The Deubiquitinase USP4 Stabilizes Twist1 Protein to Promote Lung Cancer Cell Stemness
Abstract
:1. Introduction
2. Results
2.1. USP4 Promotes Lung Cancer Cell Stemness
2.2. USP4 Promotes Lung Cancer Stemness Via Upregulation of Twist1 Protein Expression
2.3. USP4 Is a Deubiquitinase of Twist1 Protein
2.4. Clinical Validation of Correlation between USP4 and Twist1 Expression and Its Association with Overall Survival in Lung Cancer
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Plasmids and Lentiviral Infection
- For Flag-USP4, Forward: 5′ GAGGATCTATTTCCGGTGAAGAGGAG
- ATCTGCCGCCGCGA 3′; Reverse: 5′ TCTAGAACTAGTCTCGAGGTTA
- AACCTTATCGTCGTCAT 3′. For Flag-USP4C311A, Forward: 5′ ACCGCCT
- TCATGAACTCCGCTTTGC 3′; Reverse: 5′ GTTTCCCAGGTTTCCAAGTC
- CACAG 3′
- For anti-USP4, # 1: CCCAACTGTAAGAAGCATCAA; # 2 GCCCAGAAT
- GTGCTAAGGTTT. For anti-Twist1: GCTGAGCAAGATTCAGACC
4.3. Plasmid Transfection, Lentiviral Infection and RNA Interference
4.4. Western Blot, Immunoprecipitation and Immunohistochemistry (IHC) Analyses
4.5. Tumorspheres Formation Assay
4.6. Quantitative PCR
4.7. Flow Cytometry Assay
4.8. Clinical Relevance Analysis
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J. Clin. 2019, 69, 7–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Melosky, B. Current treatment algorithms for patients with metastatic non-small cell, non-squamous lung cancer. Front. Oncol. 2017, 7, 38. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nikolaou, M.; Pavlopoulou, A.; Georgakilas, A.G.; Kyrodimos, E. The challenge of drug resistance in cancer treatment: A current overview. Clin. Exp. Metastasis 2018, 35, 309–318. [Google Scholar] [CrossRef] [PubMed]
- Eramo, A.; Lotti, F.; Sette, G.; Pilozzi, E.; Biffoni, M.; di Virgilio, A.; Conticello, C.; Ruco, L.; Peschle, C.; de Maria, R. Identification and expansion of the tumorigenic lung cancer stem cell population. Cell Death Differ. 2008, 15, 504–514. [Google Scholar] [CrossRef] [PubMed]
- Sullivan, J.P.; Minna, J.D.; Shay, J.W. Evidence for self-renewing lung cancer stem cells and their implications in tumor initiation, progression, and targeted therapy. Cancer Metastasis Rev. 2010, 29, 61–72. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chiou, S.H.; Wang, M.L.; Chou, Y.T.; Chen, C.J.; Hong, C.F.; Hsieh, W.J.; Chang, H.T.; Chen, Y.S.; Lin, T.W.; Hsu, H.S.; et al. Coexpression of Oct4 and Nanog enhances malignancy in lung adenocarcinoma by inducing cancer stem cell-like properties and epithelial-mesenchymal transdifferentiation. Cancer Res. 2010, 70, 10433–10444. [Google Scholar] [CrossRef] [Green Version]
- Singh, A.; Settleman, J. EMT, cancer stem cells and drug resistance: An emerging axis of evil in the war on cancer. Oncogene 2010, 29, 4741–4751. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.C.; Hsu, H.S.; Chen, Y.W.; Tsai, T.H.; How, C.K.; Wang, C.Y.; Hung, S.C.; Chang, Y.L.; Tsai, M.L.; Lee, Y.Y.; et al. Oct-4 expression maintained cancer stem-like properties in lung cancer-derived CD133-positive cells. PLoS ONE 2008, 3, e2637. [Google Scholar] [CrossRef] [Green Version]
- Nishino, M.; Ozaki, M.; Hegab, A.E.; Hamamoto, J.; Kagawa, S.; Arai, D.; Yasuda, H.; Naoki, K.; Soejima, K.; Saya, H.; et al. Variant CD44 expression is enriching for a cell population with cancer stem cell-like characteristics in human lung adenocarcinoma. J. Cancer 2017, 8, 1774–1785. [Google Scholar] [CrossRef] [Green Version]
