Sturgeon (Acipenser)-Derived Chondroitin Sulfate Suppresses Human Colon Cancer HCT-116 Both In Vitro and In Vivo by Inhibiting Proliferation and Inducing Apoptosis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Material and Reagents
2.2. Cell Culture
2.3. Cell Viability Assay
2.4. Cell Cycle Analysis
2.5. Cell Apoptosis Analysis
2.6. Animal Experiment
2.7. Immunohistochemical (IHC) Analysis
2.8. TUNEL Staining Analysis
2.9. Total RNA Extraction and Quantitative Real-Time PCR (qPCR) Analysis
2.10. Statistical Analysis
3. Results
3.1. Sturgeon-Derived Chondroitin Sulfate (SCS) Inhibits the Proliferation of HCT-116
3.2. Sturgeon-Derived Chondroitin Sulfate (SCS) Induces Cell Cycle Arrest of HCT-116
3.3. Sturgeon-Derived Chondroitin Sulfate (SCS) Induces the Apoptosis of HCT-116
3.4. Sturgeon-Derived Chondroitin Sulfate (SCS) Suppresses the Growth of HCT-116 Tumor Xenograft In Vivo
3.5. Sturgeon-Derived Chondroitin Sulfate (SCS) Inhibits the HCT-116 Tumor Growth by a Reduction of Proliferation and an Induction of Apoptosis
3.6. Sturgeon-Derived Chondroitin Sulfate (SCS) Induces the HCT-116 Tumor Apoptosis via the Mitochondrial Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Lin, J.S.; Piper, M.A.; Perdue, L.A.; Rutter, C.; Webber, E.M.; O’Connor, E.; Smith, N.; Whitlock, E.P. Screening for Colorectal Cancer: A Systematic Review for the U.S. Preventive Services Task Force; Evidence Syntheses; Agency for Healthcare Research and Quality (US): Rockville, MD, USA, 2016.
- Martini, G.; Troiani, T.; Cardone, C.; Vitiello, P.; Sforza, V.; Ciardiello, D.; Napolitano, S.; Maria, C.; Corte, D.; Morgillo, F.; et al. Present and future of metastatic colorectal cancer treatment: A review of new candidate targets. World J. Gastroenterol. 2017, 23, 4675–4688. [Google Scholar] [CrossRef] [PubMed]
- Van der Jeught, K.; Xu, H.C.; Li, Y.J.; Lu, X.B.; Ji, G. Drug resistance and new therapies in colorectal cancer. World J. Gastroenterol. 2018, 24, 3834–3848. [Google Scholar] [CrossRef] [PubMed]
- Arnold, M.; Sierra, M.S.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global patterns and trends in colorectal cancer incidence and mortality. Gut 2017, 66, 683–691. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giovannucci, E.; Willett, W.C. Dietary factors and risk of colon cancer. Ann. Med. 1994, 26, 443–452. [Google Scholar] [CrossRef]
- Center, M.M.; Jemal, A.; Smith, R.A. Worldwide variations in colorectal cancer. CA Cancer J. Clin. 2009, 59, 366–378. [Google Scholar] [CrossRef] [Green Version]
- Murphy, C.C.; Harlan, L.C.; Lund, J.L. Patterns of colorectal cancer care in the United States: 1990–2010. J. Natl. Cancer Inst. 2015, 107, djv198. [Google Scholar] [CrossRef] [Green Version]
- Gerber, M. Background Review Paper on Total Fat, Fatty Acid Intake and Cancers. Ann. Nutr. Metab. 2009, 55, 140–161. [Google Scholar] [CrossRef]
- Khwaldia, K. Chondroitin and Glucosamine. In Nonvitamin and Nonmineral Nutritional Supplements; Academic Press: Cambridge, MA, USA, 2019; pp. 27–35. [Google Scholar]
- Volpi, N. Chondroitin Sulfate as a Bioactive Macromolecule for Advanced Biological Applications and Therapies. In Biomaterials from Nature for Advanced Devices and Therapies; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2016; pp. 79–92. [Google Scholar]
