Next Article in Journal
Future Scenarios for Olive Tree and Grapevine Potential Yields in the World Heritage Côa Region, Portugal
Next Article in Special Issue
Morphophysiological Responses of Two Cool-Season Turfgrasses with Different Shade Tolerances
Previous Article in Journal
A Simple, Semi-Automated, Gravimetric Method to Simulate Drought Stress on Plants
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 12
Issue 2
10.3390/agronomy12020348
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

An Optimized Tobacco Hairy Root Induction System for Functional Analysis of Nicotine Biosynthesis-Related Genes

by
Shangqian Qin
1,
Yanrong Liu
1,
Jianping Yan
1,
Shiwen Lin
1,
Wanjun Zhang
1,* and
Bingwu Wang
2,*
1
College of Grassland Science and Technology, China Agricultural University, Beijing 100193, China
2
Tobacco Breeding Center, Yunnan Academy of Tobacco Agricultural Sciences, Kunming 650021, China
*
Authors to whom correspondence should be addressed.
Agronomy 2022, 12(2), 348; https://doi.org/10.3390/agronomy12020348
Submission received: 13 December 2021 / Revised: 17 January 2022 / Accepted: 28 January 2022 / Published: 29 January 2022
(This article belongs to the Special Issue Advances in Genetics, Breeding, and Quality Traits in Forage and Turf Grass)
Browse Figures
Versions Notes

Abstract

:
Rhizobium rhizogenes-mediated plant hairy root induction is a convenient method for functional study of root-specific genes. To develop an optimized tobacco hairy root induction system and study gene function in nicotine biosynthesis, we investigated hairy root induction by three R. rhizogenes strains, R1601, K599, and LBA9402, on different media with leaf discs from plants of different ages, and we observed that the strain LBA9402 used for explant infection exhibited the highest hairy root induction rate with 4 and 8 week old leaf discs of the tobacco ‘Coker176’ on 2/3MS medium, and it could also be used as a cargo delivering foreign genes to hairy roots. Overexpression of MsSPL12 gene, an alfalfa (Medicago sativa) SQUAMOSA promoter binding protein-like (SPL) transcription factor, significantly improved nicotine production in transgenic hairy roots, reaching 1.38–1.85 mg/g compared to 0.5 mg/g of the controls. Expression analysis of the nicotine biosynthesis and transport-related genes responding to methyl-jasmonate (MeJA) treatment revealed a significant upregulation of NtMPO2 responsible for increased nicotine biosynthesis in MsSPL12 transgenic hairy roots. Our results establish a high-throughput approach for gene functional characterization in the hairy roots of a tobacco elite cultivar, ‘Coker176’, as well as suggest a system for efficiently manipulating tobacco nicotine biosynthesis.

1. Introduction

Rhizobium rhizogenes, previously referred to as Agrobaterium rhizogenes, is a soil-borne Gram-negative microbe that can infect dicots and induce hairy roots at the infected site [1]. The hairy roots produce secondary metabolites, which can be synthesized in intact plants [2,3]. R. rhizogenes-mediated plant transformation has been widely used in the production of secondary metabolites and is also increasingly applied to studying plant secondary metabolism and/or gene expression regulation pathways due to the simple transformation procedure and the rapid growth of the hairy root [4,5].
Hairy root induced by R. rhizogenes infection has also been used in tobacco for functional gene investigation [3]. Co-expression of basic helix–loop–helix protein (bHLH) and transcriptional activator Myb genes reportedly induced anthocyanin production in tobacco hairy roots [6]. Tobacco hairy roots expressing stilbene synthase from Vitis vinifera and a transcription factor AtMYB12 from Arabidopsis exhibited enhanced biosynthesis of stilbenes [7]. Tobacco hairy roots could also be used as a convenient system for studying the function of genes in circadian rhythm [8]. Similarly, a tobacco hairy root culture system was established to investigate the function of genes related to aluminum [9] or cadmium tolerance [10]. Considering the culturing time needed, induction of hairy root by R. rhizogenes has many advantages over traditional transgenic technology in the study of gene function and regulation of secondary metabolism [9].
Similar to Agrobacterium-mediated plant transformation, the efficiency of hairy root induction by R. rhizogenes is affected by many factors [11,12], including plant species, developmental stages of explant, R. rhizogenes strains, medium composition, and culture environment among others [13,14]. For example, when using R. rhizogenes strain MTCC 532 to infect Aegle marmelos, Boerhavia diffusa, Datura innoxia, and Solanum xanthocarpum, the hairy root induction efficiency (HRIE) of Solanum xanthocarpum was 75%, whereas that of Boerhavia diffusa was only 60% [15]. When using different strains to infect the same plant, variation in HRIE was also noticed [13]. In addition, the R. rhizogenes strains and culture media also have a synergistic effect on hairy root induction [16] as observed in soybean; the hairy root induction efficiency was significantly affected by the cocultivation medium [17]. Hence, the establishment of a highly efficient system for hairy root induction necessitates an optimized composition of the culture medium [5,18].
Nicotine is the most important secondary metabolite of tobacco. mainly synthesized in the root and transported by xylem sap to the above-ground part of the plant where it is mostly stored in the vacuoles of the leaf cells [19,20]. Jasmonic acid (JA) and MeJA play important regulatory roles in nicotine biosynthesis of tobacco as previously demonstrated in our investigation of genes involved in nicotine biosynthesis and JA-induced nicotine accumulation in tobacco [21]. Exogenous application of JA or MeJA can stimulate the rapid expression of nicotine biosynthesis-related genes such as NtPMT and NtQPT in intact plants, cultured cells, and roots [22,23,24,25]. Genes involved in JA metabolism or signaling transduction can also affect nicotine biosynthesis [25]. SQUAMOSA promoter binding protein-like (SPL) proteins are plant-specific transcription factors, which regulate plant growth, development, and secondary metabolism, as well as respond to exogenous hormone treatments, such as JA [25]. In Arabidopsis, SPL9 was reported to negatively regulate JA response through interaction with JAZ proteins [26]. In tobacco, the expression level of miR156 and other miRNAs was significantly repressed by topping treatment [27], suggesting that overexpression of a miR156-targeted SPL gene could benefit nicotine biosynthesis. The MsSPL12 gene is a target gene of miR156 in alfalfa (Medicago sativa) and was reported to respond to various stresses [28]. This raises an interesting question regarding the role that MsSPL12 may play in plant secondary metabolism. To this end, we investigated whether overexpression of the MsSPL12 gene would affect nicotine accumulation and the expression of nicotine biosynthesis-related genes in a heterologous system.
In this study, we firstly optimized the hairy root induction system of tobacco (‘Coker176’) by investigating the effects of explant age, R. rhizogenes strains, and medium compositions on hairy root induction efficiency. The optimized system was then used for functional characterization of the alfalfa MsSPL12 gene. We showed that MsSPL12 overexpression in tobacco hairy root significantly improved nicotine biosynthesis.

