–635. [Google Scholar] [CrossRef]
- Sun, A.R.; Friis, T.; Sekar, S.; Crawford, R.; Xiao, Y.; Prasadam, I. Is Synovial Macrophage Activation the Inflammatory Link Between Obesity and Osteoarthritis? Curr. Rheumatol. Rep. 2016, 18, 57. [Google Scholar] [CrossRef]
- Muñoz, J.; Akhavan, N.; Mullins, A.; Arjmandi, B. Macrophage Polarization and Osteoporosis: A Review. Nutrients 2020, 12, 2999. [Google Scholar] [CrossRef]
- Yamaguchi, T.; Movila, A.; Kataoka, S.; Wisitrasameewong, W.; Ruiz Torruella, M.; Murakoshi, M.; Murakami, S.; Kawai, T. Proinflammatory M1 Macrophages Inhibit RANKL-Induced Osteoclastogenesis. Infect. Immun. 2016, 84, 2802–2812. [Google Scholar] [CrossRef]
- Yunna, C.; Mengru, H.; Lei, W.; Weidong, C. Macrophage M1/M2 polarization. Eur. J. Pharmacol. 2020, 877, 173090. [Google Scholar] [CrossRef]
- Rőszer, T. Understanding the Mysterious M2 Macrophage through Activation Markers and Effector Mechanisms. Mediat. Inflamm. 2015, 2015, 816460. [Google Scholar] [CrossRef]
- Utomo, L.; Bastiaansen-Jenniskens, Y.; Verhaar, J.; van Osch, G. Cartilage inflammation and degeneration is enhanced by pro-inflammatory (M1) macrophages in vitro, but not inhibited directly by anti-inflammatory (M2) macrophages. Osteoarthr. Cartil. 2016, 24, 2162–2170. [Google Scholar] [CrossRef]
- Hwang, H.S.; Kim, H.A. Chondrocyte Apoptosis in the Pathogenesis of Osteoarthritis. Int. J. Mol. Sci. 2015, 16, 26035–26054. [Google Scholar] [CrossRef]
- Blanco, F.J.; Valdes, A.M.; Rego-Pérez, I. Mitochondrial DNA variation and the pathogenesis of osteoarthritis phenotypes. Nat. Rev. Rheumatol. 2018, 14, 327–340. [Google Scholar] [CrossRef]
- Yang, C.Y.; Chanalaris, A.; Troeberg, L. ADAMTS and ADAM metalloproteinases in osteoarthritis—Looking beyond the ‘usual suspects’. Osteoarthr. Cartil. 2017, 25, 1000–1009. [Google Scholar] [CrossRef]
- Bannuru, R.R.; Osani, M.C.; Vaysbrot, E.E.; Arden, N.K.; Bennell, K.; Bierma-Zeinstra, S.M.A.; Kraus, V.B.; Lohmander, L.S.; Abbott, J.H.; Bhandari, M.; et al. OARSI guidelines for the non-surgical management of knee, hip, and polyarticular osteoarthritis. Osteoarthr. Cartil. 2019, 27, 1578–1589. [Google Scholar] [CrossRef]
- Jones, I.A.; Togashi, R.; Wilson, M.L.; Heckmann, N.; Vangsness, C.T., Jr. Intra-articular treatment options for knee osteoarthritis. Nat. Rev. Rheumatol. 2019, 15, 77–90. [Google Scholar] [CrossRef]
- Altman, R.; Fredericson, M.; Bhattacharyya, S.K.; Bisson, B.; Abbott, T.; Yadalam, S.; Kim, M. Association between Hyaluronic Acid Injections and Time-to-Total Knee Replacement Surgery. J. Knee Surg. 2016, 29, 564–570. [Google Scholar] [CrossRef]
- Kotevoglu, N.; Iyıbozkurt, P.C.; Hız, O.; Toktaş, H.; Kuran, B.; Hiz, O. A prospective randomised controlled clinical trial comparing the efficacy of different molecular weight hyaluronan solutions in the treatment of knee osteoarthritis. Rheumatol. Int. 2006, 26, 325–330. [Google Scholar] [CrossRef]
- Cho, Y.; Jeong, S.; Kim, H.; Kang, D.; Lee, J.; Kang, S.-B.; Kim, J.-H. Disease-modifying therapeutic strategies in osteoarthritis: Current status and future directions. Exp. Mol. Med. 2021, 53, 1689–1696. [Google Scholar] [CrossRef]
- Shah, D.; Ali, M.; Shukla, D.; Jain, S.; Aakalu, V.K. Effects of histatin-1 peptide on human corneal epithelial cells. PLoS ONE 2017, 12, e0178030. [Google Scholar] [CrossRef] [PubMed]