- Liu, F.; Zhang, N.; Li, Z.; Wang, X.; Shi, H.; Xue, C.; Li, R.W.; Tang, Q. Chondroitin sulfate disaccharides modified the structure and function of the murine gut microbiome under healthy and stressed conditions. Sci. Rep. 2017, 7, 6783. [Google Scholar] [CrossRef]
- Cooney, C.A.; Jousheghany, F.; Yao-Borengasser, A.; Phanavanh, B.; Gomes, T.; Kieber-Emmons, A.M.; Siegel, E.R.; Suva, L.J.; Ferrone, S.; Kieber-Emmons, T.; et al. Chondroitin sulfates play a major role in breast cancer metastasis: A role for CSPG4 and CHST11gene expression in forming surface P-selectin ligands in aggressive breast cancer cells. Breast Cancer Res. 2011, 13, R58. [Google Scholar] [CrossRef] [Green Version]
- Nadanaka, S.; Kinouchi, H.; Kitagawa, H. Chondroitin sulfate-mediated N-cadherin/β-catenin signaling is associated with basal-like breast cancer cell invasion. J. Biol. Chem. 2018, 293, 444–465. [Google Scholar] [CrossRef] [Green Version]
- Yang, H.; Liu, S.; Cai, H.; Wan, L.; Li, S.; Li, Y.; Cheng, J.; Lu, X. Chondroitin Sulfate as a Molecular Portal That Preferentially Mediates the Apoptotic Killing of Tumor Cells by Penetratin-directed Mitochondria-disrupting Peptides. J. Biol. Chem. 2010, 285, 25666–25676. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Iovu, M.; Dumais, G.; du Souich, P. Anti-inflammatory activity of chondroitin sulfate. Osteoarthr. Cartil. 2008, 16, S14–S18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vallières, M.; du Souich, P. Modulation of inflammation by chondroitin sulfate. Osteoarthr. Cartil. 2010, 18, S1–S6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ferlay, J.; Soerjomataram, I.; Dikshit, R.; Eser, S.; Mathers, C.; Rebelo, M.; Parkin, D.M.; Forman, D.; Bray, F. Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int. J. Cancer 2015, 136, E359–E386. [Google Scholar] [CrossRef]
- Torre, L.A.; Siegel, R.L.; Ward, E.M.; Jemal, A. Global Cancer Incidence and Mortality Rates and Trends—An Update. Cancer Epidemiol. Biomark. Prev. 2016, 25, 16–27. [Google Scholar] [CrossRef] [Green Version]
- Nguyen, H.; Duong, H. The molecular characteristics of colorectal cancer: Implications for diagnosis and therapy (Review). Oncol. Lett. 2018, 16, 9–18. [Google Scholar] [CrossRef] [Green Version]
- Kim, C.; Kim, B. Anti-Cancer Natural Products and Their Bioactive Compounds Inducing ER Stress-Mediated Apoptosis: A Review. Nutrients 2018, 10, 1021. [Google Scholar] [CrossRef] [Green Version]
- Demain, A.L.; Vaishnav, P. Natural products for cancer chemotherapy. Microb. Biotechnol. 2011, 4, 687–699. [Google Scholar] [CrossRef] [Green Version]
- Chevalier, X.; Conrozier, T. Access to Highly Purified Chondroitin Sulfate for Appropriate Treatment of Osteoarthritis: A Review. Med. Access Point Care 2017, 1, e134–e135. [Google Scholar] [CrossRef] [Green Version]
- Arumugam, P.; Arunkumar, K.; Sivakumar, L.; Murugan, M.; Murugan, K. Anticancer effect of fucoidan on cell proliferation, cell cycle progression, genetic damage and apoptotic cell death in HepG2 cancer cells. Toxicol. Rep. 2019, 6, 556–563. [Google Scholar]
- Tian, X.; Li, Y.; Shen, Y.; Li, Q.; Wang, Q.; Feng, L. Apoptosis and inhibition of proliferation of cancer cells induced by cordycepin (Review). Oncol. Lett. 2015, 10, 595–599. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Subramaniam, S.; Selvaduray, K.R.; Radhakrishnan, A.K. Bioactive compounds: Natural defense against cancer? Biomolecules 2019, 9, 758. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rao, S.; Chinkwo, K.; Santhakumar, A.; Blanchard, C. Inhibitory Effects of Pulse Bioactive Compounds on Cancer Development Pathways. Diseases 2018, 6, 72. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, J.N.; Panchanathan, R.; Lee, W.S.; Kim, H.J.; Kim, D.H.; Choi, Y.H.; Kim, G.S.; Shin, S.C.; Hong, S.C. Anthocyanins from the fruit of vitis coignetiae pulliat inhibit TNF-Augmented cancer proliferation, migration, and invasion in A549 cells. Asian Pac. J. Cancer Prev. 2017, 18, 2919–2923. [Google Scholar]