2. Materials and Methods

2.1. Plant Materials and Culture Conditions

Seeds of the tobacco (Nicotiana tabacum) ‘Coker176’ used in this study were rinsed in 75% (v/v) ethanol for 60 s, sterilized in 5% (v/v) sodium hypochlorite (NaClO) for 10 min, washed five times in sterile water, and then placed on solid 2/3 MS medium (pH 5.8) containing 20 g/L sucrose and 8.0 g/L agar (Sigma) [29] for germination. The plant materials were cultured at 25 °C under a photoperiod of 16 h light/8 h dark, with a light intensity of 100 µmol·m−2·s−1, unless otherwise mentioned. The leaves of the 2 week old, 4 week old, and 8 week old tobacco plants (Figure 1a–c) were used as explants for R. rhizogenes infection.

2.2. R. rhizogenes Strains and Hairy Root Induction

Three R. rhizogenes strains, R1601 (kanamycin resistance), K599 (streptomycin resistance), and LBA9402 (rifampicin resistance), which could effectively induce hairy root on peanut [30], soybean [31], and Papaver somniferum (Le Flem-Bonhomme et al., 2004), respectively, were used to infect tobacco leaf discs. Single colonies of the three R. rhizogenes strains were incubated in YEP liquid medium [32] (containing kanamycin 100 mg/L, streptomycin 50 mg/L, and rifampicin 50 mg/L) in a shaker (Taichang THZ-C-1, Jiangsu, China) at 28 °C, 200 r/min. When the optical density at 600 nm wavelength (OD600) measured by an ultraviolet/visible spectrophotometer (PGeneral, Beijing, China) reached 0.8, R. rhizogenes bacteria were collected by centrifuge at 3000 rpm for 10 min, and then resuspended in liquid 2/3MS medium to 0.6 at OD600, followed by the addition of 100 μM acetosyringone.
To compare the effects of leaf age and different R. rhizogenes strains on hairy root induction, leaf discs (about 0.5 × 0.5 cm2) of 2, 4, and 8 week old tobacco plants (Figure 1a–c) were used as explants for R. rhizogenes infection. After cutting with a scalpel in a laminar flowhood, the explants were soaked in R. rhizogenes suspension for 20 min, and then blotted on a sterilized paper towel. Cocultivation was performed in the dark on 2/3MS solid medium with 20 g/L sucrose and 100 μM acetosyringone for 3 days. One layer of sterilized filter paper was placed on the surface of the cocultivation medium to avoid bacteria overgrowth (Figure 1d). After cocultivation, the explants were cleaned with sterile water containing 500 mg/L cefotaxime, briefly dried on sterilized filter paper, and then transferred onto 2/3MS solid medium with 500 mg/L cefotaxime for culture in dark, at 25 °C, until hairy roots were induced.
To compare the effects of organic ingredients on hairy root induction, 2/3MS medium supplemented with 0.5 g/L glutamine (2/3MS-g) or 0.5 g/L glutamine and 0.5 g/L casein acid hydrolysate (2/3MS-gh) was used for hairy root induction after R. rhizogenes strain LBA9402 infection of the 4 week old explants. The number of leaf discs that had a hairy root and the total number of induced hairy roots were recorded to calculate the hairy root induction rate and mean number of hairy root per leaf disc, respectively, 4 weeks after root induction. Three independent infection experiments were treated as three biological replicates with each one having at least 30 leaf discs.

2.3. Expression of Foreign Genes in Tobacco Hairy Root

To test whether R. rhizogenes strain LBA9402 could be used as a cargo for foreign gene delivery into hairy roots, R. rhizogenes strain LBA9402 harboring the binary vector pCAMBIA1305.1 or pZH01-MsSPL12 was used to infect the 4 month old leaf discs to introduce and express foreign genes in tobacco hairy root. The pZH01-MsSPL12 vector was constructed by inserting the full-length cDNA of MsSPL12 (XM_003601719.2) between the restriction sites BamHI and Kpn I of the vector pZH01 [33]. MsSPL12 was amplified by a PCR reaction with a pair of primers, MsSPL12-BamHI-F (5′–GGATCCATGGAGTGGAACGTGAAATCTCCCG–3′) and MsSPL12-KpnI-R (5′–GGTACCTTAATCCAGCTGGTTGCAAGGGAAAC–3′). When grown to 2–3 cm long, the hairy root was separated from the leaf disc and cultured on the same solid medium containing 10 mg/L hygromycin for selection. The selected hairy root grown to about 5 cm long was transferred into a 150 mL Erlenmeyer containing liquid selective medium and cultured at 70 r/min in an incubation shaker for further growth (25 °C, dark). The liquid selective medium was renewed every 2 weeks.

2.4. Transgenic Hairy Root Verification

Genomic DNA of the hairy roots was extracted by the CTAB method [34] for PCR analysis to verify the resistant hairy root containing the GUS gene or MsSPL12 gene. The primers used were designed using software Primer premier 5 [35] and are listed in Table S1. The PCR-positive hairy roots transformed with the pCAMBIA1305.1 vector were also subjected to a GUS staining assay [36]. The number of hairy roots that showed blue color was counted. The transformation efficiency was calculated according to the GUS staining assay results of the hairy roots transformed with the pCAMBIA1305.1 vector (http://www.cambia.org accessed on 12 December 2022)and the PCR test results for the transformation with the pZH01-MsSPL12 vector.