- De Aberasturi, A.L.; Redrado, M.; Villalba, M.; Larzabal, L.; Pajares, M.J.; Garcia, J.; Evans, S.R.; Garcia-Ros, D.; Bodegas, M.E.; Lopez, L.; et al. TMPRSS4 induces cancer stem cell-like properties in lung cancer cells and correlates with ALDH expression in NSCLC patients. Cancer Lett. 2016, 370, 165–176. [Google Scholar] [CrossRef]
- Ho, M.M.; Ng, A.V.; Lam, S.; Hung, J.Y. Side population in human lung cancer cell lines and tumors is enriched with stem-like cancer cells. Cancer Res. 2007, 67, 4827–4833. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bora-Singhal, N.; Perumal, D.; Nguyen, J.; Chellappan, S. Gli1-mediated regulation of Sox2 facilitates self-renewal of stem-like cells and confers resistance to EGFR Inhibitors in non-small cell lung cancer. Neoplasia 2015, 17, 538–551. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hu, F.; Li, C.; Zheng, X.; Zhang, H.; Shen, Y.; Zhou, L.; Yang, X.; Han, B.; Zhang, X. Lung adenocarcinoma resistance to therapy with EGFRtyrosine kinase inhibitors is related to increased expression of cancer stem cell markers SOX2, OCT4 and Nanog. Oncol. Rep. 2020, 43, 727–735. [Google Scholar] [CrossRef]
- Liu, K.; Xu, S.H.; Chen, Z.; Zeng, Q.X.; Li, Z.J.; Chen, Z.M. TRPM7 overexpression enhances the cancer stem cell-like and metastatic phenotypes of lung cancer through modulation of the Hsp90alpha/uPA/MMP2 signaling pathway. BMC Cancer 2018, 18, 1167. [Google Scholar] [CrossRef]
- Jen, J.; Liu, C.Y.; Chen, Y.T.; Wu, L.T.; Shieh, Y.C.; Lai, W.W.; Wang, Y.C. Oncogenic zinc finger protein ZNF322A promotes stem cell-like properties in lung cancer through transcriptional suppression of c-Myc expression. Cell Death Differ. 2019, 26, 1283–1298. [Google Scholar] [CrossRef]
- Hassan, K.A.; Wang, L.; Korkaya, H.; Chen, G.; Maillard, I.; Beer, D.G.; Kalemkerian, G.P.; Wicha, M.S. Notch pathway activity identifies cells with cancer stem cell-like properties and correlates with worse survival in lung adenocarcinoma. Clin. Cancer Res. 2013, 19, 1972–1980. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giroux-Leprieur, E.; Costantini, A.; Ding, V.W.; He, B. Hedgehog signaling in lung cancer: From oncogenesis to cancer treatment resistance. Int. J. Mol. Sci. 2018, 19, 2835. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, T.; Wu, X.; Chen, T.; Luo, Z.; Hu, X. Downregulation of DNMT3A by miR-708-5p inhibits lung cancer stem cell-like phenotypes through repressing wnt/beta-catenin signaling. Clin. Cancer Res. 2018, 24, 1748–1760. [Google Scholar] [CrossRef] [Green Version]
- Lu, C.-H.; Yeh, D.-W.; Lai, C.-Y.; Liu, Y.-L.; Huang, L.-R.; Lee, A.Y.-L.; Jin, S.L.C.; Chuang, T.-H. USP17 mediates macrophage-promoted inflammation and stemness in lung cancer cells by regulating TRAF2/TRAF3 complex formation. Oncogene 2018, 37, 6327–6340. [Google Scholar] [CrossRef]
- Yang, L.; Shi, P.; Zhao, G.; Xu, J.; Peng, W.; Zhang, J.; Zhang, G.; Wang, X.; Dong, Z.; Chen, F.; et al. Targeting cancer stem cell pathways for cancer therapy. Signal Transduct Target Ther. 2020, 5, 8. [Google Scholar] [CrossRef] [Green Version]