- Shah, D.; Son, K.-N.; Kalmodia, S.; Lee, B.-S.; Ali, M.; Balasubramaniam, A.; Shukla, D.; Aakalu, V.K. Wound Healing Properties of Histatin-5 and Identification of a Functional Domain Required for Histatin-5-Induced Cell Migration. Mol. Ther. Methods Clin. Dev. 2020, 17, 709–716. [Google Scholar] [CrossRef] [PubMed]
- Komatsu, T.; Kobayashi, K.; Helmerhorst, E.; Oppenheim, F.; Lee, M.C.-I. Direct assessment of the antioxidant property of salivary histatin. J. Clin. Biochem. Nutr. 2019, 65, 217–222. [Google Scholar] [CrossRef] [PubMed]
- Torres, P.; Castro, M.; Reyes, M.; Torres, V.A. Histatins, wound healing, and cell migration. Oral Dis. 2018, 24, 1150–1160. [Google Scholar] [CrossRef] [PubMed]
- Lin, Z.; Li, R.; Liu, Y.; Zhao, Y.; Ao, N.; Wang, J.; Li, L.; Wu, G. Histatin1-modified thiolated chitosan hydrogels enhance wound healing by accelerating cell adhesion, migration and angiogenesis. Carbohydr. Polym. 2020, 230, 115710. [Google Scholar] [CrossRef]
- Shi, C.; Yao, Y.; Wang, L.; Sun, P.; Feng, J.; Wu, G. Human Salivary Histatin-1-Functionalized Gelatin Methacrylate Hydrogels Promote the Regeneration of Cartilage and Subchondral Bone in Temporomandibular Joints. Pharmaceuticals 2021, 14, 484. [Google Scholar] [CrossRef]
- Lei, X.; Cheng, L.; Lin, H.; Pang, M.; Yao, Z.; Chen, C.; Forouzanfar, T.; Bikker, F.J.; Wu, G.; Cheng, B. Human Salivary Histatin-1 Is More Efficacious in Promoting Acute Skin Wound Healing Than Acellular Dermal Matrix Paste. Front. Bioeng. Biotechnol. 2020, 8, 999. [Google Scholar] [CrossRef]
- Lee, S.; Son, K.-N.; Shah, D.; Ali, M.; Balasubramaniam, A.; Shukla, D.; Aakalu, V. Histatin-1 Attenuates LPS-Induced Inflammatory Signaling in RAW264.7 Macrophages. Int. J. Mol. Sci. 2021, 22, 7856. [Google Scholar] [CrossRef]
- Sun, P.; Shi, A.; Shen, C.; Liu, Y.; Wu, G.; Feng, J. Human salivary histatin-1 (Hst1) promotes bone morphogenetic protein 2 (BMP2)-induced osteogenesis and angiogenesis. FEBS Open Bio 2020, 10, 1503–1515. [Google Scholar] [CrossRef]
- Zhu, S.; Yu, C.; Zhao, M.; Liu, N.; Chen, Z.; Liu, J.; Li, G.; Deng, Y.; Sai, X.; Huang, H.; et al. Histatin-1 loaded multifunctional, adhesive and conductive biomolecular hydrogel to treat diabetic wound. Int. J. Biol. Macromol. 2022, 209, 1020–1031. [Google Scholar] [CrossRef]
- Cao, Y.; Shi, X.; Zhao, X.; Chen, B.; Li, X.; Li, Y.; Chen, Y.; Chen, C.; Lu, H.; Liu, J. Acellular dermal matrix decorated with collagen-affinity peptide accelerate diabetic wound healing through sustained releasing Histatin-1 mediated promotion of angiogenesis. Int. J. Pharm. 2022, 624, 122017. [Google Scholar] [CrossRef]
- Liu-Bryan, R.; Scott, P.; Sydlaske, A.; Rose, D.M.; Terkeltaub, R. Innate immunity conferred by Toll-like receptors 2 and 4 and myeloid differentiation factor 88 expression is pivotal to monosodium urate monohydrate crystal-induced inflammation. Arthritis Rheum. 2005, 52, 2936–2946. [Google Scholar] [CrossRef]
- Fu, M.; Liu, Y.; Cheng, H.; Xu, K.; Wang, G. Coptis chinensis and dried ginger herb combination inhibits gastric tumor growth by interfering with glucose metabolism via LDHA and SLC2A1. J. Ethnopharmacol. 2022, 284, 114771. [Google Scholar] [CrossRef]
- Zhang, J.; Zhang, Q. Using Seahorse Machine to Measure OCR and ECAR in Cancer Cells. Methods Mol. Biol. 2019, 1928, 353–363. [Google Scholar]