2.5. RNA Extraction and Quantitative RT-PCR

Total RNA of the hairy roots was extracted with Trizol reagent (Thermo Fisher Scientific, San Jose, CA, USA). One microgram of total RNA was used for reverse transcription to synthesize the first strand of the cDNA according to the manufacturer’s instructions (PrimeScript RT Reagent Kit with gDNA Erase, TAKARA, Dalian, China RR047A). The cDNA was used as template to analyze the expression of genes related to nicotine synthesis by real-time quantitative PCR (RT-qPCR) using SYBR green supermix (Takara, Dalian, China RR420). To test the effects of JA on the expression of nicotine biosynthesis-related genes, 100 μM MeJA (Sigma-Aldrich, St. Louis, MO, USA) was added into the hairy root culture medium for 1 h, and the hairy roots were then collected for RNA extraction [21]. The primers used for RT-qPCR were designed using Primer premier 5 software and are listed in Table S2. The relative expression level of nicotine biosynthesis-related genes with 100 μM MeJA treatment compared with no MeJA treatment was calculated using the 2−∆∆Ct method [37]. A tobacco Actin gene (X63603) was used as an internal control to normalize gene expression [21]. Data from at least three biological replicates with each one having at least 30 leaf discs were used for statistical analyses in the experiments.

2.6. Determination of Nicotine Content

Nicotine content of the hairy roots was determined by gas chromatography–mass spectrometry using an Agilent HP6890 GC-FID system [38]. Two month old hairy root samples were collected and dried at 65 °C for 72 h, and then ground to fine powder. Fifty milligrams of powder of each sample was weighted for nicotine content measurement (YC/T 383-2010) in Yuxi Jiahui Detection Technology Co. Four independent tests (replicates) were performed for each sample.

3. Statistical Analysis

All data were collected from at least three biological replicates. One-way analysis of variance (ANOVA) was used for data analysis. Means were compared by Duncan’s multiple range test (p < 0.05). The proc GLM for ANOVA of SAS 8.2 (SAS Institute, Cary, NC, USA) was used for the analyses.

4. Results

4.1. Effects of the Explant Age and R. rhizogenes Strains on Hairy Root Induction

Upon 1 month of cultivation, obvious hairy roots grew out from the edges of the leaf discs. The explants infected with LBA9402 showed the best hairy root growth, followed by K599 and R1601 (Figure 1e–g). We noticed the explants from the 2 week old leaves became necrotic easily after cocultivation, and the hairy root induction rate was the lowest compared to the other transformations (Figure 2). The hairy root induction rates of the 4 and 8 week old explants showed no significant difference when infected with the same R. rhizogenes strain, whereas the hairy root induction rates with the infection of different R. rhizogenes strains showed a significant difference. The R. rhizogenes strain LBA9402 exhibited the highest hairy root induction rate (up to 80%) using the 4 and 8 week old tobacco leaf disc explants, followed by the R. rhizogenes strain K599 with a hairy root induction rate of about 50%. The highest hairy root induction rate obtained using the R. rhizogenes strain R1601 was only 15% (Figure 2). The results suggest that the strain LBA9402 is more suitable for hairy root induction for tobacco ‘Coker176’.

4.2. Effects of Medium Additives on Hairy Roots Induction

We studied the effects of organic ingredients on the efficiency of hairy root induction for 4 week old leaf discs by R. rhizogenes strain LBA9402 infection. Glutamine (2/3MS-g) or glutamine and casein acid hydrolysates (CH) (2/3MS-gh) were added to the 2/3MS medium during hair root induction and further growth. Intriguingly, the additional organic components reduced the hairy root induction compared to 2/3MS medium (Figure 3). The hairy root induction rate and the number of hairy roots per leaf disc generated on 2/3MS medium without additives were significantly higher than those on medium supplied with additives. Thus, 2/3MS medium without additional CH or glutamine was optimal for tobacco hairy root induction.

4.3. R. rhizogenes Strain LBA9402 as a Cargo for Foreign Gene Delivery and Expression in Hairy Root

The resistant hairy roots resulting from the transformation by R. rhizogenes strain LBA9402 harboring the binary vector pCAMBIA1305.1 were subjected to PCR targeting the GUS gene for transformation analysis. As shown in Figure 4a, 12 out of 14 randomly selected hairy root lines showed the target band. The PCR-positive hairy roots also showed a strong blue color in GUS staining assay (Figure 4b), indicating that the foreign gene was stably expressed. About 85% of hairy roots stained positively in the GUS assay (Figure 4c).

4.4. Expression of Genes Related to Nicotine Biosynthesis in Hairy Roots

JA has previously been reported to induce the expression of nicotine biosynthesis-related genes in tobacco. To examine how JA would impact gene expression in hairy roots, we applied 100 μM MeJA to the transgenic lines harboring pCAMBIA1305.1 and analyzed the expression of 11 nicotine synthesis-related genes before and 1 h after MeJA treatment by RT-qPCR. The results showed that MeJA treatment led to a significant upregulation of the genes tested (Figure 5), of which NtAO, NtODC2, NtPMT1a, and NtQS were strongly upregulated, while NtA622, NtERF189, NtMATE1, NtMATE2, and NtQPT were moderately upregulated, and NtMPO1 and NtBBLa were slightly upregulated.