- Ranji, P.; Kesejini, T.S.; Saeedikhoo, S.; Alizadeh, A.M. Targeting cancer stem cell-specific markers and/or associated signaling pathways for overcoming cancer drug resistance. Tumour Biol. 2016, 37, 13059–13075. [Google Scholar] [CrossRef] [PubMed]
- Maia, A.M.; da Silva, J.H.; Mencalha, A.L.; Caffarena, E.R.; Abdelhay, E. Computational modeling of the bHLH domain of the transcription factor TWIST1 and R118C, S144R and K145E mutants. BMC Bioinform. 2012, 13, 184. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, Q.Q.; Ma, C.; Wang, Q.; Song, Y.; Lv, T. The role of TWIST1 in epithelial-mesenchymal transition and cancers. Tumour Biol. 2016, 37, 185–197. [Google Scholar] [CrossRef] [PubMed]
- Hata, T.; Rajabi, H.; Yamamoto, M.; Jin, C.; Ahmad, R.; Zhang, Y.; Kui, L.; Li, W.; Yasumizu, Y.; Hong, D.; et al. Targeting MUC1-C inhibits TWIST1 signaling in triple-negative breast cancer. Mol. Cancer Ther. 2019, 18, 1744–1754. [Google Scholar] [CrossRef] [Green Version]
- Izadpanah, M.H.; Abbaszadegan, M.R.; Fahim, Y.; Forghanifard, M.M. Ectopic expression of TWIST1 upregulates the stemness marker OCT4 in the esophageal squamous cell carcinoma cell line KYSE30. Cell Mol. Biol. Lett. 2017, 22, 33. [Google Scholar] [CrossRef] [Green Version]
- Burns, T.F.; Dobromilskaya, I.; Murphy, S.C.; Gajula, R.P.; Thiyagarajan, S.; Chatley, S.N.; Aziz, K.; Cho, Y.J.; Tran, P.T.; Rudin, C.M. Inhibition of TWIST1 leads to activation of oncogene-induced senescence in oncogene-driven non-small cell lung cancer. Mol. Cancer Res. 2013, 11, 329–338. [Google Scholar] [CrossRef] [Green Version]
- Hung, J.J.; Yang, M.H.; Hsu, H.S.; Hsu, W.H.; Liu, J.S.; Wu, K.J. Prognostic significance of hypoxia-inducible factor-1alpha, TWIST1 and snail expression in resectable non-small cell lung cancer. Thorax 2009, 64, 1082–1089. [Google Scholar] [CrossRef] [Green Version]
- Li, Q.Q.; Xu, J.D.; Wang, W.J.; Cao, X.X.; Chen, Q.; Tang, F.; Chen, Z.Q.; Liu, X.P.; Xu, Z.D. Twist1-mediated adriamycin-induced epithelial-mesenchymal transition relates to multidrug resistance and invasive potential in breast cancer cells. Clin. Cancer Res. 2009, 15, 2657–2665. [Google Scholar] [CrossRef] [Green Version]
- Ai, L.; Kim, W.J.; Alpay, M.; Tang, M.; Pardo, C.E.; Hatakeyama, S.; May, W.S.; Kladde, M.P.; Heldermon, C.D.; Siegel, E.M.; et al. TRIM29 suppresses TWIST1 and invasive breast cancer behavior. Cancer Res. 2014, 74, 4875–4887. [Google Scholar] [CrossRef] [Green Version]
- Shiota, M.; Zardan, A.; Takeuchi, A.; Kumano, M.; Beraldi, E.; Naito, S.; Zoubeidi, A.; Gleave, M.E. Clusterin mediates TGF-beta-induced epithelial-mesenchymal transition and metastasis via Twist1 in prostate cancer cells. Cancer Res. 2012, 72, 5261–5272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cho, K.H.; Jeong, K.J.; Shin, S.C.; Kang, J.; Park, C.G.; Lee, H.Y. STAT3 mediates TGF-beta1-induced TWIST1 expression and prostate cancer invasion. Cancer Lett. 2013, 336, 167–173. [Google Scholar] [CrossRef] [PubMed]
- Sun, T.; Zhao, N.; Zhao, X.L.; Gu, Q.; Zhang, S.W.; Che, N.; Wang, X.H.; Du, J.; Liu, Y.X.; Sun, B.C. Expression and functional significance of Twist1 in hepatocellular carcinoma: Its role in vasculogenic mimicry. Hepatology 2010, 51, 545–556. [Google Scholar] [CrossRef]