- Zhong, W.; Li, X.; Pathak, J.L.; Chen, L.; Cao, W.; Zhu, M.; Luo, Q.; Wu, A.; Chen, Y.; Yi, L.; et al. Dicalcium silicate microparticles modulate the differential expression of circRNAs and mRNAs in BMSCs and promote osteogenesis via circ_1983-miR-6931-Gas7 interaction. Biomater. Sci. 2020, 8, 3664–3677. [Google Scholar] [CrossRef]
- Zhang, H.; Cai, D.; Bai, X. Macrophages regulate the progression of osteoarthritis. Osteoarthr. Cartil. 2020, 28, 555–561. [Google Scholar] [CrossRef]
- Palmieri, E.M.; Gonzalez-Cotto, M.; Baseler, W.A.; Davies, L.C.; Ghesquière, B.; Maio, N.; Rice, C.M.; Rouault, T.A.; Cassel, T.; Higashi, R.M.; et al. Nitric oxide orchestrates metabolic rewiring in M1 macrophages by targeting aconitase 2 and pyruvate dehydrogenase. Nat. Commun. 2020, 11, 698. [Google Scholar] [CrossRef]
- Bruno, F.; Malvaso, A.; Canterini, S.; Bruni, A.C. Antimicrobial Peptides (AMPs) in the Pathogenesis of Alzheimer’s Disease: Implications for Diagnosis and Treatment. Antibiotics 2022, 11, 726. [Google Scholar] [CrossRef]
- Cheng, L.; Lei, X.; Yang, Z.; Kong, Y.; Xu, P.; Peng, S.; Wang, J.; Chen, C.; Dong, Y.; Hu, X.; et al. Histatin 1 enhanced the speed and quality of wound healing through regulating the behaviour of fibroblast. Cell Prolif. 2021, 54, e13087. [Google Scholar] [CrossRef]
- Liang, Y.; Xu, X.; Xu, L.; Prasadam, I.; Duan, L.; Xiao, Y.; Xia, J. Non-surgical osteoarthritis therapy, intra-articular drug delivery towards clinical applications. J. Drug Target. 2021, 29, 609–616. [Google Scholar] [CrossRef]
- Zhu, B.; Cui, G.; Zhang, Q.; Cheng, X.; Tang, S. Desumoylation of aggrecan and collagen II facilitates degradation via aggrecanases in IL-1β-mediated osteoarthritis. J. Pain Res. 2019, 12, 2145–2153. [Google Scholar] [CrossRef] [PubMed]
- Roger, Y.; Sydow, S.; Burmeister, L.; Menzel, H.; Hoffmann, A. Sustained release of TGF-β(3) from polysaccharide nanoparticles induces chondrogenic differentiation of human mesenchymal stromal cells. Colloids Surf. B Biointerfaces 2020, 189, 110843. [Google Scholar] [CrossRef]
- Zhou, N.; Li, Q.; Lin, X.; Hu, N.; Liao, J.-Y.; Lin, L.-B.; Zhao, C.; Hu, Z.-M.; Liang, X.; Xu, W.; et al. BMP2 induces chondrogenic differentiation, osteogenic differentiation and endochondral ossification in stem cells. Cell Tissue Res. 2016, 366, 101–111. [Google Scholar] [CrossRef] [PubMed]
- Peng, X.; Zhang, Y.; Wang, Y.; He, Q.; Yu, Q. IGF-1 and BMP-7 synergistically stimulate articular cartilage repairing in the rabbit knees by improving chondrogenic differentiation of bone-marrow mesenchymal stem cells. J. Cell. Biochem. 2019, 120, 5570–5582. [Google Scholar] [CrossRef]
- Wei, P.; Xu, Y.; Gu, Y.; Yao, Q.; Li, J.; Wang, L. IGF-1-releasing PLGA nanoparticles modified 3D printed PCL scaffolds for cartilage tissue engineering. Drug Deliv. 2020, 27, 1106–1114. [Google Scholar] [CrossRef] [PubMed]
- De Lange-Brokaar, B.J.; Ioan-Facsinay, A.; Van Osch, G.J.; Zuurmond, A.M.; Schoones, J.; Toes, R.E.; Huizinga, T.W.; Kloppenburg, M. Synovial inflammation, immune cells and their cytokines in osteoarthritis: A review. Osteoarthr. Cartil. 2012, 20, 1484–1499. [Google Scholar] [CrossRef]
- Cabău, G.; Crișan, T.O.; Klück, V.; Popp, R.A.; Joosten, L.A.B. Urate-induced immune programming: Consequences for gouty arthritis and hyperuricemia. Immunol. Rev. 2020, 294, 92–105. [Google Scholar] [CrossRef]