4.5. Effects of Overexpression of MsSPL12 on Nicotine Biosynthesis in Tobacco Hairy Roots

To test the effects of MsSPL12 overexpression on nicotine biosynthesis, we generated MsSPL12 transgenic hairy roots by R. rhizogenes strain LBA9402-mediated transformation. Of the nine potential transgenic hairy root lines randomly selected for PCR, seven contained the MsSPL12 gene (Figure 6a). Analysis of the two transgenic lines (OE-1 and OE-2) with the highest MsSPL12 expression (Figure 6b) revealed that, upon 4 weeks of culture, the hairy roots of the OE-1 and OE-2 were much browner and exhibited less growth, but significantly higher nicotine accumulation than those of the WT. The nicotine contents of the tested transgenic line OE-1 and OE-2 were 1.38 mg/g and 1.85 mg/g, respectively, while that of WT was only 0.51 mg/g. Although insignificant, MsSPL12 expression in OE-2 was higher than that in OE-1, which correlated well with the significantly higher nicotine accumulation in OE-2 than in OE-1. Clearly, overexpression of the MsSPL12 gene significantly improved the nicotine biosynthesis in the transgenic tobacco hairy roots. Expression analysis of the nicotine biosynthesis-related genes indicated that NtMPO2 was induced significantly, NtBBLa and NtERF189 had no significant changes, and NtA662, NtAO, NtERF91, NtMATE1, NtMATE2, NtMPO1, NtODC2, NtPMT1a, NtQPT2, NtQS, and NtMYC2a were significantly downregulated in OE-1 and OE-2 compared to WT (Figure 6d). Obviously, overexpression of MsSPL12 had profound effects on the expression of the nicotine biosynthesis-related genes.

5. Discussion

Tobacco ‘Coker176’ is highly resistant to tobacco mosaic virus (TMV) and suitable for use in research. A fast and highly efficient hairy root culture system is desirable for high-throughput gene function studies in tobacco. To this end, we investigated the effects of R. rhizogenes stain, explant age, and medium additives on hairy root induction in ‘Coker176’ and established an optimized system for hairy root generation and genetic transformation.
Leaves are often used as explants for R. rhizogenes-mediated transformation in different species [39,40]. In this study, we observed that hairy roots were initiated from the vein at the edges of the leaf discs, and the age of explants affected hairy root induction. Four and 8 week old plants had well developed leaves and leaf veins, which benefited the induction of hairy roots. On the contrary, the 2 week old tobacco plants had younger leaves and leaf vascular bundles which may not be ideal for hairy root induction. The hairy induction rate for 2 week old tobacco leaf as explants was less than 15%, even with the best-performing strain LBA9402. Consistent with our observations, hairy roots were previously reported to be often formed from vascular bundles [39,40]. For an optimized experimental turnover, it is recommended to use leaves of the 4 week old plants instead of those of the 8 week old ones as explants, as they performed similarly in hairy root induction.
R. rhizogenes strains used for explant infection were also found to significantly impact hairy root induction [14,41]. It is, therefore, interesting to examine hairy root induction efficiency on different media. Hairy roots are normally induced using hormone-free MS solid medium [42,43], although liquid medium has also been used for hairy root proliferation [44]. In this study, the transgenic hairy roots grew well in liquid medium supplemented with hygromycine, and foreign gene insertion and expression were also confirmed by PCR and GUS staining assays. The results suggested that the optimized tobacco hairy root induction system could be used for gene function study.
JA and MeJA are both regulators of nicotine synthesis and can quickly induce the expression of genes encoding enzymes in nicotine biosynthesis [45,46]. In this experiment, 11 nicotine biosynthesis and transport-related genes were upregulated to certain degrees after JA treatment. The expression of four genes (NtAO, NtODC2, NtPMT1a, and NtQS) was significantly induced. Putrescine N-methyltransferase (PMT) and ornithine decarboxylase (ODC) play important roles in the creation of the pyrrolidine ring of nicotine. Aspartate oxidase (AO), quinolinate synthase (QS), and quinolinate phosphoribosyltransferase (QPT) are responsible for the formation of the pyridine ring of nicotine [47,48]. Expression manipulation of the genes encoding these enzymes could serve as an alternative way to control tobacco nicotine biosynthesis.
The SPL transcription factors have previously been implicated in regulating plant growth and stress resistance, as well as the production of secondary metabolites [49,50]. Overexpression of SmSPL6 gene induced phenolic acid biosynthesis and affected root development in Salvia miltiorrhiza [25]. Overexpression of AaSPL2 increased the artemisinin content of transgenic plants [51]. Intriguingly, we found that the hairy roots of MsSPL12 transgenic lines easily turned brown compared to the control hairy roots expressing GUS in liquid culture medium, suggesting the MsSPL12 transgenic lines might produce more abundant secondary metabolites [50]. Overexpression of MsSPL12 significantly increased nicotine content of tobacco hairy roots. However, unlike NtMPO2 which was significantly upregulated compared to WT controls, the expression of NtBBLa and NtERF189 exhibited no significant change, and other nicotine biosynthesis-related genes showed significantly downregulated expression compared to WT controls. MPO is responsible for regulating the deamination of N-methylputrescine as one of the steps converting the ornithine ring to a pyrrolidine ring [52]. BBL acts on the final stage of condensation of the two rings to produce nicotine. ERF189 is a transcription factor that responds to JA [53,54]. Considering that the expression of all the other tested genes in the nicotine synthesis pathway was declined, upregulation of NtMPO2 expression was probably responsible, at least partially, for the increased nicotine accumulation in MsSPL12 transgenic hairy roots. It was previously reported that overexpression of NtAOC2, NtPMT1a, and NtQPT2 did not significantly change the nicotine content [55,56]. Nicotine biosynthesis, therefore, could be synergistically regulated at many levels. The expression of genes in the nicotine synthesis pathway could be feedback-regulated by the nicotine itself [25]. Overexpression of MsSPL12 caused nicotine accumulation in hairy roots, but the detailed regulatory mechanism is yet to be revealed.
Overall, our study suggests that highly efficient tobacco hairy root induction and genetic transformation could be achieved using 4 week old ‘Coker176’ tobacco leaf discs on 2/3MS medium with R. rhizogenes strain LBA9402 infection. The key genes in the nicotine biosynthesis pathway could be significantly induced using MeJA treatment, and overexpression of the MsSPL12 gene in tobacco hairy roots could increase nicotine biosynthesis. The system reported here could also be used for the functional characterization of genes involved in nicotine biosynthesis and metabolism.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/agronomy12020348/s1, Table S1: Primers used for PCR tests; Table S2: Sequence-specific primers used for qPCR tests.