- Wushou, A.; Hou, J.; Zhao, Y.J.; Shao, Z.M. Twist-1 up-regulation in carcinoma correlates to poor survival. Int. J. Mol. Sci. 2014, 15, 21621–21630. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Giuseppe, P.; Virginia, T.; Rosa, C.; Renato, F.; Aantonello, L.R.; Eleonora, L.; Nicola, M.; Francesca, P.; Nicola, N.; Gaetano, R. Epithelial to mesenchymal transition by TGFβ-1 induction increases stemness characteristics in primary non small cell lung cancer cell line. PloS ONE 2011, 6, e21548. [Google Scholar]
- Yang-Hartwich, Y.; Tedja, R.; Roberts, C.M.; Goodner-Bingham, J.; Cardenas, C.; Gurea, M.; Sumi, N.J.; Alvero, A.B.; Glackin, C.A.; Mor, G. p53-Pirh2 Complex Promotes Twist1 Degradation and Inhibits EMT. Mol. Cancer Res. 2019, 17, 153–164. [Google Scholar] [CrossRef] [Green Version]
- Xu, M.; Zhu, C.; Zhao, X.; Chen, C.; Zhang, H.; Yuan, H.; Deng, R.; Dou, J.; Wang, Y.; Huang, J.; et al. Atypical ubiquitin E3 ligase complex Skp1-Pam-Fbxo45 controls the core epithelial-to-mesenchymal transition-inducing transcription factors. Oncotarget 2015, 6, 979–994. [Google Scholar] [CrossRef]
- Lander, R.; Nordin, K.; LaBonne, C. The F-box protein Ppa is a common regulator of core EMT factors Twist, Snail, Slug, and Sip1. J. Cell Biol. 2011, 194, 17–25. [Google Scholar] [CrossRef] [Green Version]
- Yu, C.Y.; Liu, B.H.; Tang, S.Y.; Liang, R.Y.; Hsu, K.H.; Chuang, S.M. HR23A-knockdown lung cancer cells exhibit epithelial-to-mesenchymal transition and gain stemness properties through increased Twist1 stability. Biochim. Biophys. Acta Mol. Cell Res. 2019, 1866, 118537. [Google Scholar] [CrossRef]
- Dikic, I. Proteasomal and autophagic degradation systems. Annu. Rev. Biochem. 2017, 86, 193–224. [Google Scholar] [CrossRef]
- McClurg, U.L.; Robson, C.N. Deubiquitinating enzymes as oncotargets. Oncotarget 2015, 6, 9657–9668. [Google Scholar] [CrossRef] [Green Version]
- Wada, K.; Kamitani, T. UnpEL/Usp4 is ubiquitinated by Ro52 and deubiquitinated by itself. Biochem. Biophys. Res. Commun. 2006, 342, 253–258. [Google Scholar] [CrossRef] [PubMed]
- Gray, D.A.; Inazawa, J.; Gupta, K.; Wong, A.; Ueda, R.; Takahashi, T. Elevated expression of Unph, a proto-oncogene at 3p21.3, in human lung tumors. Oncogene 1995, 10, 2179–2183. [Google Scholar]
- Zhou, Y.; Liang, P.; Ji, W.; Yu, Z.; Chen, H.; Jiang, L. Ubiquitin-specific protease 4 promotes glioblastoma multiforme via activating ERK pathway. Onco Targets Ther. 2019, 12, 1825–1839. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, J.; Guo, J.; North, B.J.; Wang, B.; Cui, C.P.; Li, H.; Tao, K.; Zhang, L.; Wei, W. Functional analysis of deubiquitylating enzymes in tumorigenesis and development. Biochim. Biophys. Acta Rev. Cancer 2019, 1872, 188312. [Google Scholar] [CrossRef] [PubMed]
- Wada, K.; Tanji, K.; Kamitani, T. Oncogenic protein UnpEL/Usp4 deubiquitinates Ro52 by its isopeptidase activity. Biochem. Biophys. Res. Commun. 2006, 339, 731–736. [Google Scholar] [CrossRef] [PubMed]
- Song, E.J.; Werner, S.L.; Neubauer, J.; Stegmeier, F.; Aspden, J.; Rio, D.; Harper, J.W.; Elledge, S.J.; Kirschner, M.W.; Rape, M. The Prp19 complex and the Usp4Sart3 deubiquitinating enzyme control reversible ubiquitination at the spliceosome. Genes. Dev. 2010, 24, 1434–1447. [Google Scholar] [CrossRef] [Green Version]
- Zhang, L.; Zhou, F.; Drabsch, Y.; Gao, R.; Snaar-Jagalska, B.E.; Mickanin, C.; Huang, H.; Sheppard, K.A.; Porter, J.A.; Lu, C.X.; et al. USP4 is regulated by AKT phosphorylation and directly deubiquitylates TGF-beta type I receptor. Nat. Cell Biol. 2012, 14, 717–726. [Google Scholar] [CrossRef]