- Parasramka, M.A.; Gupta, S.V. Synergistic effect of garcinol and curcumin on antiproliferative and apoptotic activity in pancreatic cancer cells. J. Oncol. 2012, 2012, 709739. [Google Scholar] [CrossRef] [Green Version]
- Patil, J.R.; Jayaprakasha, G.K.; Murthy, K.N.C.; Chetti, M.B.; Patil, B.S. Characterization of Citrus aurantifolia bioactive compounds and their inhibition of human pancreatic cancer cells through apoptosis. Microchem. J. 2010, 94, 108–117. [Google Scholar] [CrossRef]
- Castro-Puyana, M.; Pérez-Sánchez, A.; Valdés, A.; Ibrahim, O.H.M.; Suarez-Álvarez, S.; Ferragut, J.A.; Micol, V.; Cifuentes, A.; Ibáñez, E.; García-Cañas, V. Pressurized liquid extraction of Neochloris oleoabundans for the recovery of bioactive carotenoids with anti-proliferative activity against human colon cancer cells. Food Res. Int. 2017, 99, 1048–1055. [Google Scholar] [CrossRef] [Green Version]
- Qi, W.; Weber, C.R.; Wasland, K.; Savkovic, S.D. Genistein inhibits proliferation of colon cancer cells by attenuating a negative effect of epidermal growth factor on tumor suppressor FOXO3 activity. BMC Cancer 2011, 11, 219. [Google Scholar] [CrossRef] [Green Version]
- He, Z.; Li, B.; Rankin, G.O.; Rojanasakul, Y.; Chen, Y.C. phenolic compound, ovarian cancer, cell viability, vascular endothelial growth factor, hypoxia-inducible factor-1α. Oncol. Lett. 2015, 9, 1444–1450. [Google Scholar] [CrossRef]
- Zhang, H.W.; Hu, J.J.; Fu, R.Q.; Liu, X.; Zhang, Y.H.; Li, J.; Liu, L.; Li, Y.N.; Deng, Q.; Luo, Q.S.; et al. Flavonoids inhibit cell proliferation and induce apoptosis and autophagy through downregulation of PI3Kγ mediated PI3K/AKT/mTOR/p70S6K/ULK signaling pathway in human breast cancer cells. Sci. Rep. 2018, 8, 1–13. [Google Scholar] [CrossRef]
- Sun, F.; Zheng, X.Y.; Ye, J.; Wu, T.T.; Wang, J.L.; Chen, W. Potential anticancer activity of myricetin in human T24 bladder cancer cells both in vitro and in vivo. Nutr. Cancer 2012, 64, 599–606. [Google Scholar] [CrossRef]
- Yi, J.L.; Shi, S.; Shen, Y.L.; Wang, L.; Chen, H.Y.; Zhu, J.; Ding, Y. Myricetin and methyl eugenol combination enhances the anticancer activity, cell cycle arrest and apoptosis induction of cis-platin against HeLa cervical cancer cell lines. Int. J. Clin. Exp. Pathol. 2015, 8, 1116–1127. [Google Scholar] [PubMed]
- O’Brien, M.A.; Kirby, R. Apoptosis: A review of pro-apoptotic and anti-apoptotic pathways and dysregulation in disease. J. Vet. Emerg. Crit. Care 2008, 18, 572–585. [Google Scholar] [CrossRef]
- Bosari, S.; Moneghini, L.; Graziani, D.; Lee, A.K.C.; Murray, J.J.; Coggi, G.; Viale, G. bcl-2 oncoprotein in colorectal hyperplastic polyps, adenomas, and adenocarcinomas. Hum. Pathol. 1995, 26, 534–540. [Google Scholar] [CrossRef]
- Flohil, C.C.; Janssen, P.A.; Bosman, F.T. Eexpression of bcl-2 protein in hyperplastic polyps, adenomas, and carcinomas of the colon. J. Pathol. 1996, 178, 393–397. [Google Scholar] [CrossRef]