Author Contributions

B.W. and W.Z. designed the experiments; S.Q., Y.L., J.Y. and S.L. performed the experiments; S.Q., Y.L., B.W. and W.Z. analyzed the data; S.Q., W.Z. and B.W. wrote the paper. All authors have read and agreed to the published version of the manuscript.

Funding

The work was funded by the Yunnan Tobacco Company (2018530000241001).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We are thankful to Chunxiang Fu of Qingdao Institute of Bioenergy and Bioprocess Technology, Chinese Academy of Science for providing the R. rhizogenes strains. We thank Hong Luo of Clemson University for reading the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Flores-Felix, J.D.; Menendez, E.; Peix, A.; Garcia-Fraile, P.; Velazquez, E. History and current taxonomic status of genus Agrobacterium. Syst Appl. Microbiol. 2020, 43, 126046. [Google Scholar] [CrossRef] [PubMed]
  2. Wallaart, T.E.; Pras, N.; Quax, W.J. Isolation and identification of dihydroartemisinic acid hydroperoxide from Artemisia annua: A novel biosynthetic precursor of Artemisinin. J. Nat. Prod. 1999, 62, 1160–1162. [Google Scholar] [CrossRef] [PubMed]
  3. Chahardoli, M.; Fazeli, A.; Ghabooli, M. Recombinant production of bovine lactoferrin-derived antimicrobial peptide in tobacco hairy roots expression system. Plant Physiol. Bioch. 2018, 123, 414–421. [Google Scholar] [CrossRef] [PubMed]
  4. Zhou, M.L.; Zhu, X.; Shao, J.; Wu, Y.; Tang, Y. Transcriptional response of the catharanthine biosynthesis pathway to methyl jasmonate/nitric oxide elicitation in Catharanthus roseus hairy root culture. Appl. Microbiol. Biot. 2010, 88, 737–750. [Google Scholar] [CrossRef] [PubMed]
  5. Sharma, P.; Padh, H.; Shrivastava, N. Hairy root cultures: A suitable biological system for studying secondary metabolic pathways in plants. Eng. Life Sci. 2013, 13, 62–75. [Google Scholar] [CrossRef]
  6. Hou, X.J.; Li, J.M.; Liu, B.L.; Wei, L. Co-expression of basic helix–loop–helix protein (bHLH) and transcriptional activator-Myb genes induced anthocyanin biosynthesis in hairy root culture of Nicotiana tabacum L. and Ipomea tricolor. Acta. Physiol. Plant 2017, 39, 59. [Google Scholar] [CrossRef]
  7. Hidalgo, D.; Georgiev, M.; Marchev, A.; Bru-Martínez, R.; Cusido, R.M.; Corchete, P.; Palazon, J. Tailoring tobacco hairy root metabolism for the production of stilbenes. Sci. Rep. 2017, 7, 17976. [Google Scholar] [CrossRef]
  8. Alderete, L.G.S.; Guido, M.E.; Agostini, E.; Mas, P. Identification and characterization of key circadian clock genes of tobacco hairy roots: Putative regulatory role in xenobiotic metabolism. Environ Sci. Pollut. R. 2018, 25, 1597–1608. [Google Scholar] [CrossRef] [Green Version]
  9. Daspute, A.A.; Yunxuan, X.; Gu, M.; Kobaysshi, Y.; Wagh, S.; Panche, A.; Koyama, H. Agrobacterium rhizogenes -mediated hairy roots transformation as a tool for exploring aluminum-responsive genes function. Future Sci. OA 2019, 5, 3. [Google Scholar] [CrossRef] [Green Version]
  10. Pilaisangsuree, V.; Anuwan, P.; Supdensong, K.; Lumpa, P.; Kongbangkerd, A.; Limmongkon, A. Enhancement of adaptive response in peanut hairy root by exogenous signalling molecules under cadmium stress. J. Plant Physiol. 2020, 254, 153278. [Google Scholar] [CrossRef]
  11. Zipfel, C. Pattern-recognization receptors in plant innate immunity. Curr. Opin. Immunol. 2008, 20, 10–16. [Google Scholar] [CrossRef] [PubMed]
  12. Zhang, W.; Dewey, R.E.; Boss, W.; Phillippy, B.Q.; Qu, R.D. Enhanced Agrobacterium-mediated transformation effificiencies in monocot cells is associated with attenuated defense responses. Plant Mol. Biol. 2013, 81, 273–286. [Google Scholar] [CrossRef] [PubMed]
  13. Thwe, A.; Arasu, M.V.; Li, X.; Park, C.H.; Kim, S.J.; Al-Dhabi, N.A.; Park, S.U. Effect of different Agrobacterium rhizogenes strains on hairy root induction and phenylpropanoid biosynthesis in tartary buckwheat (Fagopyrum tataricum Gaertn). Front Microbiol. 2016, 7, 318. [Google Scholar] [CrossRef] [PubMed]
  14. Park, C.H.; Zhao, S.; Yeo, H.J.; Park, Y.E.; Baska, T.B.; Arasu, M.V.; Al-Dhabi, N.A.; Park, S.U. Comparison of different strains of Agrobacterium rhizogenes for hairy root induction and betulin and betulinic acid production in Morusalba. Nat. Prod. Commun. 2017, 12, 1934578X1701200403. [Google Scholar] [CrossRef] [Green Version]
  15. Surendra, K.; Kakoli, B. A comparative study of hairy root culture induction efficiency in four medicinally important plants using Agrobacterium rhizogenes. Int. J. Curr. Microbiol. Appl. Sci. 2014, 3, 625–633. [Google Scholar]
  16. Le Flem-Bonhomme, V.; Laurain-Mattar, D.; Fliniaux, M.A. Hairy root induction of Papaver somniferum var. album, a difficult-to-transform plant, by A. rhizogenes LBA 9402. Planta 2004, 218, 890–893. [Google Scholar] [CrossRef] [PubMed]
  17. Cheng, Y.; Wang, X.; Cao, L.; Ji, J.; Liu, T.; Duan, K. Highly efficient Agrobacterium rhizogenes-mediated hairy root transformation for gene functional and gene editing analysis in soybean. Plant Methods 2021, 17, 73. [Google Scholar] [CrossRef]