- Bhattacharjee, A.; Richards, W.G.; Staunton, J.; Li, C.; Monti, S.; Vasa, P.; Ladd, C.; Beheshti, J.; Bueno, R.; Gillette, M.; et al. Classification of human lung carcinomas by mRNA expression profiling reveals distinct adenocarcinoma subclasses. Proc. Natl. Acad. Sci. USA 2001, 98, 13790–13795. [Google Scholar] [CrossRef] [Green Version]
- Das, D.S.; Das, A.; Ray, A.; Song, Y.; Samur, M.K.; Munshi, N.C.; Chauhan, D.; Anderson, K.C. Blockade of deubiquitylating enzyme USP1 inhibits DNA repair and triggers apoptosis in multiple myeloma cells. Clin. Cancer Res. 2017, 23, 4280–4289. [Google Scholar] [CrossRef] [Green Version]
- Jeon, H.M.; Sohn, Y.W.; Oh, S.Y.; Kim, S.H.; Beck, S.; Kim, S.; Kim, H. ID4 imparts chemoresistance and cancer stemness to glioma cells by derepressing miR-9*-mediated suppression of SOX2. Cancer Res. 2011, 71, 3410–3421. [Google Scholar] [CrossRef] [Green Version]
- Shibue, T.; Weinberg, R.A. EMT, CSCs, and drug resistance: The mechanistic link and clinical implications. Nat. Rev. Clin. Oncol. 2017, 14, 611–629. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, X.; Yao, Y.; Ding, H.; Han, C.; Chen, Y.; Zhang, Y.; Wang, C.; Zhang, X.; Zhang, Y.; Zhai, Y.; et al. USP21 deubiquitylates Nanog to regulate protein stability and stem cell pluripotency. Signal Transduct. Target. Ther. 2016, 1, 16024. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, C.H.; Yeh, D.W.; Lai, C.Y.; Liu, Y.L.; Huang, L.R.; Lee, A.Y.; Jin, S.C.; Chuang, T.H. Correction: USP17 mediates macrophage-promoted inflammation and stemness in lung cancer cells by regulating TRAF2/TRAF3 complex formation. Oncogene 2019, 38, 5742–5743. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Du, T.; Li, H.; Fan, Y.; Yuan, L.; Guo, X.; Zhu, Q.; Yao, Y.; Li, X.; Liu, C.; Yu, X.; et al. The deubiquitylase OTUD3 stabilizes GRP78 and promotes lung tumorigenesis. Nat. Commun. 2019, 10, 2914. [Google Scholar] [CrossRef]
- Ouchida, A.T.; Kacal, M.; Zheng, A.; Ambroise, G.; Zhang, B.; Norberg, E.; Vakifahmetoglu-Norberg, H. USP10 regulates the stability of the EMT-transcription factor Slug/SNAI2. Biochem. Biophys. Res. Commun. 2018, 502, 429–434. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; Liu, Y.; Zhu, R.; Ding, F.; Cao, X.; Lin, D.; Liu, Z. OTUB1 promotes esophageal squamous cell carcinoma metastasis through modulating Snail stability. Oncogene 2018, 37, 3356–3368. [Google Scholar] [CrossRef]
- Cai, J.; Li, M.; Wang, X.; Li, L.; Li, Q.; Hou, Z.; Jia, H.; Liu, S. USP37 promotes lung cancer cell migration by stabilizing snail protein via deubiquitination. Front. Genet. 2019, 10, 1324. [Google Scholar] [CrossRef]
- Li, L.; Zhou, H.; Zhu, R.; Liu, Z. USP26 promotes esophageal squamous cell carcinoma metastasis through stabilizing Snail. Cancer Lett. 2019, 448, 52–60. [Google Scholar] [CrossRef]
- Wang, W.; Wang, J.; Yan, H.; Zhang, K.; Liu, Y. Upregulation of USP11 promotes epithelialtomesenchymal transition by deubiquitinating Snail in ovarian cancer. Oncol. Rep. 2019, 41, 1739–1748. [Google Scholar] [CrossRef]