- Reed, J.C. Bcl-2 family proteins: Regulators of apoptosis and chemoresistance in hematologic malignancies. Semin. Hematol. 1997, 34, 9–19. [Google Scholar]
- Gross, A.; McDonnell, J.M.; Korsmeyer, S.J. Bcl-2 family members and the mitochondria in apoptosis. Genes Dev. 1999, 13, 1899–1911. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.L.; Pang, L.Q.; Wu, Y.; Wang, X.Y.; Wang, C.Q.; Fan, Y. Significance of Bcl-xL in human colon carcinoma. World J. Gastroenterol. 2008, 14, 3069–3073. [Google Scholar] [CrossRef]
- Ogura, E.; Senzaki, H.; Yamamoto, D.; Yoshida, R.; Takada, H.; Hioki, K.; Tsubura, A. Prognostic significance of Bcl-2, Bcl-xL/S, Bax and Bak expressions in colorectal carcinomas. Oncol. Rep. 1999, 6, 365–369. [Google Scholar] [CrossRef]
- Ibáñez-Sanz, G.; Díez-Villanueva, A.; Vilorio-Marqués, L.; Gracia, E.; Aragonés, N.; Olmedo-Requena, R.; Llorca, J.; Vidán, J.; Amiano, P.; Nos, P.; et al. Possible role of chondroitin sulphate and glucosamine for primary prevention of colorectal cancer. Results from the MCC-Spain study. Sci. Rep. 2018, 8, 2040. [Google Scholar]
- Pudełko, A.; Wisowski, G.; Olczyk, K.; Koźma, E.M. The dual role of the glycosaminoglycan chondroitin-6-sulfate in the development, progression and metastasis of cancer. FEBS J. 2019, 286, 1815–1837. [Google Scholar] [CrossRef] [PubMed]
- Zhao, T.; Zhou, Y.; Mao, G.; Zou, Y.; Bai, S.; Yang, L.; Wu, X. Extraction, purification and characterization of chondroitin sulfate in chinese sturgeon cartilage. J. Sci. Food Agric. 2013, 93, 1633–1640. [Google Scholar] [CrossRef] [PubMed]
- Garnjanagoonchorn, W.; Wongekalak, L.; Engkagul, A. Determination of chondroitin sulfate form different sources of cartilage. Chem. Eng. Process. Process Intensif. 2007, 46, 465–471. [Google Scholar] [CrossRef]
- Dostrovsky, N.R.; Towheed, T.E.; Hudson, R.W.; Anastassiades, T.P. The effect of glucosamine on glucose metabolism in humans: A systematic review of the literature. Osteoarthr. Cartil. 2011, 19, 375–380. [Google Scholar] [CrossRef] [Green Version]
Gens | Primer Sequences (5′→3′) |
---|---|
β-action | F:CGACCACTTTGTCAAGCTCA |
R:AGGGGTCTACATGGCAACTG | |
Bcl-xl | F:ATGGCAGCAGTAAAGCAAGCGC |
R:TTCTCCTGGTGGCAATGGCG | |
Bcl-2 | F:AGATGTCCAGCCAGCTGCACCTGAC |
R:AGATAGGCACCCAGGGTGATGCAAGCT | |
Bad | F:CCTTTAAGAAGGGACTTCCTCGCC |
R:ACTTCCGATGGGACCAAGCCTTCC | |
Bax | F:TCCACCAAGAAGCTGAGCGA |
R:GTCCAGCCCATGATGGTTCT | |
Caspase-3 | F:TTTGTTTGTGTGCTTCTGAGCC |
R:ATTCTGTTGCCACCTTTCGG | |
Cytochrome C | F:CCAGGACTGTATGTGGAGCG |
R:CTTGAGGACCAGTGGGCTGT | |
p53 | F:TGGCCCCTCCTCAGCATCTTAT |
R:GTTGGGCAGTGCTCGCTTAGTG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wu, R.; Shang, N.; Gui, M.; Yin, J.; Li, P. Sturgeon (Acipenser)-Derived Chondroitin Sulfate Suppresses Human Colon Cancer HCT-116 Both In Vitro and In Vivo by Inhibiting Proliferation and Inducing Apoptosis. Nutrients 2020, 12, 1130. https://doi.org/10.3390/nu12041130
Wu R, Shang N, Gui M, Yin J, Li P. Sturgeon (Acipenser)-Derived Chondroitin Sulfate Suppresses Human Colon Cancer HCT-116 Both In Vitro and In Vivo by Inhibiting Proliferation and Inducing Apoptosis. Nutrients. 2020; 12(4):1130. https://doi.org/10.3390/nu12041130
Chicago/Turabian StyleWu, Ruiyun, Nan Shang, Meng Gui, Jian Yin, and Pinglan Li. 2020. "Sturgeon (Acipenser)-Derived Chondroitin Sulfate Suppresses Human Colon Cancer HCT-116 Both In Vitro and In Vivo by Inhibiting Proliferation and Inducing Apoptosis" Nutrients 12, no. 4: 1130. https://doi.org/10.3390/nu12041130