  18. Rana, M.M.; Han, Z.X.; Song, D.P.; Liu, G.F.; Li, D.X.; Wan, X.C.; Karthikeyan, A.; Wei, S. Effect of medium supplements on Agrobacterium rhizogenes mediated hairy root induction from the callus tissues of camellia sinensis var. sinensis. Int. J. Mol. Sci. 2016, 17, 1132. [Google Scholar] [CrossRef] [Green Version]
  19. Saunders, J.A. Investigations of vacuoles isolated from tobacco: I. Quantitation of nicotine. Plant Physiol. 1979, 64, 74–78. [Google Scholar] [CrossRef] [Green Version]
  20. Baldwin, I.T. Mechanism of damage-induced alkaloid production in wild tobacco. J. Chem. Ecol. 1989, 15, 1661–1680. [Google Scholar] [CrossRef]
  21. Sui, X.; He, X.; Song, Z.; Gao, Y.; Zhao, L.; Jiao, F.; Kong, G.; Li, Y.; Han, S.; Wang, B. The gene NtMYC2a acts as a‘master switch’in the regulation of JA-induced nicotine accumulation in tobacco. Plant Biol. 2021, 23, 317–326. [Google Scholar] [CrossRef] [PubMed]
  22. Afrin, S.; Huang, J.J.; Luo, Z.Y. JA-mediated transcriptional regulation of secondary metabolism in medicinal plants. Sci. Bull. 2015, 60, 1062. [Google Scholar] [CrossRef] [Green Version]
  23. Chen, X.; Wang, D.D.; Fang, X.; Chen, X.; Mao, Y. Plant specialized metabolism regulated by jasmonate signaling. Plant Cell Physiol. 2019, 60, 2638–2647. [Google Scholar] [CrossRef] [PubMed]
  24. Shoji, T.; Hashimoto, T. Expression of a tobacco nicotine biosynthesis gene depends on the JRE4 transcription factor in heterogenous tomato. J. Plant Res. 2019, 132, 173–180. [Google Scholar] [CrossRef]
  25. Cao, Y.; Chen, R.; Wang, W.; Gao, X. SmSPL6 induces phenolic acid biosynthesis and affects root development in Salvia miltiorrhiza. Int. J. Mol. Sci. 2021, 22, 7895. [Google Scholar] [CrossRef] [PubMed]
  26. Mao, Y.B.; Liu, Y.Q.; Chen, D.Y.; Chen, F.Y.; Fang, X.; Hong, G.J.; Wang, L.J.; Wang, J.W.; Chen, X.Y. Jasmonate response decay and defense metabolite accumulation contributes to age-regulated dynamics of plant insect resistance. Nat. Commun. 2017, 8, 13925. [Google Scholar] [CrossRef] [Green Version]
  27. Guo, H.; Kan, Y.; Liu, W. Differential expression of miRNAs in response to topping in flue-cured tobacco (Nicotiana tabacum) roots. PLoS ONE 2011, 6, e28565. [Google Scholar] [CrossRef] [Green Version]
  28. Wang, K.; Liu, Y.; Teng, F.; Cen, H.; Yan, J.; Lin, S.; Li, D.; Zhang, W. Heterogeneous expression of Osa-MIR156bc increases abiotic stress resistance and forage quality of alfalfa. Crop J. 2021, 9, 1135–1144. [Google Scholar] [CrossRef]
  29. Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 1962, 15, 473–497. [Google Scholar] [CrossRef]
  30. Kim, J.S.; Lee, S.Y.; Park, S.U. Resveratrol production in hairy root culture of peanut, Arachis hypogaea L. transformed with different Agrobacterium rhizogenes strains. Afr. J. Biotechnol. 2008, 7, 3788–3790. [Google Scholar]
  31. Cao, D.; Hou, W.; Song, S.; Sun, H.; Wu, C.; Gao, Y.; Han, T. Assessment of conditions affecting Agrobacterium rhizogenes-mediated transformation of soybean. Plant Cell. Tiss. Org. 2009, 96, 45–52. [Google Scholar] [CrossRef]
  32. An, G.; Ebert, P.; Mitra, A.; Ha, S.B. Binary vectors. In Plant Molecular Biology Manual; Gelvin, S.B., Schilperoort, R.A., Eds.; Kluwer Academic: Dordrecht, The Netherlands, 1988; pp. 1–19. [Google Scholar]
  33. Xiao, H.; Wang, Y.; Liu, D.F.; Wang, W.M.; Li, X.; Zhao, X.; Xu, J.; Zhai, W.; Zhu, L. Functional analysis of the rice AP3 homologue OsMADS16 by RNA interference. Plant Mol. Biol. 2003, 52, 957–966. [Google Scholar] [CrossRef] [PubMed]
  34. Liu, Y.; Cen, H.; Yan, J.; Zhang, Y.; Zhang, W. Inside out: High-efficiency plant regeneration and Agrobacterium-mediated transformation of upland and lowland switchgrass cultivars. Plant Cell Rep. 2015, 34, 1099–1108. [Google Scholar] [CrossRef] [PubMed]
  35. Lalitha, S. Primer premier 5. Biotech Softw. Internet Rep. 2000, 1, 270–272. [Google Scholar] [CrossRef]
  36. Jefferson, R. Assaying chimeric genes in plants: The GUS gene fusion system. Plant Mol. Bio. Rep. 1987, 5, 387–405. [Google Scholar] [CrossRef]
  37. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  38. Sui, X.; Zhang, H.; Song, Z.; Gao, Y.; Li, W.; Li, M.; Zhao, L.; Li, Y.; Wang, B. Ethylene response factor NtERF91 positively regulates alkaloid accumulations in tobacco (Nicotiana tabacum L.). Bioch. Bioph. Res. Commun. 2019, 517, 164–171. [Google Scholar] [CrossRef] [PubMed]
  39. Setamam, N.M.; Sidik, N.J.; Rahman, Z.A.; Zain, C.R.C.M. Induction of hairy roots by various strains of Agrobacterium rhizogenes in different types of Capsicum species explants. BMC Res. 2014, 7, 414–579. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  40. Xu, Y.; Cao, Y.; Wang, Y.; Fu, C.; Dai, S. Agrobacterium rhizogenes-mediated transformation system of Spinacia oleracea. Chin. Bull. Bot. 2019, 4, 515–521. [Google Scholar]
  41. Veena, V.; Taylor, C.G. Agrobacterium rhizogenes: Recent developments and promising applications. In Vitro Cell. Dev.-Plant 2007, 43, 383–403. [Google Scholar] [CrossRef]