- Bilsborrow, J.B.; Doherty, E.; Tilstam, P.V.; Bucala, R. Macrophage migration inhibitory factor (MIF) as a therapeutic target for rheumatoid arthritis and systemic lupus erythematosus. Expert Opin. Ther. Targets 2019, 23, 733–744. [Google Scholar] [CrossRef]
- Fernandes, T.L.; Gomoll, A.H.; Lattermann, C.; Hernandez, A.J.; Bueno, D.F.; Amano, M.T. Macrophage: A Potential Target on Cartilage Regeneration. Front. Immunol. 2020, 11, 111. [Google Scholar] [CrossRef]
- Wu, C.-L.; Harasymowicz, N.S.; Klimak, M.A.; Collins, K.H.; Guilak, F. The role of macrophages in osteoarthritis and cartilage repair. Osteoarthr. Cartil. 2020, 28, 544–554. [Google Scholar] [CrossRef]
- Sun, Y.; Zuo, Z.; Kuang, Y. An Emerging Target in the Battle against Osteoarthritis: Macrophage Polarization. Int. J. Mol. Sci. 2020, 21, 8513. [Google Scholar] [CrossRef]
- Gordon, S.; Martinez, F.O. Alternative activation of macrophages: Mechanism and functions. Immunity 2010, 32, 593–604. [Google Scholar] [CrossRef]
- Jiang, G.; Li, S.; Yu, K.; He, B.; Hong, J.; Xu, T.; Meng, J.; Ye, C.; Chen, Y.; Shi, Z.; et al. A 3D-printed PRP-GelMA hydrogel promotes osteochondral regeneration through M2 macrophage polarization in a rabbit model. Acta Biomater. 2021, 128, 150–162. [Google Scholar] [CrossRef]
- Assis, L.H.P.; Dorighello, G.G.; Oliveira, H.C.F. Pro-inflammatory polarization of macrophages is associated with reduced endoplasmic reticulum-mitochondria interaction. Biochem. Biophys. Res. Commun. 2022, 606, 61–67. [Google Scholar] [CrossRef]
- Olefsky, J.M.; Glass, C.K. Macrophages, inflammation, and insulin resistance. Annu. Rev. Physiol. 2010, 72, 219–246. [Google Scholar] [CrossRef]
- O’Brien, K.; Tailor, P.; Leonard, C.; DiFrancesco, L.M.; Hart, D.A.; Matyas, J.R.; Frank, C.B.; Krawetz, R.J. Enumeration and Localization of Mesenchymal Progenitor Cells and Macrophages in Synovium from Normal Individuals and Patients with Pre-Osteoarthritis or Clinically Diagnosed Osteoarthritis. Int. J. Mol. Sci. 2017, 18, 774. [Google Scholar] [CrossRef]
- Fahy, N.; de Vries-van Melle, M.; Lehmann, J.; Wei, W.; Grotenhuis, N.; Farrell, E.; van der Kraan, P.M.; Murphy, J.M.; Bastiaansen-Jenniskens, Y.M.; van Osch, G.J. Human osteoarthritic synovium impacts chondrogenic differentiation of mesenchymal stem cells via macrophage polarisation state. Osteoarthr. Cartil. 2014, 22, 1167–1175. [Google Scholar] [CrossRef]
- Dai, M.; Sui, B.; Xue, Y.; Liu, X.; Sun, J. Cartilage repair in degenerative osteoarthritis mediated by squid type II collagen via immunomodulating activation of M2 macrophages, inhibiting apoptosis and hypertrophy of chondrocytes. Biomaterials 2018, 180, 91–103. [Google Scholar] [CrossRef]
- Santoro, A.; Conde, J.; Scotece, M.; Abella, V.; Lois, A.; Lopez, V.; Pino, J.; Gomez, R.; Gomez-Reino, J.J.; Gualillo, O. SERPINE2 Inhibits IL-1α-Induced MMP-13 Expression in Human Chondrocytes: Involvement of ERK/NF-κB/AP-1 Pathways. PLoS ONE 2015, 10, e0135979. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
GAPDH | TGTGTCCGTCGTGGATCTG | TTGCTGTTGAAGTCGCAGGA |
IL-1β | AGTGTGGATCCCAAGCAATACCCA | TGTCCTGACCACTGTTGTTTCCCA |
IL-6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