- Lin, Y.; Wang, Y.; Shi, Q.; Yu, Q.; Liu, C.; Feng, J.; Deng, J.; Evers, B.M.; Zhou, B.P.; Wu, Y. Stabilization of the transcription factors slug and twist by the deubiquitinase dub3 is a key requirement for tumor metastasis. Oncotarget 2017, 8, 75127–75140. [Google Scholar] [CrossRef]
- Zhou, Z.; Zhang, P.; Hu, X.; Kim, J.; Yao, F.; Xiao, Z.; Zeng, L.; Chang, L.; Sun, Y.; Ma, L. USP51 promotes deubiquitination and stabilization of ZEB1. Am. J. Cancer Res. 2017, 7, 2020–2031. [Google Scholar]
- Xiao, N.; Li, H.; Luo, J.; Wang, R.; Chen, H.; Chen, J.; Wang, P. Ubiquitin-specific protease 4 (USP4) targets TRAF2 and TRAF6 for deubiquitination and inhibits TNFalpha-induced cancer cell migration. Biochem. J. 2012, 441, 979–986. [Google Scholar] [CrossRef] [PubMed]
- Liang, Y.; Song, X.; Li, Y.; Ma, T.; Su, P.; Guo, R.; Chen, B.; Zhang, H.; Sang, Y.; Liu, Y.; et al. Targeting the circBMPR2/miR-553/USP4 Axis as a potent therapeutic approach for breast cancer. Mol. Ther. Nucleic Acids 2019, 17, 347–361. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, X.; Berger, F.G.; Yang, J.; Lu, X. USP4 inhibits p53 through deubiquitinating and stabilizing ARF-BP1. EMBO J. 2011, 30, 2177–2189. [Google Scholar] [CrossRef]
- Li, Z.; Hao, Q.; Luo, J.; Xiong, J.; Zhang, S.; Wang, T.; Bai, L.; Wang, W.; Chen, M.; Wang, W.; et al. USP4 inhibits p53 and NF-kappaB through deubiquitinating and stabilizing HDAC2. Oncogene 2016, 35, 2902–2912. [Google Scholar] [CrossRef] [Green Version]
- Yun, S.I.; Kim, H.H.; Yoon, J.H.; Park, W.S.; Hahn, M.J.; Kim, H.C.; Chung, C.H.; Kim, K.K. Ubiquitin specific protease 4 positively regulates the WNT/beta-catenin signaling in colorectal cancer. Mol. Oncol. 2015, 9, 1834–1851. [Google Scholar] [CrossRef] [PubMed]
- Bergholz, J.; Zhang, Y.; Wu, J.; Meng, L.; Walsh, E.M.; Rai, A.; Sherman, M.Y.; Xiao, Z.X. DeltaNp63alpha regulates Erk signaling via MKP3 to inhibit cancer metastasis. Oncogene 2014, 33, 212–224. [Google Scholar] [CrossRef] [Green Version]
- Yi, Y.; Chen, D.; Ao, J.; Sun, S.; Wu, M.; Li, X.; Bergholz, J.; Zhang, Y.; Xiao, Z.X. Metformin promotes AMP-activated protein kinase-independent suppression of DeltaNp63alpha protein expression and inhibits cancer cell viability. J. Biol. Chem. 2017, 292, 5253–5261. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Li, Y.; Peng, Y.; Zheng, X.; Fan, S.; Yi, Y.; Zeng, P.; Chen, H.; Kang, H.; Zhang, Y.; et al. DeltaNp63alpha down-regulates c-Myc modulator MM1 via E3 ligase HERC3 in the regulation of cell senescence. Cell Death Differ. 2018, 25, 2118–2129. [Google Scholar] [CrossRef] [Green Version]
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, F.; Hu, Q.; He, T.; Xu, J.; Yi, Y.; Xie, S.; Ding, L.; Fu, M.; Guo, R.; Xiao, Z.-X.J.; et al. The Deubiquitinase USP4 Stabilizes Twist1 Protein to Promote Lung Cancer Cell Stemness. Cancers 2020, 12, 1582. https://doi.org/10.3390/cancers12061582
Li F, Hu Q, He T, Xu J, Yi Y, Xie S, Ding L, Fu M, Guo R, Xiao Z-XJ, et al. The Deubiquitinase USP4 Stabilizes Twist1 Protein to Promote Lung Cancer Cell Stemness. Cancers. 2020; 12(6):1582. https://doi.org/10.3390/cancers12061582
Chicago/Turabian StyleLi, Fengtian, Qingyong Hu, Tao He, Jing Xu, Yong Yi, Siyi Xie, Liangping Ding, Mengyuan Fu, Rongtian Guo, Zhi-Xiong Jim Xiao, and et al. 2020. "The Deubiquitinase USP4 Stabilizes Twist1 Protein to Promote Lung Cancer Cell Stemness" Cancers 12, no. 6: 1582. https://doi.org/10.3390/cancers12061582