  42. Shanks, J.V.; Morgan, J. Plant ‘hairy root’ culture. Curr. Opin. Biotech. 1999, 10, 151–155. [Google Scholar] [CrossRef]
  43. Zhou, M.L.; Zhu, X.M.; Shao, J.R.; Tang, Y.X.; Wu, Y.M. Production and metabolic engineering of bioactive substances in plant hairy root culture. Appl. Microbiol. Biot. 2011, 90, 1229–1239. [Google Scholar] [CrossRef] [PubMed]
  44. Sudo, H.; Yamakawa, T.; Yamazaki, M.; Aimi, N.; Saito, K. Bioreactor production of camptothecin by hairy root cultures of Ophiorrhiza pumila. Biotechnol. Lett. 2002, 24, 359–363. [Google Scholar] [CrossRef]
  45. Geyter, N.D.; Gholami, A.; Goormachtig, S.; Goossens, A. Transcriptional machineries in jasmonate-elicited plant secondary metabolism. Trends Plant Sci. 2012, 17, 349–359. [Google Scholar] [CrossRef] [PubMed]
  46. Baldwin, I.T.; Zhang, Z.P.; Diab, N.; Ohnmeiss, T.E.; McCloud, E.S.; Lynds, G.Y.; Schmelz, L.E. Quantification, correlations and manipulations of wound-induced changes in jasmonic acid and nicotine in Nicotiana sylvestris. Planta 1997, 201, 397–404. [Google Scholar] [CrossRef]
  47. Dewey, R.E.; Xie, J. Molecular genetics of alkaloid biosynthesis in nicotiana tabacum. Phytochemistry 2013, 94, 10–27. [Google Scholar] [CrossRef]
  48. Kajikawa, M.; Sierro, N.; Kawaguchi, H.; Bakaher, N.; Ivanov, N.V.; Hashimoto, T.; Shoji, T. Genomic insights into the evolution of the nicotine biosynthesis pathway in tobacco. Plant Physiol. 2017, 174, 999–1011. [Google Scholar] [CrossRef] [Green Version]
  49. Wang, H.; Wang, H.Y. The miR156/SPL module, a regulatory hub and versatile toolbox, gears up crops for enhanced agronomic traits. Mol. Plant 2015, 8, 677–688. [Google Scholar] [CrossRef] [Green Version]
  50. Li, X.Y.; Hou, Y.M.; Xie, X.; Li, H.; Li, X.; Zhu, Y.; Zhai, L.; Zhang, C.; Bian, S. A blueberry MIR156a-SPL12 module coordinates the accumulation of chlorophylls and anthocyanins during fruit ripening. J. Exp. Bot. 2020, 71, 5976–5989. [Google Scholar] [CrossRef]
  51. Lv, Z.Y.; Wang, Y.; Liu, Y.; Peng, B.W.; Zhang, L.; Tang, K.X.; Chen, W.S. The SPB-box transcription factor AaSPL2 positively regulates artemisinin biosynthesis in Artemisia annua L. Front. Plant Sci. 2019, 10, 409. [Google Scholar] [CrossRef] [Green Version]
  52. Katoh, A.; Shoji, T.; Hashimoto, T. Molecular cloning of N-methylputrescine oxidase from tobacco. Plant Cell Physiol. 2007, 48, 550–554. [Google Scholar] [CrossRef] [PubMed]
  53. Kajikawa, M.; Shoji, T.; Kato, A.; Hashimoto, T. Vacuole-localized berberine bridge enzyme-like proteins are required for a late step of nicotine biosynthesis in tobacco. Plant Physiol. 2011, 155, 2010–2022. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  54. Shoji, T.; Kajikawa, M.; Hashimoto, T. Clustered transcription factor genes regulate nicotine biosynthesis in tobacco. Plant Cell 2010, 22, 3390–3409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  55. Wang, B. Factors in Nicotine Biosynthesis in Tobacco. Ph.D. Thesis, North Carolina State University, Raleigh, NC, USA, 2011. [Google Scholar]
  56. Chen, H.X.; Wang, B.W.; Geng, S.S.; Arellano, C.; Chen, S.; Qu, R. Effects of overexpression of jasmonic acid biosynthesis genes on nicotine accumulation in tobacco. Plant Direct. 2018, 1, e00036. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Agronomy 12 00348 g001 550
Figure 1. R. rhizogenes-mediated tobacco hairy root induction: (a) 2 week old tobacco plants’ (b) 4 week old tobacco plants; (c) 8 week old tobacco plants; (d) a typical photograph of 4 week old tobacco leaf discs after cocultivation for 3 days’ (e) induction tobacco hairy roots with R. rhizogen strain LBA9402 for 1 month; (f) induction tobacco hairy roots with R. rhizogen strain K599 for 1 month; (g) induction tobacco hairy roots with R. rhizogen strain R1061 for 1 month; (h) hairy roots inoculated in 2/3 MS liquid medium; (i) growth state of hairy roots cultured in liquid medium for 1 month.
Figure 1. R. rhizogenes-mediated tobacco hairy root induction: (a) 2 week old tobacco plants’ (b) 4 week old tobacco plants; (c) 8 week old tobacco plants; (d) a typical photograph of 4 week old tobacco leaf discs after cocultivation for 3 days’ (e) induction tobacco hairy roots with R. rhizogen strain LBA9402 for 1 month; (f) induction tobacco hairy roots with R. rhizogen strain K599 for 1 month; (g) induction tobacco hairy roots with R. rhizogen strain R1061 for 1 month; (h) hairy roots inoculated in 2/3 MS liquid medium; (i) growth state of hairy roots cultured in liquid medium for 1 month.
Agronomy 12 00348 g001
Agronomy 12 00348 g002 550
Figure 2. Effects of explant age and R. rhizogenes strain on hairy root generation efficiency. The data were statistically analyzed using one-way ANOVA. The data are presented as the mean ± standard error (SE) (n = 3). Different letters indicate a statistically significant difference according to Duncan’s multiple range test (p < 0.05).