TNF-α | CATCTTCTCAAAATTCGAGTGACAA | TGGGAGTAGACAAGGTACAACCC |
iNOS | CAGAAGTGCAAAGTCTCAGACAT | GTCATCTTGTATTGTTGGGCT |
CD86 | CTGCTCATCATTGTATGTCAC | ACTGCCTTCACTCTGCATTTG |
CD206 | AGACGAAATCCCTGCTACTG | CACCCATTCGAAGGCATTC |
Arg-1 | CGAGGAGGGGTAGAGAAAG | CATCAACAAAGGCCAGGT |
IL-10 | GAGAAGCATGGCCCAGAAATC | GAGAAATCGATGACAGCGCC |
Col-2 | GGACGTTAGCGGTGTTGGGAG | ACTGGTGGAGCAGCAAGAGCA |
Aggrecan | CAGAACCTTCGCTCCAATGAC | CCTCAATGCCATGCATCACTT |
Sox-9 | CAGCCCCTTCAACCTTCCTC | TGATGGTCAGCGTAGTCGTATT |
MMP-3 | ATGATGAACGATGGACAGATGA | CATTGGCTGAGTGAAAGAGACC |
MMP-9 | CACCGGCTAAACCACCTC | CGCCCGACACACAGTAAG |
MMP-13 | GGGGAGCCACAGATGAG | AACGCTCGCAGTGAAAAG |
Admats-5 | TATGACAAGTGCGGAGTATG | TTCAGGGCTAAATAGGCAGT |
BAX | TGGTTGCCCTCTTCTACTTTG | GTCACTGTCTGCCATGTGGG |
Caspase-3 | CTGACTGGAAAGCCGAAACTC | CGACCCGTCCTTTGAATTTCT |
Antibody | Application and Dilution | Manufacturer |
---|---|---|
Anti-rabbit IgG | 1:3000 for WB | Cell Signaling Technology, USA |
Anti-mouse IgG | 1:3000 for WB | Cell Signaling Technology, USA |
Rabbit anti-β-actin | 1:3000 for WB | Cell Signaling Technology, USA |
Rabbit anti-CD86 | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-CD206 | 1:1000 for WB; 1:500 for IF | Abcam, UK |
Rabbit anti-iNOS | 1:500 for IF | Cell Signaling Technology, USA |
Rabbit anti-NF-κB | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-IKB-α | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-pNF-κB | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-pIKB-α | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-P38 | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-Erk | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-JNK | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-pP38 | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-pErk | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-pJNK | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-Col-2 | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-Sox-9 | 1:1000 for WB | Abcam, UK |
Mouse anti-Aggrecan | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-MMP-2 | 1:1000 for WB | Abcam, UK |
Rabbit anti-MMP-3 | 1:1000 for WB | Abcam, UK |
Rabbit anti-MMP-9 | 1:1000 for WB | Abcam, UK |
Rabbit anti-Clv-Caspase-3 | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-Bcl-2 | 1:1000 for WB | Cell Signaling Technology, USA |
Rabbit anti-Bax | 1:1000 for WB | Cell Signaling Technology, USA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, A.; Pathak, J.L.; Li, X.; Cao, W.; Zhong, W.; Zhu, M.; Wu, Q.; Chen, W.; Han, Q.; Jiang, S.; et al. Human Salivary Histatin-1 Attenuates Osteoarthritis through Promoting M1/M2 Macrophage Transition. Pharmaceutics 2023, 15, 1272. https://doi.org/10.3390/pharmaceutics15041272
Wu A, Pathak JL, Li X, Cao W, Zhong W, Zhu M, Wu Q, Chen W, Han Q, Jiang S, et al. Human Salivary Histatin-1 Attenuates Osteoarthritis through Promoting M1/M2 Macrophage Transition. Pharmaceutics. 2023; 15(4):1272. https://doi.org/10.3390/pharmaceutics15041272
Chicago/Turabian StyleWu, Antong, Janak Lal. Pathak, Xingyang Li, Wei Cao, Wenchao Zhong, Mingjing Zhu, Qiuyu Wu, Wanyi Chen, Qiao Han, Siqing Jiang, and et al. 2023. "Human Salivary Histatin-1 Attenuates Osteoarthritis through Promoting M1/M2 Macrophage Transition" Pharmaceutics 15, no. 4: 1272. https://doi.org/10.3390/pharmaceutics15041272