Figure 2. Effects of explant age and R. rhizogenes strain on hairy root generation efficiency. The data were statistically analyzed using one-way ANOVA. The data are presented as the mean ± standard error (SE) (n = 3). Different letters indicate a statistically significant difference according to Duncan’s multiple range test (p < 0.05).
Agronomy 12 00348 g002
Agronomy 12 00348 g003 550
Figure 3. Effects of medium supplements on the R. rhizogenes strain LBA9402 hairy root induction: (a) effects of medium supplements on hairy root generation efficiency; (b) number of hairy roots that emerged per leaf disc on different media. The data are presented as mean ± standard error (SE) (n = 3) and were statistically analyzed using one-way ANOVA. The comparison of treatments was conducted using Duncan’s multiple range test (p < 0.05). Different letters indicate a statistically significant difference (p < 0.05).
Figure 3. Effects of medium supplements on the R. rhizogenes strain LBA9402 hairy root induction: (a) effects of medium supplements on hairy root generation efficiency; (b) number of hairy roots that emerged per leaf disc on different media. The data are presented as mean ± standard error (SE) (n = 3) and were statistically analyzed using one-way ANOVA. The comparison of treatments was conducted using Duncan’s multiple range test (p < 0.05). Different letters indicate a statistically significant difference (p < 0.05).
Agronomy 12 00348 g003
Agronomy 12 00348 g004 550
Figure 4. Efficiency of the hairy root transformation by R. rhizogenes strain LBA9402 containing a binary vector pCAMBIA1305.1: (a) PCR targeting GUS gene in hairy roots; (b) a typical picture showing positive (blue) and negative (brown) GUS staining of the hairy roots; (c) efficiency of tobacco hairy root transformation mediated by R. rhizogenes strain LBA9402 cultured on 2/3MS medium.
Figure 4. Efficiency of the hairy root transformation by R. rhizogenes strain LBA9402 containing a binary vector pCAMBIA1305.1: (a) PCR targeting GUS gene in hairy roots; (b) a typical picture showing positive (blue) and negative (brown) GUS staining of the hairy roots; (c) efficiency of tobacco hairy root transformation mediated by R. rhizogenes strain LBA9402 cultured on 2/3MS medium.
Agronomy 12 00348 g004
Agronomy 12 00348 g005 550
Figure 5. Relative expression of nicotine biosynthesis and transport-related genes 1 h after hairy roots were treated with 100 μM MeJA.
Figure 5. Relative expression of nicotine biosynthesis and transport-related genes 1 h after hairy roots were treated with 100 μM MeJA.
Agronomy 12 00348 g005
Agronomy 12 00348 g006 550
Figure 6. Overexpression of MsSPL12 in tobacco hairy roots led to enhanced nicotine production and altered expression of nicotine biosynthesis and transport related genes: (a) PCR targeting MsSPL12 in tobacco hairy roots; (b) RT-qPCR test revealing the relative expression level of MsSPL12 in different lines of hairy roots; (c) the content of nicotine in hairy roots; (d) RT-qPCR test revealing the relative expression of nicotine synthesis and transport related genes in wild-type roots (control) and transgenic hairy roots overexpressing MsSPL12. The data are presented as the mean ± standard error (SE) (n = 3) and were statistically analyzed using one-way ANOVA. The comparison of treatments was conducted using Duncan’s multiple range test (p < 0.05). Different letters indicate a statistically significant difference (p < 0.05).
Figure 6. Overexpression of MsSPL12 in tobacco hairy roots led to enhanced nicotine production and altered expression of nicotine biosynthesis and transport related genes: (a) PCR targeting MsSPL12 in tobacco hairy roots; (b) RT-qPCR test revealing the relative expression level of MsSPL12 in different lines of hairy roots; (c) the content of nicotine in hairy roots; (d) RT-qPCR test revealing the relative expression of nicotine synthesis and transport related genes in wild-type roots (control) and transgenic hairy roots overexpressing MsSPL12. The data are presented as the mean ± standard error (SE) (n = 3) and were statistically analyzed using one-way ANOVA. The comparison of treatments was conducted using Duncan’s multiple range test (p < 0.05). Different letters indicate a statistically significant difference (p < 0.05).
Agronomy 12 00348 g006
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Qin, S.; Liu, Y.; Yan, J.; Lin, S.; Zhang, W.; Wang, B. An Optimized Tobacco Hairy Root Induction System for Functional Analysis of Nicotine Biosynthesis-Related Genes. Agronomy 2022, 12, 348. https://doi.org/10.3390/agronomy12020348

AMA Style

Qin S, Liu Y, Yan J, Lin S, Zhang W, Wang B. An Optimized Tobacco Hairy Root Induction System for Functional Analysis of Nicotine Biosynthesis-Related Genes. Agronomy. 2022; 12(2):348. https://doi.org/10.3390/agronomy12020348

Chicago/Turabian Style

Qin, Shangqian, Yanrong Liu, Jianping Yan, Shiwen Lin, Wanjun Zhang, and Bingwu Wang. 2022. "An Optimized Tobacco Hairy Root Induction System for Functional Analysis of Nicotine Biosynthesis-Related Genes" Agronomy 12, no. 2: 348. https://doi.org/10.3390/agronomy12020348

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop